| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Molecular Biology, Pathobiology, and Genetics |
1 The Institute for Advanced Study, Princeton, New Jersey; 2 The Cancer Institute of New Jersey, New Brunswick, New Jersey; 3 Memorial Sloan Kettering Cancer Center, New York, New York; 4 Martin-Luther-University, Halle/Salle, Germany; and 5 University of Ulm, Ulm, Germany
Requests for reprints: Arnold Levine, The Institute for Advanced Study, Einstein Drive, Princeton, NJ 08540-0631. Phone: 609-734-8005; Fax: 609-924-7592; E-mail: alevine{at}ias.edu.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Both genetic and biochemical studies have shown that the MDM2 oncogene is a key negative regulator of the p53 protein (7). Since the initial publication (6), multiple studies have shown that the G-allele of the single nucleotide polymorphism (SNP309, T/G) in the promoter of the MDM2 gene was associated with the attenuation of the p53 pathway and an enhanced early onset of, and increased risk for, tumorigenesis (6, 814). In various reports, results were presented that support the model that the G-allele of SNP309 increases the DNA binding affinity of the transcriptional activator Sp1, which results in high levels of MDM2 mRNA and protein in human cells and tissue with this allele (10, 15, 16). The heightened MDM2 levels were shown to lead to the attenuation of the p53 DNA damage response induced by various chemotherapeutic drugs (6, 15), in concordance with the well-described role of MDM2 in the negative regulation of the p53 protein. In humans, two independent reports have shown that germ-line p53 mutation carriers who possessed the G-allele of SNP309 were diagnosed with cancer, on average, 7 or 10 years earlier than those who were homozygous for the T-allele (6, 9). It was proposed that high levels of MDM2, resulting from the G-allele of SNP309 and just one wild-type p53 allele, produce a severely weakened p53 tumor suppressor pathway resulting in a higher mutation rate, poorer DNA repair processes, and reduced apoptosis leading to faster and more frequent tumor formation (6, 16).
Estrogen signaling has been shown to regulate MDM2 expression levels. Many reports have shown that MDM2 mRNA and protein levels are heightened in breast tumors which express the estrogen receptor (ER), a critical component of the estrogen signaling pathway (1721). In fact, the expression of ER
was shown to induce transcription of MDM2 (22). The regulation of MDM2 expression by estrogen, as well as by thyroid hormone, is mediated, at least in part, through a well-characterized region of the MDM2 promoter (20, 2224). Both the ER and the thyroid hormone receptor are known to bind to this region of the promoter and activate transcription of the MDM2 gene (23, 24). Interestingly, SNP309 is found in this region of the promoter. The SNP309 locus potentially could affect the transcriptional regulation of MDM2 by hormone receptors as the G-allele of SNP309 increases the affinity of the MDM2 promoter for Sp1, which is a well-characterized cotranscriptional activator for multiple hormone receptors, including the ER (2527). These observations suggest the possibility that the SNP309 locus could alter the effects of hormones, like estrogen, on tumorigenesis, and therefore contribute to the gender differences observed in many different types of cancer. In this report, data are presented from four independent studies that support this hypothesis.
| Materials and Methods |
|---|
|
|
|---|
Ashkenazi lymphoma and breast cancer cases. Lymphoma cases were derived from 678 cases of non-Hodgkin's lymphoma ascertained at a single center in the New York metropolitan area during the period of April 2000 to March 2005. Of these, 162 were classified as diffuse large B-cell lymphoma (DLBCL). The breast cancer cases were derived from 658 individuals with invasive ductal carcinoma (IDC). The patients were Caucasians and self-identified as of Ashkenazi Jewish ethnicity. Pathology reports, and in the case of breast tumors, ER status, of all cases were reviewed and age of diagnosis was recorded. Germ-line DNA from cases was collected and permanently stripped of identifiers before genotyping, in accord with an Institutional Review Boardapproved protocol.
Controls were drawn from DNA of 976 healthy men and women, all of Ashkenazi ancestry by self-report of religion and country of origin of parents and grandparents. Age range was 18 to 65 years. Control DNA samples were available from the New York Cancer Project, an ongoing cohort study of over 17,000 volunteers of varying ethnic backgrounds who live in the New York metropolitan area (28).
Soft-tissue sarcoma cases. Samples originated from 105 sporadic soft-tissue sarcoma (STS) cases diagnosed from 1991 to 2001 at the Surgical Clinic 1, University of Leipzig and at the Institute of Pathology of the Martin-Luther-University Halle, Germany. All patients had a R0-resection of a their primary tumor done by the same team. The patients were of Caucasian ethnicity with an age range of 14 to 84 years (average, 55 years). The STS samples consisted of 29 liposarcomas, 23 malignant fibrous histiocytomas, 16 leiomyosarcomas, 12 neurogenic sarcomas, 8 rhabdomyosarcomas, 8 synovial sarcomas, 5 fibrosarcomas, and 4 other types. One hundred four healthy blood donors of Caucasian ethnicity (non-Jewish) from Germany served as controls.
Breast cancer cases. Between April 2004 and October 2005, 258 Caucasian women previously diagnosed with infiltrating ductal carcinoma of the breast were accrued to this study at The Cancer Institute of New Jersey (New Brunswick, NJ). Pathology reports were reviewed on all cases. Venipuncture was done and genomic DNA was prepared from whole blood. Age and menopausal status at diagnosis, ER status, and degree of positivity were recorded. All information was devoid of identifiers and kept in a database. Data collection was in accord with an approval by the Institutional Review Board at the Cancer Institute of New Jersey.
Sequence analysis. The status of the SNP309 locus was determined for the p53 germ-line mutation carriers, the unaffected non-Ashkenazi Jewish individuals, the STS patients, and the second group of Caucasian IDC patients by PCR amplification and subsequent sequencing (primer 1, CGGGAGTTCAGGGTAAAGGT; primer 2, AGCAAGTCGGTGCTTACCTG).
The status of the SNP309 locus was determined for the unaffected Ashkenazi Jewish individuals, DLBCL patients, and the first group of Caucasian Ashkenazi Jewish IDC patients by using the combination of MspIA1 RFLP analysis and 5' allelic discrimination assay (TaqMan). For the MspA1 RFLP analysis, primers 5'-CGGGAGTTCAGGGTAAAGGT-3' and 5'-AGCAAGTCGGTGCTTACCTG-3' were used. PCR was done under standard conditions using 20 ng of genomic DNA and annealing temperature of 66°C. The resulting PCR product (351 bp) was digested by MspIA1. MspIA1 cleaves final PCR product on two sites, one is constitutive that served as an internal control of enzymatic digestion and allele G of SNP309 generates specific MspIA1 restriction site.
The TaqMan 5' allelic discrimination PCR assay was done in 384-well plates. Each well contained 5.0 ng DNA, 2.5 µL TaqMan Universal PCR Master Mix (Applied Biosystems, Foster City, CA), 0.0625 µL of probe and primer solution (Assays-on-Demand, Applied Biosystems), and 2.4375 µL distilled water. The PCR reaction was initiated at 95°C for 10 minutes, followed by 47 cycles of 92°C for 30 seconds and 60°C for 60 seconds. Following PCR, fluorescence was measured in an ABI 7900 HT Sequence Detector (Applied Biosystems) and the genotype clusters were manually scored using Sequence Detection Software 2.0 (Applied Biosystems).
| Results |
|---|
|
|
|---|
As previously observed (29, 30), in 162 Caucasians of Ashkenazi Jewish ethnicity diagnosed with DLBCL, the 83 male patients were diagnosed, on average, 5 years earlier than the 79 female patients (Fig. 1A ). Specifically, the male patients were diagnosed, on average, at 57 years of age (range, 25-85 years) and females at 62 years of age (range, 21-93 years). The male DLBCL patients showed no large differences in the age of tumor diagnosis when separated into the different genotypes of the SNP309 locus (T/T males, 58 years of age versus G/G males, 60 years of age; Fig. 1B). In contrast, G/G women showed a 13-year earlier tumor diagnosis than T/T women [T/T women, 68 years of age (range, 55-78 years) versus G/G women, 55 years of age (range, 21-87 years); Fig. 1C].
|
Soft-tissue sarcoma. The G-allele of SNP309 in its homozygous state (G/G) has been previously shown to associate with a 12-year earlier age of onset of sporadic STS compared with T/T individuals (6). The STS patients in this study were made up of 58 Caucasian women and 47 Caucasian men. When separated by gender, it became clear that the significant earlier age of onset of STS observed in these cases is only associated with the G/G women, as only 3 of 47 male patients had the G/G genotype. Specifically, G/G women were diagnosed on average 14 years earlier than T/T women [T/T women, 59 years of age (range, 30-78 years) versus G/G women, 45 years of age (range, 23-81 years); Fig. 2A ; P = 0.028, randomization test]. As the presence of ER in STS is well documented (3740), the possibility that estrogen might be playing a role in the ability of the G-allele of SNP309 to accelerate STS formation in women was tested. Indeed, the largest differences in the age-dependent STS incidence between G/G women and T/T women were also seen in women below the average age of menopause (51 years) when gender-specific hormones, such as estrogen, are at their highest levels. Specifically, 67% of G/G women were diagnosed with STS by the age of 51 years, but only 27% of T/T women (P = 0.05, one-tailed Fisher's exact test). In fact, the overall frequency of the G/G genotype is 27% in female STS cases diagnosed by the age of 51 years and only 8% in female cases diagnosed >51 years of age and 6% in male STS cases (Fig. 2B; P = 0.0173, one-tailed Fisher's exact test). Together these data further support the hypothesis that gender-specific hormones, like estrogen, could be playing a role in the ability of the G-allele of SNP309 to accelerate both sporadic DLBCL formation and sporadic STS tumor formation.
|
Of the 658 IDC patients, 136 patients were noted to have no significant levels of ER expression (<10% of tumor cells stained positive for ER) whereas 472 were noted to have significant levels of ER staining (
10% of tumors cells stained positive for ER) and the expression level of ER was not known for 50 patients. Of the 472 patients noted to have significant levels of ER staining, 127 patients were known to have high levels of ER expression (
50% of the tumor cells stained positive for ER).
If the G-allele of SNP309 can accelerate tumorigenesis only in the presence of an active estrogen-signaling pathway, then an earlier age of tumor onset for G/G women versus T/T women should be greatest in the formation of tumors that express high levels of ER, as the percent of tumor cells which stain positive for ER has been shown to correlate with the tumor dependence on estrogen for growth (42, 43). Indeed, in those 100 women whose tumors expressed high levels of ER (
50%), G/G women showed a 7-year average earlier age of onset of IDC compared with T/T women and an 11-year median earlier onset [T/T women, 60 years of age (range, 33-81 years) versus G/G women, 53 years of age (range, 35-84 years); P = 0.0094, randomization test; Fig. 3A
]. No significant differences were observed in those women whose tumors expressed low levels of ER [<10% (Fig. 3B) or <50% (data not shown)]. Specifically, the ER-negative T/T patients were diagnosed on average at 51 years of age and G/G patients at 56 years of age. Interestingly, the acceleration of high ER-positive (
50%) IDC formation in G/G women compared with T/T women was also greatest below the average age of menopause (51 years) when estrogen levels are at their highest. Fifty-four percent of the patients with the G/G genotype had been diagnosed with high ER-positive (
50%) IDC by the age of 51 years, in contrast to only 22% of the T/T patients (Fig. 3A; P = 0.0133, one-tailed Fisher's exact test). In fact, women with the G/G genotype make up 33% of high ER-positive (
50%) IDC cases diagnosed by the age of 51 years, as opposed to 16% of high ER-positive (
50%) IDC cases diagnosed >51 years of age (Fig. 3C; P = 0.0272, two-tailed Fisher's exact test). These data further support the hypothesis that an active estrogen-signaling pathway allows for the G-allele of SNP309 to accelerate tumor formation in women.
|
10% of tumor cells stained positive for ER) and the expression level of ER was not known for 3 patients. Of the 184 patients noted to have significant levels of ER staining, 117 patients were known to have high levels of ER expression (
50% of the tumor cells stained positive for ER).
As previously observed, in the 117 women in this second group whose tumors expressed high levels of ER (>50%), G/G women again showed a 7-year earlier onset of IDC compared with T/T women [T/T women, 54 years of age (range, 29-76 years) versus G/G women, 47 years of age (range, 32-62 years); P = 0.025, randomization test; Fig. 4A
]. Again, no significant differences were observed in the 71 women whose tumors expressed lower levels of ER [<10% (Fig. 4B) or <50% (data not shown)]. The acceleration of high ER-positive (
50%) IDC formation in G/G women compared with T/T women was also greatest below the average age of menopause (51 years) when estrogen levels are at their highest. Eighty percent of the G/G patients had been diagnosed with ER-positive IDC by the age of 51 years, but only 39% of the T/T patients (P = 0.0061, one-sided Fisher's exact test). In fact, G/G women make up 20% of high ER-positive (
50%) IDC cases diagnosed by the age of 51 years, as opposed to 5% of high ER-positive (
50%) IDC cases diagnosed >51 years of age (Fig. 4C; P = 0.0133, one-sided Fisher's exact test). In this study, the menopause status of the patients at diagnosis was available and, as predicted, individuals with the G-allele of SNP309 were enriched in the premenopausal high ER-positive (
50%) IDC cases compared with the postmenopausal cases. Specifically, individuals with the G-allele of SNP309 made up 72% of the premenopausal cases and only 53% of the postmenopausal cases (Fig. 4D; P = 0.0247, one-sided Fisher's exact test).
