| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Priority Reports |
-Radiation and the Benzene Metabolite Hydroquinone
Division of Pathology and Neuroscience, University of Dundee Medical School, Dundee, United Kingdom
Requests for reprints: Eric G. Wright, Cancer Biology and Clinical Pathology Unit, Division of Pathology and Neurosciences, University of Dundee, Ninewells Hospital and Medical School, Dundee, DD1 9SY, United Kingdom. Phone: 44-1382-632169; Fax: 44-1382-633952; E-mail: e.g.wright{at}dundee.ac.uk.
| Abstract |
|---|
|
|
|---|
-radiation can induce a persisting genomic instability in the clonal descendants of hemopoietic stem cells manifested as a high frequency of nonclonal chromosome and chromatid aberrations. A strikingly similar instability is shown after exposure to the benzene metabolite hydroquinone. The CBA/Ca but not the C57BL/6 genotype is susceptible to the induction of instability by both ionizing radiation and hydroquinone and exposure of CBA/Ca, but not C57BL/6, mice to either agent is known to be associated with the development of AML. The results are consistent with the proposal that chromosomal instability induced by either agent may contribute to AML development by increasing the number of genetic lesions in hemopoietic cells. Genotype-dependent chromosomal instability can be induced by hydroquinone doses that are not acutely stem cell toxic and this may have important implications for current assessment of safe levels of exposure to benzene as well as for mechanistic understanding of the hemotoxic and leukemogenic effects. | Introduction |
|---|
|
|
|---|
Cytotoxic and genetic changes are readily shown in irradiated cells but there is now a substantial body of evidence that high frequencies of chromosome aberrations and gene mutations may be shown in unirradiated cells that are the progeny of cells exposed to ionizing radiation many cell divisions previously. These delayed effects are manifestations of radiation-induced genomic instability (1012). The induction of radiation-induced chromosomal instability in hemopoietic cells from CBA strains of mice can be shown as nonclonal chromosome and chromatid-type aberrations in the clonal progeny of hemopoietic stem cells (13), but the relationship of inducible instability and AML induction is not known. We now report that both
-irradiation and hydroquinone induce chromosomal instability in a genotype-dependent manner and that induction by hydroquinone can be by doses that are not acutely toxic to stem cells. The induction of this genotype-dependent phenotype by such disparate agents, both of which are implicated in the induction of AML together with the significant susceptibility of the CBA strain both to chromosomal instability and to AML supports the view that such instability may contribute to disease development.
| Materials and Methods |
|---|
|
|
|---|
-irradiated at a dose rate of 0.45 Gy/min using a CIS Bio International 637 Cesium irradiator to a total dose of 4 Gy, a potentially leukemogenic dose for CBA strains of mice (7). Sham-treated controls were also obtained.
Cell assays. An in vitro clonogenic assay, operationally defined as the colony-forming units in agar (CFU-A) assay, was used to obtain clones of cells derived from members of the hemopoietic stem cell compartment as described previously (14). Cells were plated in 45-mm vented Petri dishes (Sterilin, Stone, United Kingdom) containing 2 mL modified alpha Eagles medium (Life Technologies, Gaithersburg, MD) supplemented with 25% pretested horse serum (Sera-Lab), 50 µg/mL streptomycin, 50 IU penicillin, 2 mmol/L L-glutamine, and 0.3% low melting point agarose (Life Technologies) and conditioned medium from the AF1.19T and L929 cell lines batch tested to provide maximal colony-stimulating activity. Cultures were incubated for 11 to 12 days at 37°C in a fully humidified atmosphere of 5% CO2 in air to obtain mixed lineage colonies of
2-mm diameter. An in vivo clonogenic assay, operationally defined as the spleen CFU (CFU-S) assay that detects the same cell type as the in vitro CFU-A assay (14), was also used to obtain clones of cells derived from members of the hemopoietic stem cell compartment. Male cells were resuspended at 2.5 x 105 cells/mL and 0.2-mL aliqouts injected into the dorsal tail vein of each of six to eight female recipients conditioned with 9-Gy
-radiation. On days 10 to 11, spleens were obtained, individual colonies dissected out, and cell suspensions obtained for cytogenetic analyses. In addition to confirming the presence of Y chromosome in scored metaphases, each colony was checked for evidence of donor origin using a PCR-based technique. A small aliquot of each colony (
50,000 cells) was added to two volumes of NSD buffer [10 mmol/L Tris-HCl (pH 8.0), 0.5 mmol/L EDTA (pH 8.0), 1% N-laurly sarcosyl], vortexed, and kept on ice for 10 minutes before proteinase K (5 µg/mL overnight at 42°C) and RNAase A treatment (100 µg/mL for 1 hour at 37°C). DNA was extracted using phenol/chloroform and was precipitated overnight at 20°C in 0.3 mol/L sodium acetate, 65% ethanol. Samples were spun at 31,000 rpm (43 000 x g) for 1 hour at 4°C, washed once with 70% ethanol and spun for a further 20 minutes at 4°C before air drying and redissolving the pellet in 10 µL TE 1/0.1 pH 8.0. PCR reactions were done on a Hybaid Omni thermal cycler in 25-µL reaction volumes using the primers YF, CCTATTGCATGGACTGCAGCTTA and YR, GACTAGACATGTCTTAACATCTG (Sigma Genosys, The Woodlands, TX) at 0.5 µmol/L using 1.25 units HotStarTaq (Qiagen, Chatsworth, CA), 1.5 mmol/L MgCl2, and 200 µmol/L deoxynucleotide triphosphate's. Following a 15-minute cycle at 95°C, 30 cycles of 1-minute segments with the following reaction conditions were done: 95°C, 60°C, and 72°C. A product of
200 bp was visualized by UV light on a 3% agarose gel using ethidium bromide. Positive and negative controls plus blank samples were included in each run.
Cytogenetic analysis. Cells to which Colcemid had been added at final concentration of 0.02 µg/mL were incubated for one hour at 37°C. The cells were resuspended in 5 mL hypotonic potassium chloride (0.5%) for 30 minutes before adding 2 mL sodium citrate/potassium chloride and incubating for a further 8 minutes. Two to 3 mL of fixative (methanol/acetic acid, 3:1) was added and the sample inverted once. After 10 to 15 minutes, the cells were resuspended in fixative. At least two further washes in fixative were done before the cells were dropped onto precleaned glass slides. The slides were air dried and aged for 14 days before stained with Giemsa (diluted 1:4 with distilled water and filtered) for 15 to 20 minutes. Coded samples were scored for karyotypic abnormalities and at the completion of scoring, treatments were assigned to the coded data and differences between the proportions of aberrant cells at each harvesting point were analyzed by the Fisher's exact test.
| Results |
|---|
|
|
|---|
|
106 cells were processed for cytogenetic studies; the results are summarized in Table 1. In the in vivo colonies derived from sham-treated control CBA/Ca bone marrow, the frequency of cells with unstable aberrations (chromatid breaks, chromosome fragments and minutes) was
3%. In colonies initiated from cell exposed to 10 or 300 µmol/L hydroquinone, the incidence of unstable aberrations was significantly increased relative to the control group (8.5%, P = 6 x 106 and 7.0%, P = 1. 6 x 103, respectively). However, there was no evidence of dose dependency as there was no significant difference between the level of instability after 10 µmol/L treatment and after 300 µmol/L treatment (8.5% and 7.0%, P = 0.2045).
|
2%; not significantly different from CBA/Ca controls (P = 0.1361). In colonies initiated from cells exposed to 10 or 300 µmol/L hydroquinone, the incidence of unstable aberrations was not significantly increased relative to controls (3.0%, P = 0.8912 and 1.3%, P = 0.2858, respectively).
Colonies derived from
-irradiated clonogenic cells of both genotypes exhibited levels of instability greater than their respective controls (for CBA/Ca cells, 12.9% versus 3.1%, P < 1.0 x 107 and for C57BL/6 cells, 4.4% versus 1.9%, P = 0.0127). However, the level of instability in colonies derived from irradiated C57BL/6 clonogenic cells was significantly lower (P = 7.0 x 106) than in the corresponding CBA/Ca-derived colonies. Comparing the expression of unstable aberrations in colonies derived from hydroquinone-treated cells of the two genotypes, it is evident that the CBA/Ca-derived colonies exhibited a greater percentage of cells with aberrations than in the corresponding C57BL/6-derived cells. For the 10 µmol/L treatments, 8.5% of CBA/Ca and 3.0% of C57BL/6 cells (P = 1.16 x 103) and for the 300 mmol/L treatments, 7.0% of CBA/Ca cells and 1.3% of C57BL/6 cells (P = 4.0 x 106).
| Discussion |
|---|
|
|
|---|
Currently, the mechanism of induction and perpetuation of radiation-induced genomic instability is not understood but is thought to be driven by epigenetic factors that secondarily produce genetic lesions. There is evidence that the expression of the phenotype involves intercellular communication (16, 17) and a number of studies have pointed to an association between radiation-induced chromosomal instability and free radical-mediated processes (1820). Previous studies in vivo had indicated that macrophages in the murine hematopoietic system become activated after irradiation and produce excess levels of reactive oxygen and nitrogen species and it was proposed that the production of reactive species by macrophages in the longer term after irradiation might be involved in nontargeted and delayed effects of irradiation as part of an ongoing tissue response to radiation injury (21). Previous studies have implicated increased free radical activity in bone marrow as contributing, at least in part, to the toxic and leukemogenic effects of benzene (22, 23). The bone marrow of mice treated with benzene produced 50% more hydrogen peroxide in response to the phorbol ester, 12-O-tetradecanoyl-phorbol-13-acetate than did cells from control animals (24) suggesting that phagocyte activation may contribute to hydroquinone-induced effects and that ionizing radiation and benzene may share common indirect mechanisms of microenvironmentally mediated secondary cell damage.
This study has shown that chromosomal instability can be a high-frequency delayed consequence of exposure to both ionizing radiation and hydroquinone with the same genotype dependency. Previous studies, using CBA/Ca mice have implicated genetic instability as a factor in benzene- and radiation-induced leukemia (25) and the present study clearly shows that after either exposure, the clonal descendants of stem cells are genetically unstable in susceptible CBA/Ca mice but not in resistant C57BL/6 mice. The induction of this phenotype by such disparate agents, both of which are implicated in the induction of AML, sometimes years after the exposure, and the significant susceptibility of the CBA strain to both chromsosomal instability and AML add weight to the possible biological importance of such instability in disease development. It should be noted, however, that many AMLs in humans show normal karyotypes; thus, instability is not a universal finding and this may well reflect different responses to different leukemogenic insults. In addition, low-penetrance susceptibility and resistance loci and target stem cells numbers are factors that also impinge on the relative risk for radiation-induced AML in mice (26). In this study, the nonclonal aberrations seen in the clonal progeny of stem cells have the characteristics of spontaneous damage. This implies that induced instability would lead to a greater number of "spontaneous" mutations in the progeny of hemopoietic stem cells put under proliferative stress. Thus, inducible chromosomal instability may be a permissive event in the development of AML rather than directly causative. The induction of delayed chromosomal instability by hydroquinone doses that are not acutely stem cell toxic may have important implications for current assessment of safe levels of exposure to benzene as well as for mechanistic understanding the hemotoxic and leukemogenic effects.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 11/30/04. Revised 2/ 7/05. Accepted 2/25/05.
| References |
|---|
|
|
|---|
-particle irradiation. Proc Natl Acad Sci U S A 1998;95:57303.This article has been cited by other articles:
![]() |
X. Ren, S. Lim, M. T. Smith, and L. Zhang Werner Syndrome Protein, WRN, Protects Cells from DNA Damage Induced by the Benzene Metabolite Hydroquinone Toxicol. Sci., February 1, 2009; 107(2): 367 - 375. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Lorimore, J. A. Chrystal, J. I. Robinson, P. J. Coates, and E. G. Wright Chromosomal Instability in Unirradiated Hemaopoietic Cells Induced by Macrophages Exposed In vivo to Ionizing Radiation Cancer Res., October 1, 2008; 68(19): 8122 - 8126. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Fox and S. Klawansky Interruption of cell transformation and cancer formation FASEB J, November 1, 2006; 20(13): 2209 - 2213. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Shen, Q. Lan, L. Zhang, S. Chanock, G. Li, R. Vermeulen, S. M. Rappaport, W. Guo, R. B. Hayes, M. Linet, et al. Polymorphisms in genes involved in DNA double-strand break repair pathway and susceptibility to benzene-induced hematotoxicity Carcinogenesis, October 1, 2006; 27(10): 2083 - 2089. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |