Cancer Research Grants Advances in Breast Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, E. C. Y.
Right arrow Articles by Greenberg, N. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, E. C. Y.
Right arrow Articles by Greenberg, N. M.
[Cancer Research 66, 4996-5002, May 15, 2006]
© 2006 American Association for Cancer Research

Priority Reports

Targeting Aurora Kinases for the Treatment of Prostate Cancer

Edmund Chun Yu Lee1, Anna Frolov3, Rile Li3, Gustavo Ayala3,4 and Norman M. Greenberg1,2

1 Clinical Research Division, Fred Hutchinson Cancer Research Center, and 2 Department of Pharmacology, University of Washington, Seattle, Washington; and 3 Departments of Pathology and 4 Urology, Baylor College of Medicine, Houston, Texas

Requests for reprints: Norman M. Greenberg, Clinical Research Division, Fred Hutchinson Cancer Research Center, 1100 Fairview Avenue North, D4-100, Seattle, WA 98109. Phone: 206-667-4433; Fax: 206-667-4930; E-mail: ngreenberg{at}fhcrc.org.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Inappropriate expression of the Aurora kinases can induce aberrant mitosis, centrosome irregularities, and chromosomal instability, which lead to anueploidy and cell transformation. Here, we report that Aurora-A and Aurora-B are highly expressed in primary human and mouse prostate cancers and prostate cancer cell lines. In clinical samples, levels of Aurora-A and Aurora-B were significantly elevated in prostatic intraepithelial neoplasia lesions and prostate tumors when compared with the non-neoplastic samples. Interestingly, expression of Aurora-A in non-neoplastic prostates correlated with seminal vesicle invasion ({rho} = 0.275, P = 0.0169) and in prostate tumor with positive surgical margins ({rho} = 0.265, P = 0.0161). In addition, nuclear expression of Aurora-B in prostatic intraepithelial neoplasia lesions correlated with clinical staging of the tumor ({rho} = –0.4, P = 0.0474) whereas cytoplasmic expression in tumors correlated with seminal vesicle invasion ({rho} = 0.282, P = 0.0098). Cell lines and primary tumors derived from the TRAMP model were also found to express high levels of Aurora-A and Aurora-B. When human PC3, LNCaP, and mouse C1A cells were treated with the potent Aurora kinase inhibitor VX680, which attenuates phosphorylation of histone H3, cancer cell survival was reduced. VX680 could further reduce cell viability >2-fold when used in combination with the chemotherapy drug doxorubicin. Our findings support a functional relationship between Aurora kinase expression and prostate cancer and the application of small-molecule inhibitors in therapeutic modalities. (Cancer Res 2006; 66(10): 4996-5002)


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Mitosis is a series of tightly regulated events that ensure the generation of genetically identical daughter cells. Infidelity of chromosome segregation during mitosis often results in chromosome instability, a common feature in human cancer (1). Whereas the molecular events leading to chromosome instability are not fully understood, chromosomal instability is associated with the aberrant expression of proteins controlling cell cycle checkpoints such as the Aurora kinase family proteins (2).

Aurora-A (STK15/BTAK/hARK1/Aurora-2) is a serine-threonine kinase essential for mitotic spindle formation and accurate chromosome segregation. Aurora-B (STK12/AIM-1/hARK2/Aurora-1) is a chromosome passenger protein kinase that regulates centrosome separation, chromosome segregation, and cytokinesis. Whereas elevated levels of Aurora-A expression can override the G2-M checkpoint and result in resistance to DNA damage or paclitaxel (Taxol; ref. 3), overexpression of either Aurora-A or Aurora-B can induce centrosome amplification, aneuploidy, transformation of p53-deficient mammalian cells (4), and metastatic progression in p53-defective xenografts models (5). Whereas the presence of centrosomal defects and chromosomal instability in human prostate cancer (6) and overexpression of Aurora-A in high-grade prostatic intraepithelial neoplasia lesions (7) have been observed, the relationship between Aurora kinase expression in human prostate cancer and disease progression has not been thoroughly addressed.

In this study, we showed that Aurora-A and Aurora-B are overexpressed in primary clinical prostate cancers and that such expression patterns correlate with tumorigenicity, clinical staging, surgical margin status, and seminal vesicle invasion. In addition, the kinases were found to be highly expressed in a genetically engineered autochthonous mouse prostate cancer model system. To address the causal relationship between Aurora kinase expression and cancer cell growth, we showed that the Aurora kinase–specific small-molecule inhibitor VX680 significantly attenuates the proliferation of both human and mouse derived prostate cancer cell lines. Moreover, VX680 enhanced the potency of the chemotherapy drug doxorubicin by >2-fold. In all, these findings support the hypothesis that misexpression of Aurora kinases likely facilitates the progression of prostate cancer and targeted inhibition of these kinases represents a feasible approach toward prostate cancer therapy.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Quantitative real-time PCR. Total cellular RNAs were extracted and reverse transcribed into cDNA using standard protocols. Target sequences of human and mouse Aurora-A, Aurora-B, and S16 were amplified with specific exon-spanning primers in quantitative real-time PCR reactions using SYBR Green dye fluorescence. Data were normalized using human or mouse S16 rRNA (a marker for cell activity/growth rates) as the endogenous control, compared with the normalized values of the corresponding gene from normal human or mouse prostate, and expressed as fold differences. Primer sets (5'->3') were as follows: human Aurora-A, GCCCTGTCTTACTGTCATTCG and AGAGAGTGGTCCTCCTGGAAG; human Aurora-B, ATCTGCTCTTAGGGCCAAGGG and CACATTGTCTTCCTCCTCAGGG; human S16, GCCCCTGGAGATGATTGAG and CCTTTACACGGACACGGATG; mouse Aurora-A, CTTACTGCTTGGCTCAAACG and TCAATCATCTCTGGGGGC; mouse Aurora-B, CATCCCTGAGGAGGAAGACC and TTCATAGCAGAGCACCCCG; and mouse S16, AGGAGCGATTTGCTGGTGTGGA and GCTACCAGGCCTTTGAGATGGA.

Immunohistochemistry. Mouse prostate tissues were extracted, fixed, and paraffin embedded following standard protocols. Five-micron sections were incubated with primary antibody that detects Aurora-A (BL656; Bethyl Laboratories, Montgomery, TX) or Aurora-B (NB100-294; Novus Biologicals, Littleton, CO) in conjunction with the VectaStain Elite ABC Kit (rabbit or mouse immunoglobulin G; Vector Laboratories, Burlingame, CA). Sections were counterstained with methyl green. Serial sections were processed and stained with H&E.

Tissue microarray analysis. Radical prostatectomy specimens were processed using whole-mount slides as previously described (8). The clinical and pathologic data of these patients were available for analysis in the Baylor Prostate Specialized Program of Research Excellence data bank. Tissue slices were reviewed and mapped. The tissue microarrays were built using a manual tissue arrayer (Beecher Instruments, Silver Spring, MD). Triplicate 0.6-mm cores were obtained from the areas of nonneoplastic peripheral zone, prostatic intraepithelial neoplasia lesion, and tumor.

Immunohistochemistry and assessment of immunostaining. Slides were stained with anti-Aurora-A (BL656; Bethyl Laboratories) or Aurora-B (NB100-294; Novus Biologicals) antibody and analyzed as previously described (8). In brief, all stained slides were scanned (Bacus Laboratories, Lombard, IL) to produce an image and coordinate set for every slide. Each image was interpreted for immunoreactivity using a 0 to 3+ semiquantitation scoring system for both the intensity of stain and percentage of positive cells (labeling frequency percentage). For the intensity, the grading scale ranged from no detectable signal (0) to strong signal (3) seen at low power. A moderate signal seen at low to intermediate power was designated 2, whereas 1 indicated a weak signal seen only at intermediate to high power. Labeling frequency was scored as 0 (0%), 1 (1-33%), 2 (34-66%), or 3 (67-100%). Because of the triplicate nature of the arrays, three values were obtained for every measurement. To represent the intensity hotspot, the highest intensity value was used. The average of the three percentage values was used for analysis. The multiplicative expression index was obtained by totaling the scores of intensity and percentage (i.e., if the intensity score is 3 and the labeling index is 2, the multiplicative expression index is 6). Expression level of Aurora kinases was defined as low (multiplicative expression index, 0-6) or high (multiplicative expression index, >6).

Cell culture. Approximately 1.5 x 104 C1A cells and 5 x 104 PC3 or LNCaP cells were seeded in each well of 24-well plates in DMEM or RMPI 1640 medium supplemented with 10% fetal bovine serum. Cells were treated with vehicle, 1 µmol/L, or 10 µmol/L VX680 (Kava Technology, San Diego, CA) in the presence of 0, 0.1, or 1 µg/mL doxorubicin (Sigma, St. Louis, MO) for 72 hours. Cells were washed with PBS and replenished with fresh drug and medium every 24 hours. To measure cell viability after treatment, cells were incubated in fresh medium supplemented with 10% 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma) solution for an additional 4 hours at 37°C. The resulting MTT formazan crystals were harvested and dissolved in 500 µL of DMSO. The absorbance of the dissolved solution from each well was measured at 570 nm with background subtraction at 630 nm.

Immunocytochemistry and Western blot analyses. Approximately 5 x 104 PC3 or LNCaP cells or 1.5 x 104 C1A cells were seeded in each chamber of Two-Chamber Culture Slides (BD Biosciences, Bedford, MA). Treated cells were fixed, permeabilized, and blocked with Powerblock (BioGenex, San Ramon, CA) using standard protocols. Slides were then immunostained with anti-H3(S10)ph antibody (05-598; Upstate, Lake Placid, NY) and visualized with goat anti-mouse Alexa Fluor 594 secondary antibody (Molecular Probes, Eugene, OR). Slides were mounted with Vectorshield with 4',6-diamidino-2-phenylindole (DAPI) stains (H1200; Vector Laboratories).

Total protein lysates from treated cells were extracted with radioimmunoprecipitation assay buffer, separated on 12.5% SDS-PAGE, transferred to membrane, and immunoblotted with anti-ß-actin (A5316; Sigma), anti-H3(S10)ph (05-598; Upstate), or anti-H3(Total) (ab1791; Abcam, Cambridge, MA) using standard protocols.

Statistics. Data were expressed as mean ± SD and significance was determined by ANOVA. P < 0.05 was considered to be significant. Associations between clinicopathologic variables and Aurora kinase expressions were evaluated using Spearman correlation coefficient testing. In brief, the determined correlation coefficient {rho} represents the strength of linear association between clinicopathologic variables and Aurora kinase expressions. P < 0.05 represents a statistically significant relationship between the two variable sets.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Overexpressions of Aurora kinases in human prostate cancer cell lines. To investigate the role of Aurora kinases in the progression of prostate cancer, we initially screened three human prostate cancer cell lines for expression of Aurora-A and Aurora-B using quantitative real-time PCR. Similar to observations reported with HeLa human cervical cancer cell line, Aurora-A and Aurora-B were found to be highly expressed in all three human prostate cancer cell lines tested and correlated with known tumorigenicity and invasive potentials (PC3 > DU145 > LNCaP; Fig. 1A ). Interestingly, Aurora-B was also highly expressed in the noncancerous immortal human 293T cell line, suggesting the overexpression of Aurora-B could correlate with cell proliferation.


Figure 1
View larger version (47K):
[in this window]
[in a new window]
  		Figure 1. Overexpression of Aurora-A and Aurora-B in human prostate cancer. A, steady-state expression levels of Aurora-A and Aurora-B in PC3, DU145, and LNCaP human prostate cancer cells, HeLa human cervical carcinoma cells, 293T human kidney epithelial cells, and normal human prostate samples as determined by quantitative real-time PCR. B, representative immunohistochemical staining of Aurora-A and Aurora-B from tissue microarray analysis of normal prostate tissues, prostatic intraepithelial neoplasia (PIN) lesions, and prostatic tumors. C and D, top, multiplicative expression index for Aurora-A or Aurora-B determined according to Materials and Methods. Columns, mean; bars, SD. C and D, bottom, percentage of tissues that highly expressed Aurora-A or Aurora-B (multiplicative expression index, >6) was plotted with their tissue type. Closed columns, cytoplasmic staining; open columns, nuclear staining. *, P < 0.001, prostatic intraepithelial neoplasia lesions or prostatic tumors versus normal prostate tissues (ANOVA).

 
Expression of Aurora kinases is elevated in clinical samples. Tissue microarrays bearing samples of non-neoplastic prostate, prostatic intraepithelial neoplasia lesions, and prostate tumors from different radical prostatectomy specimens were immunostained with antibodies specific for Aurora-A and Aurora-B, digitized, and quantified as described in Materials and Methods. As shown in Fig. 1, Aurora-A and Aurora-B were differentially expressed in non-neoplastic, neoplastic, and malignant prostate cancer (Fig. 1B). Expression of Aurora-A was found predominantly in the cytoplasmic compartment and was elevated in both prostatic intraepithelial neoplasia lesions and prostate tumors (Fig. 1C). Expression of Aurora-B was found in both cytoplasmic and nuclear compartments, with elevated level of cytoplasmic staining and attenuated nuclear staining frequently observed in prostatic intraepithelial neoplasia and tumors (Fig. 1D). On visual inspection, Aurora-A was highly expressed (multiplicative expression index, >6) in the cytoplasm of 54.5% of nonneoplastic tissues (N = 77), 100.0% of prostatic intraepithelial neoplasia lesions (N = 68), and 94.0% of prostatic tumors (N = 84; Fig. 1C). Aurora-B was highly expressed in the cytoplasm of 18.5% of nonneoplastic tissues (N = 54), 79.6% of prostatic intraepithelial neoplasia lesions (N = 54), and 94.2% of prostatic tumors (N = 86; Fig. 1D). Together, these data indicate that Aurora kinases are highly expressed in both precancerous lesions and cancerous tissues of the prostate and therefore could play important causal roles in the initiation and progression of prostate cancer.

Correlations between Aurora kinase expression and clinicopathologic variables. The detailed clinical and pathologic data associated with each radical prostatectomy specimen on the tissue microarray were examined for associations with Aurora kinase expressions using Spearman correlation coefficient testing. As shown in Table 1 , the nuclear multiplicative expression index of Aurora-A in non-neoplastic tissues was correlated with seminal vesicle invasion ({rho} = 0.275, P = 0.0169) whereas the nuclear multiplicative expression index of Aurora-A in the tumor was correlated with positive surgical margins ({rho} = 0.265, P = 0.0161). In addition, the nuclear multiplicative expression index of Aurora-B in the prostatic intraepithelial neoplasia lesions was inversely associated with clinical staging of the tumor ({rho} = –0.4, P = 0.0474) whereas the cytoplasmic multiplicative expression index of Aurora-B in the tumor was correlated with seminal vesicle invasion ({rho} = 0.282, P = 0.0098). No other significant correlations were found between expression of Aurora-A or Aurora-B and age at radical prostatectomy, preoperative prostate-specific antigen level, lymph node metastasis, extracapsular extension, or Gleason score.


View this table:
[in this window]
[in a new window]
  		Table 1. Correlation between expression of Aurora kinases A and B and clinicopathologic variables

 
Expression of Aurora kinase is elevated in experimental prostate cancer. Transgenic mouse models have become essential tools for translational studies to investigate the efficacy of novel cancer therapeutics in preclinical trials. To determine whether the pattern of Aurora kinase expression in mouse prostate cancer models paralleled those in clinical samples, we examined four TRAMP mouse prostate cancer cell lines using quantitative real-time PCR. As shown in Fig. 2 , both Aurora-A and Aurora-B were highly expressed in all mouse prostate cancer cell lines tested. As in man, high levels of Aurora-A and Aurora-B were also found in primary prostatic tumors of TRAMP mice whereas only low to moderate levels (AP = DP < LP < VP) of the proteins were found in the prostatic tissues of age-matched nontransgenic mice (Fig. 2B and C). This analysis showed that the temporal pattern of Aurora kinase expression in TRAMP closely mimics that observed in clinical samples and supports the use of TRAMP to study the role of Aurora kinase in primary prostate cancer.


Figure 2
View larger version (77K):
[in this window]
[in a new window]
  		Figure 2. Overexpression of Aurora-A and Aurora-B in mouse prostate cancer. A, steady-state expression levels of Aurora-A and Aurora-B in TRAMP mouse prostate cancer cells, normal mouse colon, and normal mouse prostate as determined by quantitative real-time PCR. B and C, representative immunohistochemical staining of Aurora-A and Aurora-B of prostatic tissues from nontransgenic (a-h) and TRAMP (i-p) mice. Five-micron sections from 24-week-old nontransgenic and TRAMP mice were stained for Aurora-A (B) or Aurora-B (C) as described in Materials and Methods (inset, a and e, dorsal prostate; b and f, lateral prostate; c and g, ventral prostate; d and h, anterior prostate; i-p, primary prostatic tumor).

 
Aurora kinase inhibitor VX680 suppresses the growth of TRAMP cells. Our observation of Aurora kinase overexpression in prostate cancer cells suggested that specific inhibition of Aurora kinase activities could potentially attenuate the proliferation of these cells. We therefore treated C1A, PC3, and LNCaP cells which overexpress Aurora kinases in different levels (C1A > PC3 > LNCaP; 94.8 > 48.4 > 23.4 fold increases; Figs. 1 and 2) with VX680, a potent inhibitor of Aurora kinases (9). As shown in Fig. 3A , VX680 significantly attenuated the proliferation of all prostate cancer cell lines tested in a dose-dependent manner. Interestingly, the antiproliferative activity of VX680 was correlated with the endogenous level of Aurora kinase expression (C1A > PC3 > LNCaP; 51.6% > 31.3% > 19.8% reduction in cell viability; Fig. 3A). Whereas the chemotherapy drug doxorubicin alone was able to reduce C1A cell survival at a concentration of 1 µg/mL, combination treatment with 10 µmol/L VX680 further reduced cell survival >2-fold (6.1% versus 2.8%; P = 0.0086; Fig. 3A). The additional antiproliferative activities conferred by VX680, when used in combination with doxorubicin, were also observed in human PC3 and LNCaP cells. As shown in Fig. 3A, although doxorubicin alone did not significantly reduce PC3 cell survival at a concentration of 0.1 µg/mL (100% versus 98.4%; P = 0.7654), combination treatment with VX680 rendered PC3 cells more sensitive to the treatment and further reduced cell survival in a dose-dependent manner [97.2% versus 81.0% at 1 µmol/L VX680 (P = 0.0066); 68.7% versus 54.9% at 10 µmol/L VX680 (P = 0.015)]. For LNCaP cells, whereas treatment with 1 µg/mL doxorubicin reduced cell survival to 39.8%, combination treatment with 10 µmol/L VX680 further reduced cell survival >2-fold (P = 0.0488; Fig. 3A). These data showed that VX680 effectively reduced prostate cancer cell survival and, when used in combination with doxorubicin, could enhance the potency of the chemotherapy drug by >2-fold.


Figure 3
View larger version (48K):
[in this window]
[in a new window]
  		Figure 3. Inhibition of Aurora kinases activity by VX680 attenuates viability of prostate cancer cells. A, PC3, LNCaP, and C1A cells were treated with vehicle, 1 µmol/L, or 10 µmol/L VX680 (closed columns); 0.1 µg/mL doxorubicin plus 0, 1, or 10 µmol/L VX680 (shadowed columns); or 1 µg/mL doxorubicin plus 0, 1, or 10 µmol/L VX680 (open columns) for 72 hours. Cell viability was measured as described in Materials and Methods. Columns, percentage compared with vehicle-treated cells; bars, SD. *, P < 0.05; **, P < 0.05; ***, P < 0.05, drug-treated versus control vehicle, doxorubicin-treated (1 µg/mL), and VX680-treated (10 µmol/L), respectively (ANOVA). B, PC3, LNCaP, and C1A cells were treated with vehicle, 10 µmol/L VX680, 0.1 µg/mL doxorubicin, or 0.1 µg/mL doxorubicin plus 10 µmol/L VX680 for 72 hours, fixed, and immunostained with anti-H3(S10)ph antibody and DAPI as described in Materials and Methods. White arrows, cells with reduced histone H3 phosphorlyation on Ser10. C, immunoblots of total protein lysates of PC3, LNCaP, and C1A cells treated as above using anti-ß-actin, anti-H3(S10)ph, or anti-H3(Total) antibodies.

 
The antiproliferative activity of VX680 acts through specific inhibition of Aurora kinases. As shown in Fig. 3B, VX680 alone or in combination with doxorubicin attenuates phosphorylation of histone H3, a direct downstream target of Aurora kinase, in all tested prostate cancer cell lines. In C1A cells that were most sensitive to VX680, a significant reduction of histone H3 phosphorylation was observed after treatments with VX680 alone or in combination with doxorubicin (Fig. 3C). In PC3 and LNCaP cells that were less sensitive to VX680, only a low level of reduction in histone H3 phosphorylation was observed (Fig. 3C). These data show that the antiproliferative activity of VX680 is dependent on the specific inhibition of Aurora kinases and support a critical functional role for Aurora kinase action in prostate cancer cell proliferation.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The supraphysiologic expression of Aurora kinase can induce aberrant mitosis, centrosome irregularities, chromosomal instability leading to anueploidy, and cell transformation (3, 5). As Aurora kinase overexpression is frequently observed in cancers and tumor cell lines, it has been tempting to speculate on the causal relationship between such expression, genetic instability, and tumorigenesis. Previous attempts to characterize the expression of Aurora-A and Aurora-B in prostate cancer have typically relied on clinical samples from a small number of cases with limited scope. In the current study, we have examined a total of 92 cases of prostate cancer each with extensive clinical follow-up and have drawn correlations with clinicopathologic variables that are only possible with such a detailed record set.

Here we show that Aurora-A and Aurora-B are highly expressed in human prostate cancer specimens and cell lines. In addition, the levels of expression of Aurora-A and Aurora-B in human prostate cancer cell lines correlated with tumorigenicity and invasive potential as well as the clinical staging, surgical margin status, and seminal vesicle invasion. It should be noted that our observations are further supported by the recent identification of Aurora-A as a putative low-penetrance tumor susceptibility gene of breast cancer (10). That we were unable to establish a strong association between Aurora kinase expression and Gleason score likely reflects the biological function of Aurora-A and Aurora-B in controlling genomic instability during tumorigenesis such that continued expression of the kinases, once they initiate genomic instability, need not correlate with histologic appearances.

A number of small-molecule inhibitors of Aurora kinases have been developed that show antiproliferative activities or induce tumor regression in mouse xenograft models. The intrinsic antitumor activity of many of these inhibitors seems to correlate with their specificity towards Aurora-B, although inactivation of Aurora-B can bypass the mitotic requirement for Aurora-A (11). In fact, Kurai et al. (12) have recently shown that whereas Aurora-A and Aurora-B were both increased in endometrial carcinoma, only the expression of Aurora-B correlated with cell proliferation. This underscores the differential functions of Aurora-A and Aurora-B in cancer where the former seems to be more important for tumor initiation and the latter for tumor progression and maintenance of the transformed state.

Previous gene array analyses of clinical prostate cancer specimens have consistently established correlations between expression of Aurora-B and metastatic progression, but only sporadic changes in expression of Aurora-A were reported (13–15). However, elevated expression of Aurora-A protein was observed consistently in our clinical specimens, TRAMP primary tumors and derivative cell lines. This is significant for a number of reasons: First, loss of functional Fbxw7/hCDC4, a p53-dependent tumor suppressor gene implicated in the control of chromosome stability, has been shown to induce expression of Aurora-A and to increase tumor spectrum (16); second, Fbxw7/hCDC4 has also been implicated in the regulation of GSK3-phosphorylation-dependent degradation of the oncoprotein c-Myc that is amplified in clinical prostate cancer and can drive transformation when misexpressed in the prostate of transgenic mice (17); and third, TRAMP is driven by the prostate-specific expression of the SV40 early genes T and t antigen where T antigen abrogates the function of both Fbxw7/hCDC4 (18) and p53 (19). Therefore, the induction of Aurora kinase in TRAMP mice, like humans, might also be due to the abrogation of wild-type Fbxw7/hCDC4 and p53 functions. Whereas this remains to be rigorously examined, the Fbxw7/hCDC4 regulatory pathway is likely to figure prominently in future strategies to inhibit Aurora kinase.

We have shown that VX680 reduces prostate cancer cell survival and can further reduce cell viability when used in combination with doxorubicin. The antiproliferative activity of VX680 was correlated with (i) the endogenous level of Aurora kinase expression and (ii) specific inhibition of Aurora kinases activity in vitro. Whereas VX680 can also inhibit imatinib-resistant BCR-Abl (T315I) kinase (20), the ability of VX680 to inhibit prostate cancer cell survival in vivo through additional mechanism still needs to be rigorously explored using a panel of appropriate autochthonous model systems. Nevertheless, our result is consistent with the hypothesis that misexpression of Aurora kinases likely facilitates the progression of prostate cancer and targeted inhibition of these kinases represents a feasible approach toward prostate cancer therapy. This combination therapy is currently being explored in other preclinical models of prostate cancer and, when coupled with gene expression and proteomic analyses, should likely elucidate the mechanistic role of Aurora kinase expression and deregulation during initiation and progression of prostate cancer.


   Acknowledgments
 
Grant support: National Cancer Institute grant UO1-CA84296 (N. Greenberg) and Department of Defense grant PC030745 (E.C.Y. Lee).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Dr. Robert Vessella (Department of Urology, University of Washington, Seattle, WA) for his kind gift of normal human prostate cDNA samples.

Received 8/ 5/05. Revised 3/20/06. Accepted 3/31/06.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Jallepalli PV, Lengauer C. Chromosome segregation and cancer: cutting through the mystery. Nat Rev Cancer 2001;1:109–17.[CrossRef][Medline]
  2. Keen N, Taylor S. Aurora-kinase inhibitors as anticancer agents. Nat Rev Cancer 2004;4:927–36.[CrossRef][Medline]
  3. Anand S, Penrhyn-Lowe S, Venkitaraman AR. AURORA-A amplification overrides the mitotic spindle assembly checkpoint, inducing resistance to Taxol. Cancer Cell 2003;3:51–62.[CrossRef][Medline]
  4. Meraldi P, Honda R, Nigg EA. Aurora-A overexpression reveals tetraploidization as a major route to centrosome amplification in p53–/– cells. EMBO J 2002;21:483–92.[CrossRef][Medline]
  5. Ota T, Suto S, Katayama H, et al. Increased mitotic phosphorylation of histone H3 attributable to AIM-1/Aurora-B overexpression contributes to chromosome number instability. Cancer Res 2002;62:5168–77.[Abstract/Free Full Text]
  6. Pihan GA, Wallace J, Zhou Y, Doxsey SJ. Centrosome abnormalities and chromosome instability occur together in pre-invasive carcinomas. Cancer Res 2003;63:1398–404.[Abstract/Free Full Text]
  7. Buschhorn HM, Klein RR, Chambers SM, et al. Aurora-A over-expression in high-grade PIN lesions and prostate cancer. Prostate 2005;64:341–6.[CrossRef][Medline]
  8. Ayala G, Thompson T, Yang G, et al. High levels of phosphorylated form of Akt-1 in prostate cancer and non-neoplastic prostate tissues are strong predictors of biochemical recurrence. Clin Cancer Res 2004;10:6572–8.[Abstract/Free Full Text]
  9. Harrington EA, Bebbington D, Moore J, et al. VX-680, a potent and selective small-molecule inhibitor of the Aurora kinases, suppresses tumor growth in vivo. Nat Med 2004;10:262–7.[CrossRef][Medline]
  10. Ewart-Toland A, Briassouli P, de Koning JP, et al. Identification of Stk6/STK15 as a candidate low-penetrance tumor-susceptibility gene in mouse and human. Nat Genet 2003;34:403–12.[CrossRef][Medline]
  11. Yang H, Burke T, Dempsey J, et al. Mitotic requirement for aurora A kinase is bypassed in the absence of aurora B kinase. FEBS Lett 2005;579:3385–91.[CrossRef][Medline]
  12. Kurai M, Shiozawa T, Shih HC, et al. Expression of Aurora kinases A and B in normal, hyperplastic, and malignant human endometrium: Aurora B as a predictor for poor prognosis in endometrial carcinoma. Hum Pathol 2005;36:1281–8.[CrossRef][Medline]
  13. LaTulippe E, Satagopan J, Smith A, et al. Comprehensive gene expression analysis of prostate cancer reveals distinct transcriptional programs associated with metastatic disease. Cancer Res 2002;62:4499–506.[Abstract/Free Full Text]
  14. Dhanasekaran SM, Barrette TR, Ghosh D, et al. Delineation of prognostic biomarkers in prostate cancer. Nature 2001;412:822–6.[CrossRef][Medline]
  15. Luo J, Duggan DJ, Chen Y, et al. Human prostate cancer and benign prostatic hyperplasia: molecular dissection by gene expression profiling. Cancer Res 2001;61:4683–8.[Abstract/Free Full Text]
  16. Mao JH, Perez-Losada J, Wu D, et al. Fbxw7/Cdc4 is a p53-dependent, haploinsufficient tumour suppressor gene. Nature 2004;432:775–9.[CrossRef][Medline]
  17. Welcker M, Orian A, Jin J, et al. The Fbw7 tumor suppressor regulates glycogen synthase kinase 3 phosphorylation-dependent c-Myc protein degradation. Proc Natl Acad Sci U S A 2004;101:9085–90.[Abstract/Free Full Text]
  18. Welcker M, Clurman BE. The SV40 large T antigen contains a decoy phosphodegron that mediates its interactions with Fbw7/hCdc4. J Biol Chem 2005;280:7654–8.[Abstract/Free Full Text]
  19. Linzer DI, Levine AJ. Characterization of a 54K dalton cellular SV40 tumor antigen present in SV40-transformed cells and uninfected embryonal carcinoma cells. Cell 1979;17:43–52.[CrossRef][Medline]
  20. Carter TA, Wodicka LM, Shah NP, et al. Inhibition of drug-resistant mutants of ABL, KIT, and EGF receptor kinases. Proc Natl Acad Sci U S A 2005;102:11011–6.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Molecular Cancer TherapeuticsHome page
E. C. VanderPorten, P. Taverna, J. N. Hogan, M. D. Ballinger, W. M. Flanagan, and R. V. Fucini
The Aurora kinase inhibitor SNS-314 shows broad therapeutic potential with chemotherapeutics and synergy with microtubule-targeted agents in a colon carcinoma model
Mol. Cancer Ther., April 1, 2009; 8(4): 930 - 939.
[Abstract] [Full Text] [PDF]

Home page
 Mol Cancer ResHome page
K. Wakahara, T. Ohno, M. Kimura, T. Masuda, S. Nozawa, T. Dohjima, T. Yamamoto, A. Nagano, G. Kawai, A. Matsuhashi, et al.
EWS-Fli1 Up-Regulates Expression of the Aurora A and Aurora B Kinases
Mol. Cancer Res., December 1, 2008; 6(12): 1937 - 1945.
[Abstract] [Full Text] [PDF]

Home page
 CarcinogenesisHome page
X.-B. Wan, Z.-J. Long, M. Yan, J. Xu, L.-P. Xia, L. Liu, Y. Zhao, X.-F. Huang, X.-R. Wang, X.-F. Zhu, et al.
Inhibition of Aurora-A suppresses epithelial-mesenchymal transition and invasion by downregulating MAPK in nasopharyngeal carcinoma cells
Carcinogenesis, October 1, 2008; 29(10): 1930 - 1937.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
Y. Dai, S. Chen, C. A. Venditti, X.-Y. Pei, T. K. Nguyen, P. Dent, and S. Grant
Vorinostat synergistically potentiates MK-0457 lethality in chronic myelogenous leukemia cells sensitive and resistant to imatinib mesylate
Blood, August 1, 2008; 112(3): 793 - 804.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
O. Gautschi, J. Heighway, P. C. Mack, P. R. Purnell, P. N. Lara Jr., and D. R. Gandara
Aurora Kinases as Anticancer Drug Targets
Clin. Cancer Res., March 15, 2008; 14(6): 1639 - 1648.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
X.-F. Huang, S.-K. Luo, J. Xu, J. Li, D.-R. Xu, L.-H. Wang, M. Yan, X.-R. Wang, X.-B. Wan, F.-M. Zheng, et al.
Aurora kinase inhibitory VX-680 increases Bax/Bcl-2 ratio and induces apoptosis in Aurora-A-high acute myeloid leukemia
Blood, March 1, 2008; 111(5): 2854 - 2865.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
S. Uzbekova, Y. Arlot-Bonnemains, J. Dupont, R. Dalbies-Tran, P. Papillier, S. Pennetier, A. Thelie, C. Perreau, P. Mermillod, C. Prigent, et al.
Spatio-Temporal Expression Patterns of Aurora Kinases A, B, and C and Cytoplasmic Polyadenylation-Element-Binding Protein in Bovine Oocytes During Meiotic Maturation
Biol Reprod, February 1, 2008; 78(2): 218 - 233.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
Z. Guan, X.-r. Wang, X.-f. Zhu, X.-f. Huang, J. Xu, L.-h. Wang, X.-b. Wan, Z.-j. Long, J.-n. Liu, G.-k. Feng, et al.
Aurora-A, a Negative Prognostic Marker, Increases Migration and Decreases Radiosensitivity in Cancer Cells
Cancer Res., November 1, 2007; 67(21): 10436 - 10444.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
S. Lassmann, Y. Shen, U. Jutting, P. Wiehle, A. Walch, G. Gitsch, A. Hasenburg, and M. Werner
Predictive Value of Aurora-A/STK15 Expression for Late Stage Epithelial Ovarian Cancer Patients Treated by Adjuvant Chemotherapy
Clin. Cancer Res., July 15, 2007; 13(14): 4083 - 4091.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, E. C. Y.
Right arrow Articles by Greenberg, N. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, E. C. Y.
Right arrow Articles by Greenberg, N. M.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online