|
| Discussion |
|---|
|
|
|---|
50%), but not in ER-negative, IDC formation, which was seen in two independent case studies (Figs. 3 and 4). Further support came from the observation that the differences in age-specific cancer incidence between G/G and T/T women with high ER-positive (
50%) IDC were the largest below the average age of menopause (51 years) when estrogen levels are at their highest (Figs. 3A and 4A). This model, in which an active estrogen-signaling pathway allows for the G-allele of SNP309 to accelerate tumor formation in women, may help explain the genetic basis for the frequently observed gender differences in cancer and shows that the genotype at a specific locus can affect how hormones, like estrogen, will affect tumorigenesis in humans.
The estrogen-signaling pathway can be regulated in humans for a variety of reasons (e.g., contraception, relief of menopausal symptoms, as well as cancer prevention and treatment). Estrogen signaling manipulation has been shown to alter both cancer incidence and progression (4244). This study suggests that women with a G/G genotype for SNP309 could be affected differently by estrogen signaling manipulation than women with a T/T genotype. Specifically, in the case studies of DLBCL, STS, and high ER-positive (
50%) IDC of the breast, a total of 147 female cancer patients diagnosed below the average age of menopause, when estrogen levels are at their highest, were greatly and significantly enriched for women with a G/G genotype (29.3%) when compared with the 234 female patients diagnosed after the average age of menopause (12.8% G/G; P < 0.0001, two-sided Fisher's exact test) when estrogen levels in women measurably decrease (Figs. 1D, 2B, 3C, and 4C; Table 1
). These observations suggest that increasing estrogen levels in postmenopausal women with a G/G genotype, to alleviate menopausal symptoms, could significantly increase their risk to develop these cancers. Indeed, studies have shown the association of exogenous estrogen use by menopausal women lends to an increased risk of developing ER-positive IDC and other cancers (4446). In contrast, these observations imply that women with a G/G genotype and these cancers (DLBCL, STS, and high ER-positive IDC) would benefit from decreasing estrogen levels and this could significantly retard the progression of their disease. Indeed, many studies have shown that reducing estrogen signaling in patients with high ER-positive IDC significantly retards tumor growth and results in longer overall survival rates (43, 47). It will be interesting to determine if reduction of estrogen signaling will also prove to be an effective treatment for G/G women with DLBCL and STS, as the results presented here predict.
|
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Eve Wadsworth, Kelly J. Lafaro, Johanna Lee, Reina Roth, Michael Krasnitz, and Suzanne Christen for their help in preparation of the manuscript and Andy Zelenetz for his critical reading of this manuscript.
| Footnotes |
|---|
Received 1/17/06. Revised 3/20/06. Accepted 4/ 7/06.
| References |
|---|
|
|
|---|
G and the risk of uterine leiomyosarcoma, colorectal cancer, and squamous cell carcinoma of the head and neck. J Med Genet 2005;42:6948.
-positive breast cancer cells. Cancer Res 2003;63:261623.
and SP proteins. Oncogene 2004;23:105263.[CrossRef][Medline]
and ß in soft tissue sarcomas: immunohistochemical and molecular analysis. Pathol Int 2003;53:6719.[Medline]This article has been cited by other articles:
![]() |
L. F. Grochola, A. Vazquez, E. E. Bond, P. Wurl, H. Taubert, T. H. Muller, A. J. Levine, and G. L. Bond Recent Natural Selection Identifies a Genetic Variant in a Regulatory Subunit of Protein Phosphatase 2A that Associates with Altered Cancer Risk and Survival Clin. Cancer Res., October 1, 2009; 15(19): 6301 - 6308. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Boulanger, A. Marchio, S.-S. Hong, and P. Pineau Mutational analysis of TP53, PTEN, PIK3CA and CTNNB1/{beta}-catenin genes in human herpesvirus 8-associated primary effusion lymphoma Haematologica, August 1, 2009; 94(8): 1170 - 1174. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. S. Atwal, T. Kirchhoff, E. E. Bond, M. Montagna, C. Menin, R. Bertorelle, M. C. Scaini, F. Bartel, A. Bohnke, C. Pempe, et al. Altered tumor formation and evolutionary selection of genetic variants in the human MDM4 oncogene PNAS, June 23, 2009; 106(25): 10236 - 10241. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Toffoli, P. Biason, A. Russo, E. De Mattia, E. Cecchin, C. M. Hattinger, M. Pasello, M. Alberghini, C. Ferrari, K. Scotlandi, et al. Effect of TP53 Arg72Pro and MDM2 SNP309 Polymorphisms on the Risk of High-Grade Osteosarcoma Development and Survival Clin. Cancer Res., May 15, 2009; 15(10): 3550 - 3556. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. F. Firoz, M. Warycha, J. Zakrzewski, D. Pollens, G. Wang, R. Shapiro, R. Berman, A. Pavlick, P. Manga, H. Ostrer, et al. Association of MDM2 SNP309, Age of Onset, and Gender in Cutaneous Melanoma Clin. Cancer Res., April 1, 2009; 15(7): 2573 - 2580. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Onel, D Huo, D Hastings, J Fryer-Biggs, M. Crow, and K Onel Lack of Association of the TP53 Arg72Pro SNP and the MDM2 SNP309 with systemic lupus erythematosus in Caucasian, African American, and Asian children and adults Lupus, January 1, 2009; 18(1): 61 - 66. [Abstract] [PDF] |
||||
![]() |
M. Wade and G. M. Wahl Targeting Mdm2 and Mdmx in Cancer Therapy: Better Living through Medicinal Chemistry? Mol. Cancer Res., January 1, 2009; 7(1): 1 - 11. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Wrench, R. Waters, E. Carlotti, S. Iqbal, J. Matthews, M. Calaminici, J. Gribben, T. A. Lister, and J. Fitzgibbon Clinical relevance of MDM2 SNP 309 and TP53 Arg72Pro in follicular lymphoma Haematologica, January 1, 2009; 94(1): 148 - 150. [Full Text] [PDF] |
||||
![]() |
H. Taubert, F. Bartel, T. Greither, M. Bache, M. Kappler, T. Kohler, A. Bohnke, C. Lautenschlager, H. Schmidt, H.-J. Holzhausen, et al. Association of HDM2 Transcript Levels with Age of Onset and Prognosis in Soft Tissue Sarcomas Mol. Cancer Res., October 1, 2008; 6(10): 1575 - 1581. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Lu, K. A. Becker, M. J. Hagen, H. Yan, A. L. Roberts, L. A. Mathews, S. S. Schneider, H. T. Siegelmann, K. J. MacBeth, S. M. Tirrell, et al. Transcriptional Responses to Estrogen and Progesterone in Mammary Gland Identify Networks Regulating p53 Activity Endocrinology, October 1, 2008; 149(10): 4809 - 4820. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. A. Ellis, D. Huo, O. Yildiz, L. J. Worrillow, M. Banerjee, M. M. Le Beau, R. A. Larson, J. M. Allan, and K. Onel MDM2 SNP309 and TP53 Arg72Pro interact to alter therapy-related acute myeloid leukemia susceptibility Blood, August 1, 2008; 112(3): 741 - 749. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. S. Jones, S. C. Kaste, W. Liu, C. Cheng, W. Yang, K. G. Tantisira, C.-H. Pui, and M. V. Relling CRHR1 Polymorphisms Predict Bone Density in Survivors of Acute Lymphoblastic Leukemia J. Clin. Oncol., June 20, 2008; 26(18): 3031 - 3037. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Cattelani, R. Defferrari, S. Marsilio, R. Bussolari, O. Candini, F. Corradini, G. Ferrari-Amorotti, C. Guerzoni, L. Pecorari, C. Menin, et al. Impact of a Single Nucleotide Polymorphism in the MDM2 Gene on Neuroblastoma Development and Aggressiveness: Results of a Pilot Study on 239 Patients Clin. Cancer Res., June 1, 2008; 14(11): 3248 - 3253. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Gryshchenko, S. Hofbauer, M. Stoecher, P. T. Daniel, M. Steurer, A. Gaiger, K. Eigenberger, R. Greil, and I. Tinhofer MDM2 SNP309 Is Associated With Poor Outcome in B-Cell Chronic Lymphocytic Leukemia J. Clin. Oncol., May 10, 2008; 26(14): 2252 - 2257. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Terry, M. McGrath, I-M. Lee, J. Buring, and I. De Vivo MDM2 SNP309 Is Associated with Endometrial Cancer Risk Cancer Epidemiol. Biomarkers Prev., April 1, 2008; 17(4): 983 - 986. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. S. Lum, H. W. Chua, H. Li, W.-F. Li, N. Rao, J. Wei, Z. Shao, and K. Sabapathy MDM2 SNP309 G allele increases risk but the T allele is associated with earlier onset age of sporadic breast cancers in the Chinese population Carcinogenesis, April 1, 2008; 29(4): 754 - 761. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Bartel, J. Jung, A. Bohnke, E. Gradhand, K. Zeng, C. Thomssen, and S. Hauptmann Both Germ Line and Somatic Genetics of the p53 Pathway Affect Ovarian Cancer Incidence and Survival Clin. Cancer Res., January 1, 2008; 14(1): 89 - 96. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Hu, G. Jin, L. Wang, F. Chen, X. Wang, and H. Shen MDM2 Promoter Polymorphism SNP309 Contributes to Tumor Susceptibility: Evidence from 21 Case-Control Studies Cancer Epidemiol. Biomarkers Prev., December 1, 2007; 16(12): 2717 - 2723. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Mrkonjic, S. Raptis, R. C. Green, N. Monga, D. Daftary, E. Dicks, H.B. Younghusband, P. S. Parfrey, S. S. Gallinger, J. R. McLaughlin, et al. MSH2 118T>C and MSH6 159C>T promoter polymorphisms and the risk of colorectal cancer Carcinogenesis, December 1, 2007; 28(12): 2575 - 2580. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Wilkening, J. L. Bermejo, and K. Hemminki MDM2 SNP309 and cancer risk: a combined analysis Carcinogenesis, November 1, 2007; 28(11): 2262 - 2267. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. K. Schmidt, S. Reincke, A. Broeks, L. M. Braaf, F. B.L. Hogervorst, R. A.E.M. Tollenaar, N. Johnson, O. Fletcher, J. Peto, J. Tommiska, et al. Do MDM2 SNP309 and TP53 R72P Interact in Breast Cancer Susceptibility? A Large Pooled Series from the Breast Cancer Association Consortium Cancer Res., October 1, 2007; 67(19): 9584 - 9590. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. D. Orsted, S. E. Bojesen, A. Tybjaerg-Hansen, and B. G. Nordestgaard Tumor suppressor p53 Arg72Pro polymorphism and longevity, cancer survival, and risk of cancer in the general population J. Exp. Med., June 11, 2007; 204(6): 1295 - 1301. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sanchez-Carbayo, N. D. Socci, T. Kirchoff, N. Erill, K. Offit, B. H. Bochner, and C. Cordon-Cardo A Polymorphism in HDM2 (SNP309) Associates with Early Onset in Superficial Tumors, TP53 Mutations, and Poor Outcome in Invasive Bladder Cancer Clin. Cancer Res., June 1, 2007; 13(11): 3215 - 3220. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Hartmann, V. Fernandez, H. Stoecklein, L. Hernandez, E. Campo, and A. Rosenwald Increased MDM2 expression is associated with inferior survival in mantle cell lymphoma, but not related to the MDM2 SNP309 Haematologica, April 1, 2007; 92(4): 574 - 575. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Hu, Z. Feng, L. Ma, J. Wagner, J. J. Rice, G. Stolovitzky, and A. J. Levine A Single Nucleotide Polymorphism in the MDM2 Gene Disrupts the Oscillation of p53 and MDM2 Levels in Cells Cancer Res., March 15, 2007; 67(6): 2757 - 2765. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. S. Atwal, G. L. Bond, S. Metsuyanim, M. Papa, E. Friedman, T. Distelman-Menachem, E. Ben Asher, D. Lancet, D. A. Ross, J. Sninsky, et al. Haplotype structure and selection of the MDM2 oncogene in humans PNAS, March 13, 2007; 104(11): 4524 - 4529. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. L Bond, C. Menin, R. Bertorelle, P. Alhopuro, L. A Aaltonen, and A. J Levine MDM2 SNP309 accelerates colorectal tumour formation in women J. Med. Genet., December 1, 2006; 43(12): 950 - 952. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |