| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Priority Reports |
1 Clinical Research Division, Fred Hutchinson Cancer Research Center, and 2 Department of Pharmacology, University of Washington, Seattle, Washington; and 3 Departments of Pathology and 4 Urology, Baylor College of Medicine, Houston, Texas
Requests for reprints: Norman M. Greenberg, Clinical Research Division, Fred Hutchinson Cancer Research Center, 1100 Fairview Avenue North, D4-100, Seattle, WA 98109. Phone: 206-667-4433; Fax: 206-667-4930; E-mail: ngreenberg{at}fhcrc.org.
| Abstract |
|---|
|
|
|---|
= 0.275, P = 0.0169) and in prostate tumor with positive surgical margins (
= 0.265, P = 0.0161). In addition, nuclear expression of Aurora-B in prostatic intraepithelial neoplasia lesions correlated with clinical staging of the tumor (
= 0.4, P = 0.0474) whereas cytoplasmic expression in tumors correlated with seminal vesicle invasion (
= 0.282, P = 0.0098). Cell lines and primary tumors derived from the TRAMP model were also found to express high levels of Aurora-A and Aurora-B. When human PC3, LNCaP, and mouse C1A cells were treated with the potent Aurora kinase inhibitor VX680, which attenuates phosphorylation of histone H3, cancer cell survival was reduced. VX680 could further reduce cell viability >2-fold when used in combination with the chemotherapy drug doxorubicin. Our findings support a functional relationship between Aurora kinase expression and prostate cancer and the application of small-molecule inhibitors in therapeutic modalities. (Cancer Res 2006; 66(10): 4996-5002) | Introduction |
|---|
|
|
|---|
Aurora-A (STK15/BTAK/hARK1/Aurora-2) is a serine-threonine kinase essential for mitotic spindle formation and accurate chromosome segregation. Aurora-B (STK12/AIM-1/hARK2/Aurora-1) is a chromosome passenger protein kinase that regulates centrosome separation, chromosome segregation, and cytokinesis. Whereas elevated levels of Aurora-A expression can override the G2-M checkpoint and result in resistance to DNA damage or paclitaxel (Taxol; ref. 3), overexpression of either Aurora-A or Aurora-B can induce centrosome amplification, aneuploidy, transformation of p53-deficient mammalian cells (4), and metastatic progression in p53-defective xenografts models (5). Whereas the presence of centrosomal defects and chromosomal instability in human prostate cancer (6) and overexpression of Aurora-A in high-grade prostatic intraepithelial neoplasia lesions (7) have been observed, the relationship between Aurora kinase expression in human prostate cancer and disease progression has not been thoroughly addressed.
In this study, we showed that Aurora-A and Aurora-B are overexpressed in primary clinical prostate cancers and that such expression patterns correlate with tumorigenicity, clinical staging, surgical margin status, and seminal vesicle invasion. In addition, the kinases were found to be highly expressed in a genetically engineered autochthonous mouse prostate cancer model system. To address the causal relationship between Aurora kinase expression and cancer cell growth, we showed that the Aurora kinasespecific small-molecule inhibitor VX680 significantly attenuates the proliferation of both human and mouse derived prostate cancer cell lines. Moreover, VX680 enhanced the potency of the chemotherapy drug doxorubicin by >2-fold. In all, these findings support the hypothesis that misexpression of Aurora kinases likely facilitates the progression of prostate cancer and targeted inhibition of these kinases represents a feasible approach toward prostate cancer therapy.
| Materials and Methods |
|---|
|
|
|---|
3') were as follows: human Aurora-A, GCCCTGTCTTACTGTCATTCG and AGAGAGTGGTCCTCCTGGAAG; human Aurora-B, ATCTGCTCTTAGGGCCAAGGG and CACATTGTCTTCCTCCTCAGGG; human S16, GCCCCTGGAGATGATTGAG and CCTTTACACGGACACGGATG; mouse Aurora-A, CTTACTGCTTGGCTCAAACG and TCAATCATCTCTGGGGGC; mouse Aurora-B, CATCCCTGAGGAGGAAGACC and TTCATAGCAGAGCACCCCG; and mouse S16, AGGAGCGATTTGCTGGTGTGGA and GCTACCAGGCCTTTGAGATGGA. Immunohistochemistry. Mouse prostate tissues were extracted, fixed, and paraffin embedded following standard protocols. Five-micron sections were incubated with primary antibody that detects Aurora-A (BL656; Bethyl Laboratories, Montgomery, TX) or Aurora-B (NB100-294; Novus Biologicals, Littleton, CO) in conjunction with the VectaStain Elite ABC Kit (rabbit or mouse immunoglobulin G; Vector Laboratories, Burlingame, CA). Sections were counterstained with methyl green. Serial sections were processed and stained with H&E.
Tissue microarray analysis. Radical prostatectomy specimens were processed using whole-mount slides as previously described (8). The clinical and pathologic data of these patients were available for analysis in the Baylor Prostate Specialized Program of Research Excellence data bank. Tissue slices were reviewed and mapped. The tissue microarrays were built using a manual tissue arrayer (Beecher Instruments, Silver Spring, MD). Triplicate 0.6-mm cores were obtained from the areas of nonneoplastic peripheral zone, prostatic intraepithelial neoplasia lesion, and tumor.
Immunohistochemistry and assessment of immunostaining. Slides were stained with anti-Aurora-A (BL656; Bethyl Laboratories) or Aurora-B (NB100-294; Novus Biologicals) antibody and analyzed as previously described (8). In brief, all stained slides were scanned (Bacus Laboratories, Lombard, IL) to produce an image and coordinate set for every slide. Each image was interpreted for immunoreactivity using a 0 to 3+ semiquantitation scoring system for both the intensity of stain and percentage of positive cells (labeling frequency percentage). For the intensity, the grading scale ranged from no detectable signal (0) to strong signal (3) seen at low power. A moderate signal seen at low to intermediate power was designated 2, whereas 1 indicated a weak signal seen only at intermediate to high power. Labeling frequency was scored as 0 (0%), 1 (1-33%), 2 (34-66%), or 3 (67-100%). Because of the triplicate nature of the arrays, three values were obtained for every measurement. To represent the intensity hotspot, the highest intensity value was used. The average of the three percentage values was used for analysis. The multiplicative expression index was obtained by totaling the scores of intensity and percentage (i.e., if the intensity score is 3 and the labeling index is 2, the multiplicative expression index is 6). Expression level of Aurora kinases was defined as low (multiplicative expression index, 0-6) or high (multiplicative expression index, >6).
Cell culture. Approximately 1.5 x 104 C1A cells and 5 x 104 PC3 or LNCaP cells were seeded in each well of 24-well plates in DMEM or RMPI 1640 medium supplemented with 10% fetal bovine serum. Cells were treated with vehicle, 1 µmol/L, or 10 µmol/L VX680 (Kava Technology, San Diego, CA) in the presence of 0, 0.1, or 1 µg/mL doxorubicin (Sigma, St. Louis, MO) for 72 hours. Cells were washed with PBS and replenished with fresh drug and medium every 24 hours. To measure cell viability after treatment, cells were incubated in fresh medium supplemented with 10% 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma) solution for an additional 4 hours at 37°C. The resulting MTT formazan crystals were harvested and dissolved in 500 µL of DMSO. The absorbance of the dissolved solution from each well was measured at 570 nm with background subtraction at 630 nm.
Immunocytochemistry and Western blot analyses. Approximately 5 x 104 PC3 or LNCaP cells or 1.5 x 104 C1A cells were seeded in each chamber of Two-Chamber Culture Slides (BD Biosciences, Bedford, MA). Treated cells were fixed, permeabilized, and blocked with Powerblock (BioGenex, San Ramon, CA) using standard protocols. Slides were then immunostained with anti-H3(S10)ph antibody (05-598; Upstate, Lake Placid, NY) and visualized with goat anti-mouse Alexa Fluor 594 secondary antibody (Molecular Probes, Eugene, OR). Slides were mounted with Vectorshield with 4',6-diamidino-2-phenylindole (DAPI) stains (H1200; Vector Laboratories).
Total protein lysates from treated cells were extracted with radioimmunoprecipitation assay buffer, separated on 12.5% SDS-PAGE, transferred to membrane, and immunoblotted with anti-ß-actin (A5316; Sigma), anti-H3(S10)ph (05-598; Upstate), or anti-H3(Total) (ab1791; Abcam, Cambridge, MA) using standard protocols.
Statistics. Data were expressed as mean ± SD and significance was determined by ANOVA. P < 0.05 was considered to be significant. Associations between clinicopathologic variables and Aurora kinase expressions were evaluated using Spearman correlation coefficient testing. In brief, the determined correlation coefficient
represents the strength of linear association between clinicopathologic variables and Aurora kinase expressions. P < 0.05 represents a statistically significant relationship between the two variable sets.
| Results |
|---|
|
|
|---|
|
Correlations between Aurora kinase expression and clinicopathologic variables. The detailed clinical and pathologic data associated with each radical prostatectomy specimen on the tissue microarray were examined for associations with Aurora kinase expressions using Spearman correlation coefficient testing. As shown in Table 1
, the nuclear multiplicative expression index of Aurora-A in non-neoplastic tissues was correlated with seminal vesicle invasion (
= 0.275, P = 0.0169) whereas the nuclear multiplicative expression index of Aurora-A in the tumor was correlated with positive surgical margins (
= 0.265, P = 0.0161). In addition, the nuclear multiplicative expression index of Aurora-B in the prostatic intraepithelial neoplasia lesions was inversely associated with clinical staging of the tumor (
= 0.4, P = 0.0474) whereas the cytoplasmic multiplicative expression index of Aurora-B in the tumor was correlated with seminal vesicle invasion (
= 0.282, P = 0.0098). No other significant correlations were found between expression of Aurora-A or Aurora-B and age at radical prostatectomy, preoperative prostate-specific antigen level, lymph node metastasis, extracapsular extension, or Gleason score.
|
|
|
| Discussion |
|---|
|
|
|---|
Here we show that Aurora-A and Aurora-B are highly expressed in human prostate cancer specimens and cell lines. In addition, the levels of expression of Aurora-A and Aurora-B in human prostate cancer cell lines correlated with tumorigenicity and invasive potential as well as the clinical staging, surgical margin status, and seminal vesicle invasion. It should be noted that our observations are further supported by the recent identification of Aurora-A as a putative low-penetrance tumor susceptibility gene of breast cancer (10). That we were unable to establish a strong association between Aurora kinase expression and Gleason score likely reflects the biological function of Aurora-A and Aurora-B in controlling genomic instability during tumorigenesis such that continued expression of the kinases, once they initiate genomic instability, need not correlate with histologic appearances.
A number of small-molecule inhibitors of Aurora kinases have been developed that show antiproliferative activities or induce tumor regression in mouse xenograft models. The intrinsic antitumor activity of many of these inhibitors seems to correlate with their specificity towards Aurora-B, although inactivation of Aurora-B can bypass the mitotic requirement for Aurora-A (11). In fact, Kurai et al. (12) have recently shown that whereas Aurora-A and Aurora-B were both increased in endometrial carcinoma, only the expression of Aurora-B correlated with cell proliferation. This underscores the differential functions of Aurora-A and Aurora-B in cancer where the former seems to be more important for tumor initiation and the latter for tumor progression and maintenance of the transformed state.
Previous gene array analyses of clinical prostate cancer specimens have consistently established correlations between expression of Aurora-B and metastatic progression, but only sporadic changes in expression of Aurora-A were reported (1315). However, elevated expression of Aurora-A protein was observed consistently in our clinical specimens, TRAMP primary tumors and derivative cell lines. This is significant for a number of reasons: First, loss of functional Fbxw7/hCDC4, a p53-dependent tumor suppressor gene implicated in the control of chromosome stability, has been shown to induce expression of Aurora-A and to increase tumor spectrum (16); second, Fbxw7/hCDC4 has also been implicated in the regulation of GSK3-phosphorylation-dependent degradation of the oncoprotein c-Myc that is amplified in clinical prostate cancer and can drive transformation when misexpressed in the prostate of transgenic mice (17); and third, TRAMP is driven by the prostate-specific expression of the SV40 early genes T and t antigen where T antigen abrogates the function of both Fbxw7/hCDC4 (18) and p53 (19). Therefore, the induction of Aurora kinase in TRAMP mice, like humans, might also be due to the abrogation of wild-type Fbxw7/hCDC4 and p53 functions. Whereas this remains to be rigorously examined, the Fbxw7/hCDC4 regulatory pathway is likely to figure prominently in future strategies to inhibit Aurora kinase.
We have shown that VX680 reduces prostate cancer cell survival and can further reduce cell viability when used in combination with doxorubicin. The antiproliferative activity of VX680 was correlated with (i) the endogenous level of Aurora kinase expression and (ii) specific inhibition of Aurora kinases activity in vitro. Whereas VX680 can also inhibit imatinib-resistant BCR-Abl (T315I) kinase (20), the ability of VX680 to inhibit prostate cancer cell survival in vivo through additional mechanism still needs to be rigorously explored using a panel of appropriate autochthonous model systems. Nevertheless, our result is consistent with the hypothesis that misexpression of Aurora kinases likely facilitates the progression of prostate cancer and targeted inhibition of these kinases represents a feasible approach toward prostate cancer therapy. This combination therapy is currently being explored in other preclinical models of prostate cancer and, when coupled with gene expression and proteomic analyses, should likely elucidate the mechanistic role of Aurora kinase expression and deregulation during initiation and progression of prostate cancer.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Dr. Robert Vessella (Department of Urology, University of Washington, Seattle, WA) for his kind gift of normal human prostate cDNA samples.
Received 8/ 5/05. Revised 3/20/06. Accepted 3/31/06.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
D. S. Boss, J. H. Beijnen, and J. H.M. Schellens Clinical Experience with Aurora Kinase Inhibitors: A Review Oncologist, August 1, 2009; 14(8): 780 - 793. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. C. VanderPorten, P. Taverna, J. N. Hogan, M. D. Ballinger, W. M. Flanagan, and R. V. Fucini The Aurora kinase inhibitor SNS-314 shows broad therapeutic potential with chemotherapeutics and synergy with microtubule-targeted agents in a colon carcinoma model Mol. Cancer Ther., April 1, 2009; 8(4): 930 - 939. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Wakahara, T. Ohno, M. Kimura, T. Masuda, S. Nozawa, T. Dohjima, T. Yamamoto, A. Nagano, G. Kawai, A. Matsuhashi, et al. EWS-Fli1 Up-Regulates Expression of the Aurora A and Aurora B Kinases Mol. Cancer Res., December 1, 2008; 6(12): 1937 - 1945. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-B. Wan, Z.-J. Long, M. Yan, J. Xu, L.-P. Xia, L. Liu, Y. Zhao, X.-F. Huang, X.-R. Wang, X.-F. Zhu, et al. Inhibition of Aurora-A suppresses epithelial-mesenchymal transition and invasion by downregulating MAPK in nasopharyngeal carcinoma cells Carcinogenesis, October 1, 2008; 29(10): 1930 - 1937. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Dai, S. Chen, C. A. Venditti, X.-Y. Pei, T. K. Nguyen, P. Dent, and S. Grant Vorinostat synergistically potentiates MK-0457 lethality in chronic myelogenous leukemia cells sensitive and resistant to imatinib mesylate Blood, August 1, 2008; 112(3): 793 - 804. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Gautschi, J. Heighway, P. C. Mack, P. R. Purnell, P. N. Lara Jr., and D. R. Gandara Aurora Kinases as Anticancer Drug Targets Clin. Cancer Res., March 15, 2008; 14(6): 1639 - 1648. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-F. Huang, S.-K. Luo, J. Xu, J. Li, D.-R. Xu, L.-H. Wang, M. Yan, X.-R. Wang, X.-B. Wan, F.-M. Zheng, et al. Aurora kinase inhibitory VX-680 increases Bax/Bcl-2 ratio and induces apoptosis in Aurora-A-high acute myeloid leukemia Blood, March 1, 2008; 111(5): 2854 - 2865. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Uzbekova, Y. Arlot-Bonnemains, J. Dupont, R. Dalbies-Tran, P. Papillier, S. Pennetier, A. Thelie, C. Perreau, P. Mermillod, C. Prigent, et al. Spatio-Temporal Expression Patterns of Aurora Kinases A, B, and C and Cytoplasmic Polyadenylation-Element-Binding Protein in Bovine Oocytes During Meiotic Maturation Biol Reprod, February 1, 2008; 78(2): 218 - 233. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Guan, X.-r. Wang, X.-f. Zhu, X.-f. Huang, J. Xu, L.-h. Wang, X.-b. Wan, Z.-j. Long, J.-n. Liu, G.-k. Feng, et al. Aurora-A, a Negative Prognostic Marker, Increases Migration and Decreases Radiosensitivity in Cancer Cells Cancer Res., November 1, 2007; 67(21): 10436 - 10444. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Lassmann, Y. Shen, U. Jutting, P. Wiehle, A. Walch, G. Gitsch, A. Hasenburg, and M. Werner Predictive Value of Aurora-A/STK15 Expression for Late Stage Epithelial Ovarian Cancer Patients Treated by Adjuvant Chemotherapy Clin. Cancer Res., July 15, 2007; 13(14): 4083 - 4091. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |