Cancer Research Prevention Award  Advances in Breast Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bond, G. L.
Right arrow Articles by Levine, A. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bond, G. L.
Right arrow Articles by Levine, A. J.
[Cancer Research 66, 5104-5110, May 15, 2006]
© 2006 American Association for Cancer Research


Molecular Biology, Pathobiology, and Genetics

MDM2 SNP309 Accelerates Tumor Formation in a Gender-Specific and Hormone-Dependent Manner

Gareth L. Bond1,2, Kim M. Hirshfield2, Tomas Kirchhoff3, Gabriella Alexe1, Elisabeth E. Bond2, Harlan Robins1, Frank Bartel4, Helge Taubert4, Peter Wuerl5, William Hait2, Deborah Toppmeyer2, Kenneth Offit3 and Arnold J. Levine1,2

1 The Institute for Advanced Study, Princeton, New Jersey; 2 The Cancer Institute of New Jersey, New Brunswick, New Jersey; 3 Memorial Sloan Kettering Cancer Center, New York, New York; 4 Martin-Luther-University, Halle/Salle, Germany; and 5 University of Ulm, Ulm, Germany

Requests for reprints: Arnold Levine, The Institute for Advanced Study, Einstein Drive, Princeton, NJ 08540-0631. Phone: 609-734-8005; Fax: 609-924-7592; E-mail: alevine{at}ias.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The importance of the p53 stress response pathway in the suppression of tumor formation is well documented. In a previous report, a single nucleotide polymorphism (SNP309 T/G) was found in the promoter of the MDM2 gene resulting in higher levels of MDM2 RNA and protein and, consequently, in the attenuation of the p53 pathway both in vitro and in vivo. As the SNP309 locus is found in a region of the MDM2 promoter, which is regulated by hormonal signaling pathways, and the G-allele of SNP309 increases the affinity of a well-described cotranscriptional activator of nuclear hormone receptors (i.e., Sp1), the hypothesis that the SNP309 locus could alter the effects of hormones on tumorigenesis was tested in vivo in humans. Data obtained from patients with three different sporadic cancers, from four independent case studies, support this hypothesis, providing an example for the genetic basis of gender differences in cancer and showing that the genotype at a specific locus can affect how hormones, like estrogen, affect tumorigenesis in humans. (Cancer Res 2006; 66(10): 5104-10)


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
On exposure to cellular stresses, the p53 protein is stabilized, increases its concentration, and becomes active as a transcription factor initiating a transcriptional program, which leads to DNA repair, cell cycle arrest, cellular senescence, or apoptosis. The p53 stress response pathway functions as a critical tumor suppressor pathway, which is underlined by the observation that the p53 gene is one of the most commonly mutated genes in human tumors (1). Furthermore, both mice and humans harboring a germ-line inactivating mutation in just one allele of the p53 gene develop tumors early in life and at very high frequencies (25). A previous report provided evidence that naturally occurring polymorphic genetic variant in the p53 stress response pathway influences an individual's susceptibility to cancer (6).

Both genetic and biochemical studies have shown that the MDM2 oncogene is a key negative regulator of the p53 protein (7). Since the initial publication (6), multiple studies have shown that the G-allele of the single nucleotide polymorphism (SNP309, T/G) in the promoter of the MDM2 gene was associated with the attenuation of the p53 pathway and an enhanced early onset of, and increased risk for, tumorigenesis (6, 814). In various reports, results were presented that support the model that the G-allele of SNP309 increases the DNA binding affinity of the transcriptional activator Sp1, which results in high levels of MDM2 mRNA and protein in human cells and tissue with this allele (10, 15, 16). The heightened MDM2 levels were shown to lead to the attenuation of the p53 DNA damage response induced by various chemotherapeutic drugs (6, 15), in concordance with the well-described role of MDM2 in the negative regulation of the p53 protein. In humans, two independent reports have shown that germ-line p53 mutation carriers who possessed the G-allele of SNP309 were diagnosed with cancer, on average, 7 or 10 years earlier than those who were homozygous for the T-allele (6, 9). It was proposed that high levels of MDM2, resulting from the G-allele of SNP309 and just one wild-type p53 allele, produce a severely weakened p53 tumor suppressor pathway resulting in a higher mutation rate, poorer DNA repair processes, and reduced apoptosis leading to faster and more frequent tumor formation (6, 16).

Estrogen signaling has been shown to regulate MDM2 expression levels. Many reports have shown that MDM2 mRNA and protein levels are heightened in breast tumors which express the estrogen receptor (ER), a critical component of the estrogen signaling pathway (1721). In fact, the expression of ER{alpha} was shown to induce transcription of MDM2 (22). The regulation of MDM2 expression by estrogen, as well as by thyroid hormone, is mediated, at least in part, through a well-characterized region of the MDM2 promoter (20, 2224). Both the ER and the thyroid hormone receptor are known to bind to this region of the promoter and activate transcription of the MDM2 gene (23, 24). Interestingly, SNP309 is found in this region of the promoter. The SNP309 locus potentially could affect the transcriptional regulation of MDM2 by hormone receptors as the G-allele of SNP309 increases the affinity of the MDM2 promoter for Sp1, which is a well-characterized cotranscriptional activator for multiple hormone receptors, including the ER (2527). These observations suggest the possibility that the SNP309 locus could alter the effects of hormones, like estrogen, on tumorigenesis, and therefore contribute to the gender differences observed in many different types of cancer. In this report, data are presented from four independent studies that support this hypothesis.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Statistical analysis. A randomization test is employed to determine the statistical significance of the age of onset of cancer between the different genotypes. The groups are compared pairwise and each instance of an element from the second group adds one to the distance. This total distance is the cutoff. The lists are then randomly permuted, holding fixed the number of elements of each list. The calculated P value is the percent of randomized groups that have a distance less than the cutoff as determined by a large Monte Carlo simulation.

Ashkenazi lymphoma and breast cancer cases. Lymphoma cases were derived from 678 cases of non-Hodgkin's lymphoma ascertained at a single center in the New York metropolitan area during the period of April 2000 to March 2005. Of these, 162 were classified as diffuse large B-cell lymphoma (DLBCL). The breast cancer cases were derived from 658 individuals with invasive ductal carcinoma (IDC). The patients were Caucasians and self-identified as of Ashkenazi Jewish ethnicity. Pathology reports, and in the case of breast tumors, ER status, of all cases were reviewed and age of diagnosis was recorded. Germ-line DNA from cases was collected and permanently stripped of identifiers before genotyping, in accord with an Institutional Review Board–approved protocol.

Controls were drawn from DNA of 976 healthy men and women, all of Ashkenazi ancestry by self-report of religion and country of origin of parents and grandparents. Age range was 18 to 65 years. Control DNA samples were available from the New York Cancer Project, an ongoing cohort study of over 17,000 volunteers of varying ethnic backgrounds who live in the New York metropolitan area (28).

Soft-tissue sarcoma cases. Samples originated from 105 sporadic soft-tissue sarcoma (STS) cases diagnosed from 1991 to 2001 at the Surgical Clinic 1, University of Leipzig and at the Institute of Pathology of the Martin-Luther-University Halle, Germany. All patients had a R0-resection of a their primary tumor done by the same team. The patients were of Caucasian ethnicity with an age range of 14 to 84 years (average, 55 years). The STS samples consisted of 29 liposarcomas, 23 malignant fibrous histiocytomas, 16 leiomyosarcomas, 12 neurogenic sarcomas, 8 rhabdomyosarcomas, 8 synovial sarcomas, 5 fibrosarcomas, and 4 other types. One hundred four healthy blood donors of Caucasian ethnicity (non-Jewish) from Germany served as controls.

Breast cancer cases. Between April 2004 and October 2005, 258 Caucasian women previously diagnosed with infiltrating ductal carcinoma of the breast were accrued to this study at The Cancer Institute of New Jersey (New Brunswick, NJ). Pathology reports were reviewed on all cases. Venipuncture was done and genomic DNA was prepared from whole blood. Age and menopausal status at diagnosis, ER status, and degree of positivity were recorded. All information was devoid of identifiers and kept in a database. Data collection was in accord with an approval by the Institutional Review Board at the Cancer Institute of New Jersey.

Sequence analysis. The status of the SNP309 locus was determined for the p53 germ-line mutation carriers, the unaffected non-Ashkenazi Jewish individuals, the STS patients, and the second group of Caucasian IDC patients by PCR amplification and subsequent sequencing (primer 1, CGGGAGTTCAGGGTAAAGGT; primer 2, AGCAAGTCGGTGCTTACCTG).

The status of the SNP309 locus was determined for the unaffected Ashkenazi Jewish individuals, DLBCL patients, and the first group of Caucasian Ashkenazi Jewish IDC patients by using the combination of MspIA1 RFLP analysis and 5' allelic discrimination assay (TaqMan). For the MspA1 RFLP analysis, primers 5'-CGGGAGTTCAGGGTAAAGGT-3' and 5'-AGCAAGTCGGTGCTTACCTG-3' were used. PCR was done under standard conditions using 20 ng of genomic DNA and annealing temperature of 66°C. The resulting PCR product (351 bp) was digested by MspIA1. MspIA1 cleaves final PCR product on two sites, one is constitutive that served as an internal control of enzymatic digestion and allele G of SNP309 generates specific MspIA1 restriction site.

The TaqMan 5' allelic discrimination PCR assay was done in 384-well plates. Each well contained 5.0 ng DNA, 2.5 µL TaqMan Universal PCR Master Mix (Applied Biosystems, Foster City, CA), 0.0625 µL of probe and primer solution (Assays-on-Demand, Applied Biosystems), and 2.4375 µL distilled water. The PCR reaction was initiated at 95°C for 10 minutes, followed by 47 cycles of 92°C for 30 seconds and 60°C for 60 seconds. Following PCR, fluorescence was measured in an ABI 7900 HT Sequence Detector (Applied Biosystems) and the genotype clusters were manually scored using Sequence Detection Software 2.0 (Applied Biosystems).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Diffuse large B-cell lymphoma. To test if SNP309 can contribute to the gender differences observed in cancer, a type of cancer was studied with a well-documented gender difference in tumor incidence (i.e., non-Hodgkin's lymphoma). Non-Hodgkin's lymphoma is the fifth most common cancer in both men and women but men have an increased risk for developing non-Hodgkin's lymphoma worldwide, as well as an earlier average age of tumor diagnosis (29, 30). In this study, Caucasians of Ashkenazi Jewish ethnicity with DLBCL were analyzed. It is interesting to note that Ashkenazi Jewish individuals have a higher relative frequency of the G-allele compared with Caucasians not of Ashkenazi descent. Specifically, 976 Ashkenazi Jewish individuals who had never been diagnosed with cancer, on sample ascertainment, were found to have the following relative frequency of three different genotypes at the SNP309 locus: T/T, 27%; T/G, 49%; G/G, 24%. One hundred four Caucasians, not of Ashkenazi decent and who had never been diagnosed with cancer, on sample ascertainment, were found to have the following relative frequencies: T/T, 38%; T/G, 51%; G/G, 10%.

As previously observed (29, 30), in 162 Caucasians of Ashkenazi Jewish ethnicity diagnosed with DLBCL, the 83 male patients were diagnosed, on average, 5 years earlier than the 79 female patients (Fig. 1A ). Specifically, the male patients were diagnosed, on average, at 57 years of age (range, 25-85 years) and females at 62 years of age (range, 21-93 years). The male DLBCL patients showed no large differences in the age of tumor diagnosis when separated into the different genotypes of the SNP309 locus (T/T males, 58 years of age versus G/G males, 60 years of age; Fig. 1B). In contrast, G/G women showed a 13-year earlier tumor diagnosis than T/T women [T/T women, 68 years of age (range, 55-78 years) versus G/G women, 55 years of age (range, 21-87 years); Fig. 1C].


Figure 1
View larger version (14K):
[in this window]
[in a new window]
 
Figure 1. The G-allele of SNP309 associates with an accelerated age of onset of DLBCL in younger females but not in males. DLBCL has a well-documented gender difference in tumor incidence. A, the cumulative incidence of cancer for both men (black squares) and women (gray diamonds) is plotted as a function of age. The cumulative incidence of DLBCL for both the individuals T/T in genotype (black squares) and G/G in genotype (gray diamonds) is plotted as a function of age for males (B) and females (C). Female DLBCL patients diagnosed below the average age of menopause (51 years) are enriched for the G-allele of SNP309. D, relative ratios of the three genotypes at the SNP309 locus for the male DLBCL patients, the female DLBCL patients diagnosed at ≤51 years of age, and females diagnosed >51 years of age.

 
Estrogen has been proposed to play a role in the gender-specific differences in DLBCL incidence, as women exposed to exogenous estrogens have been observed to have altered risk for DLBCL (3133). Indeed, ER, a critical component of the estrogen-signaling pathway, is expressed in multiple B-cell lymphomas (3436). If estrogen signaling is working to allow the G-allele of SNP309 to accelerate tumor formation in women, then differences in the age-dependent incidence of DLBCL between G/G women and T/T women should be the largest in women below the average age of menopause (51 years) when female specific hormones like estrogen are at their highest levels. As seen in the Fig. 1C, where the cumulative incidence of DLBCL for each genotype is plotted as a function of age, the greatest differences in the age-dependent incidence between the two genotypes are seen in women <51 years of age. Indeed, there are no women with a T/T genotype in these cases diagnosed with DLBCL under the age of 55 years. By contrast, over half of the G/G women had already been diagnosed with DLBCL by this age (P = 0.0027, two-tailed Fisher's exact test). The G/G women make up 48% of the female DLBCL cases diagnosed by the age of 51 years and only 19% of the female cases >51 years of age and only 24% of the male DLBCL cases (Fig. 1D; P = 0.0166, two-tailed Fisher's exact test). Together, these data support the hypothesis that estrogen could play a role in the ability of the G-allele of SNP309 to accelerate DLBCL formation in women as the greatest differences in the age-dependent incidence between G/G women and T/T women are the greatest below the average age of menopause when gender-specific hormones, like estrogen, are at the highest levels.

Soft-tissue sarcoma. The G-allele of SNP309 in its homozygous state (G/G) has been previously shown to associate with a 12-year earlier age of onset of sporadic STS compared with T/T individuals (6). The STS patients in this study were made up of 58 Caucasian women and 47 Caucasian men. When separated by gender, it became clear that the significant earlier age of onset of STS observed in these cases is only associated with the G/G women, as only 3 of 47 male patients had the G/G genotype. Specifically, G/G women were diagnosed on average 14 years earlier than T/T women [T/T women, 59 years of age (range, 30-78 years) versus G/G women, 45 years of age (range, 23-81 years); Fig. 2A ; P = 0.028, randomization test]. As the presence of ER in STS is well documented (3740), the possibility that estrogen might be playing a role in the ability of the G-allele of SNP309 to accelerate STS formation in women was tested. Indeed, the largest differences in the age-dependent STS incidence between G/G women and T/T women were also seen in women below the average age of menopause (51 years) when gender-specific hormones, such as estrogen, are at their highest levels. Specifically, 67% of G/G women were diagnosed with STS by the age of 51 years, but only 27% of T/T women (P = 0.05, one-tailed Fisher's exact test). In fact, the overall frequency of the G/G genotype is 27% in female STS cases diagnosed by the age of 51 years and only 8% in female cases diagnosed >51 years of age and 6% in male STS cases (Fig. 2B; P = 0.0173, one-tailed Fisher's exact test). Together these data further support the hypothesis that gender-specific hormones, like estrogen, could be playing a role in the ability of the G-allele of SNP309 to accelerate both sporadic DLBCL formation and sporadic STS tumor formation.


Figure 2
View larger version (7K):
[in this window]
[in a new window]
 
Figure 2. The G-allele of SNP309 associates with an accelerated age of onset of STS in younger females. A, the cumulative incidence of STS for both the women T/T in genotype (black squares) and G/G in genotype (gray diamonds) is plotted as a function of age. Female STS patients diagnosed below the average age of menopause (51 years) are enriched for the G-allele of SNP309. B, the relative ratios of the three genotypes at the SNP309 locus for the male STS patients, the female STS patients diagnosed at ≤51 years of age, and females diagnosed >51 years of age.

 
Invasive ductal breast carcinoma. To test if the G-allele of SNP309 can indeed accelerate tumorigenesis only in the presence of an active estrogen-signaling pathway in vivo, women with the same tumor type were studied. The tumor type studied was sporadic IDC of the breast, which accounts for the vast majority of all breast cancers (41). Some women developed IDC with an intact estrogen pathway whereas others did not. DNA was isolated from lymphocytes from women with IDC of the breast and the status of SNP309 was determined. All patients were Caucasians of self-identified Ashkenazi Jewish ethnicity. Individuals with the most common breast cancer susceptibility alleles of the BRCA1 and BRCA2 genes were excluded from this study. In each case, pathology reports, including analysis of ER (when available), and age at diagnosis were recorded. At diagnosis, the levels of the ER, a critical component of the estrogen-signaling pathway, are measured in the tumor to determine the most appropriate course of therapy. ER is detectable in 60% to 70% of all breast cancers and its expression level correlates with the tumor dependence on estrogen for growth (42, 43).

Of the 658 IDC patients, 136 patients were noted to have no significant levels of ER expression (<10% of tumor cells stained positive for ER) whereas 472 were noted to have significant levels of ER staining (≥10% of tumors cells stained positive for ER) and the expression level of ER was not known for 50 patients. Of the 472 patients noted to have significant levels of ER staining, 127 patients were known to have high levels of ER expression (≥50% of the tumor cells stained positive for ER).

If the G-allele of SNP309 can accelerate tumorigenesis only in the presence of an active estrogen-signaling pathway, then an earlier age of tumor onset for G/G women versus T/T women should be greatest in the formation of tumors that express high levels of ER, as the percent of tumor cells which stain positive for ER has been shown to correlate with the tumor dependence on estrogen for growth (42, 43). Indeed, in those 100 women whose tumors expressed high levels of ER (≥50%), G/G women showed a 7-year average earlier age of onset of IDC compared with T/T women and an 11-year median earlier onset [T/T women, 60 years of age (range, 33-81 years) versus G/G women, 53 years of age (range, 35-84 years); P = 0.0094, randomization test; Fig. 3A ]. No significant differences were observed in those women whose tumors expressed low levels of ER [<10% (Fig. 3B) or <50% (data not shown)]. Specifically, the ER-negative T/T patients were diagnosed on average at 51 years of age and G/G patients at 56 years of age. Interestingly, the acceleration of high ER-positive (≥50%) IDC formation in G/G women compared with T/T women was also greatest below the average age of menopause (51 years) when estrogen levels are at their highest. Fifty-four percent of the patients with the G/G genotype had been diagnosed with high ER-positive (≥50%) IDC by the age of 51 years, in contrast to only 22% of the T/T patients (Fig. 3A; P = 0.0133, one-tailed Fisher's exact test). In fact, women with the G/G genotype make up 33% of high ER-positive (≥50%) IDC cases diagnosed by the age of 51 years, as opposed to 16% of high ER-positive (≥50%) IDC cases diagnosed >51 years of age (Fig. 3C; P = 0.0272, two-tailed Fisher's exact test). These data further support the hypothesis that an active estrogen-signaling pathway allows for the G-allele of SNP309 to accelerate tumor formation in women.


Figure 3
View larger version (11K):
[in this window]
[in a new window]
 
Figure 3. The G-allele of SNP309 associates with an accelerated age of onset in high ER-positive, but not in ER-negative, IDC of the breast in Caucasians (Ashkenazi Jewish). The cumulative incidence of IDC for both the individuals T/T in genotype (black squares) and G/G in genotype (gray diamonds) is plotted as a function of age for high ER-positive tumors (>50% of the tumor cells stained positive for ER; A) and ER-negative tumors (<10%; B). Female patients with high ER-positive IDC (>50% of the tumor cells stained positive for ER) diagnosed below the average age of menopause (51 years) are enriched for the G-allele of SNP309. C, relative ratios of the three genotypes at the SNP309 locus for the female high ER-positive IDC patients diagnosed at ≤51 years of age and females diagnosed >51 years of age.

 
To confirm these observations with an independent study, the hypothesis was tested again in a second group of Caucasian IDC patients not selected for Ashkenazi Jewish ethnicity. In the 258 IDC patients in this study, 71 patients were noted to have no significant levels of ER expression (<10% of tumor cells stained positive for ER) whereas 184 were noted to have significant levels of ER staining (≥10% of tumor cells stained positive for ER) and the expression level of ER was not known for 3 patients. Of the 184 patients noted to have significant levels of ER staining, 117 patients were known to have high levels of ER expression (≥50% of the tumor cells stained positive for ER).

As previously observed, in the 117 women in this second group whose tumors expressed high levels of ER (>50%), G/G women again showed a 7-year earlier onset of IDC compared with T/T women [T/T women, 54 years of age (range, 29-76 years) versus G/G women, 47 years of age (range, 32-62 years); P = 0.025, randomization test; Fig. 4A ]. Again, no significant differences were observed in the 71 women whose tumors expressed lower levels of ER [<10% (Fig. 4B) or <50% (data not shown)]. The acceleration of high ER-positive (≥50%) IDC formation in G/G women compared with T/T women was also greatest below the average age of menopause (51 years) when estrogen levels are at their highest. Eighty percent of the G/G patients had been diagnosed with ER-positive IDC by the age of 51 years, but only 39% of the T/T patients (P = 0.0061, one-sided Fisher's exact test). In fact, G/G women make up 20% of high ER-positive (≥50%) IDC cases diagnosed by the age of 51 years, as opposed to 5% of high ER-positive (≥50%) IDC cases diagnosed >51 years of age (Fig. 4C; P = 0.0133, one-sided Fisher's exact test). In this study, the menopause status of the patients at diagnosis was available and, as predicted, individuals with the G-allele of SNP309 were enriched in the premenopausal high ER-positive (≥50%) IDC cases compared with the postmenopausal cases. Specifically, individuals with the G-allele of SNP309 made up 72% of the premenopausal cases and only 53% of the postmenopausal cases (Fig. 4D; P = 0.0247, one-sided Fisher's exact test).


Figure 4
View larger version (14K):
[in this window]
[in a new window]
 
Figure 4. The G-allele of SNP309 associates with an accelerated age of onset in high ER-positive but not ER-negative IDC of the breast in a second independent group of Caucasians. The cumulative incidence of IDC for both the individuals T/T in genotype (black squares) and G/G in genotype (gray diamonds) is plotted as a function of age for high ER-positive tumors (>50% of the tumor cells stained positive for ER; A) and ER-negative tumors (<10%; B). Female patients with high ER-positive IDC (>50% of the tumor cells stained positive for ER) diagnosed below the average age of menopause (51 years; C) or premenopausal (D) are enriched for the G-allele of SNP309. C and D, relative ratios of the three genotypes at the SNP309 locus for the female high ER-positive IDC patients diagnosed at ≤51 years of age or premenopausal and females diagnosed >51 years of age or postmenopausal.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In summary, the results of four independent studies of three different sporadic cancers (DLBCL, STS, and IDC) support the model that an active estrogen-signaling pathway, either directly or indirectly, allows for the G-allele of SNP309 to accelerate tumor formation in women. Specifically, in DLBCL patients (Fig. 1), the G-allele of SNP309 only associated with an earlier age of diagnosis in female patients and not in male patients, similar to what was previously observed in a study of male and female colorectal cancer patients (8). That this gender-specific difference could be due to gender-specific hormones was supported by the observations that both in female DLBCL patients (Fig. 1) and in female STS patients (Fig. 2), the differences in age-specific cancer incidence between G/G and T/T women were the largest below the average age of menopause (51 years) when gender-specific hormones, like estrogen, are at their highest levels. That the estrogen-signaling pathway could be either directly or indirectly involved was supported by the observations that the G-allele of SNP309 only associated with an earlier age of onset in high ER-positive (≥50%), but not in ER-negative, IDC formation, which was seen in two independent case studies (Figs. 3 and 4). Further support came from the observation that the differences in age-specific cancer incidence between G/G and T/T women with high ER-positive (≥50%) IDC were the largest below the average age of menopause (51 years) when estrogen levels are at their highest (Figs. 3A and 4A). This model, in which an active estrogen-signaling pathway allows for the G-allele of SNP309 to accelerate tumor formation in women, may help explain the genetic basis for the frequently observed gender differences in cancer and shows that the genotype at a specific locus can affect how hormones, like estrogen, will affect tumorigenesis in humans.

The estrogen-signaling pathway can be regulated in humans for a variety of reasons (e.g., contraception, relief of menopausal symptoms, as well as cancer prevention and treatment). Estrogen signaling manipulation has been shown to alter both cancer incidence and progression (4244). This study suggests that women with a G/G genotype for SNP309 could be affected differently by estrogen signaling manipulation than women with a T/T genotype. Specifically, in the case studies of DLBCL, STS, and high ER-positive (≥50%) IDC of the breast, a total of 147 female cancer patients diagnosed below the average age of menopause, when estrogen levels are at their highest, were greatly and significantly enriched for women with a G/G genotype (29.3%) when compared with the 234 female patients diagnosed after the average age of menopause (12.8% G/G; P < 0.0001, two-sided Fisher's exact test) when estrogen levels in women measurably decrease (Figs. 1D, 2B, 3C, and 4C; Table 1 ). These observations suggest that increasing estrogen levels in postmenopausal women with a G/G genotype, to alleviate menopausal symptoms, could significantly increase their risk to develop these cancers. Indeed, studies have shown the association of exogenous estrogen use by menopausal women lends to an increased risk of developing ER-positive IDC and other cancers (4446). In contrast, these observations imply that women with a G/G genotype and these cancers (DLBCL, STS, and high ER-positive IDC) would benefit from decreasing estrogen levels and this could significantly retard the progression of their disease. Indeed, many studies have shown that reducing estrogen signaling in patients with high ER-positive IDC significantly retards tumor growth and results in longer overall survival rates (43, 47). It will be interesting to determine if reduction of estrogen signaling will also prove to be an effective treatment for G/G women with DLBCL and STS, as the results presented here predict.


View this table:
[in this window]
[in a new window]
 
Table 1. Distribution of MDM2 SNP309 in patients from four independent case studies of three different tumor types

 

    Acknowledgments
 
Grant support: Breast Cancer Research Foundation, the Simons Foundation, the Leon Levy Foundation, the Lymphoma Foundation, the Frankel Fellowship, the Carmel Cancer Research Fund, National Cancer Institute grants PO1 CA 87497 and PO1 CA 65930-08, NIH grant T32 CA 99946-01, and Deutsche Krebshilfe "Mildred Scheel Stiftung" grant 10-2130-Ta2 (H. Taubert and F. Bartel).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Eve Wadsworth, Kelly J. Lafaro, Johanna Lee, Reina Roth, Michael Krasnitz, and Suzanne Christen for their help in preparation of the manuscript and Andy Zelenetz for his critical reading of this manuscript.


    Footnotes
 
Note: G.L. Bond and K.M. Hirshfield contributed equally to this manuscript.

Received 1/17/06. Revised 3/20/06. Accepted 4/ 7/06.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Lain S, Lane D. Improving cancer therapy by non-genotoxic activation of p53. Eur J Cancer 2003;39:1053–60.[CrossRef][Medline]
  2. Garber JE, Friend SH, Strong LC, et al. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein. J Natl Cancer Inst 1992;84:1156–60.[Free Full Text]
  3. Lang GA, Iwakuma T, Suh YA, et al. Gain of function of a p53 hot spot mutation in a mouse model of Li-Fraumeni syndrome. Cell 2004;119:861–72.[CrossRef][Medline]
  4. Li FP, Strong LC, Fraumeni JF, Jr., et al. Germ line p53 mutations in a familial syndrome of breast cancer, sarcomas, and other neoplasms. Science 1990;250:1233–8.[Abstract/Free Full Text]
  5. Olive KP, Tuveson DA, Ruhe ZC, et al. Mutant p53 gain of function in two mouse models of Li-Fraumeni syndrome. Cell 2004;119:847–60.[CrossRef][Medline]
  6. Bond GL, Hu W, Bond EE, et al. A single nucleotide polymorphism in the MDM2 promoter attenuates the p53 tumor suppressor pathway and accelerates tumor formation in humans. Cell 2004;119:591–602.[CrossRef][Medline]
  7. Bond GL, Hu W, Levine AJ. MDM2 is a central node in the p53 pathway: 12 years and counting. Curr Cancer Drug Targets 2005;5:3–8.[CrossRef][Medline]
  8. Alhopuro P, Ylisaukko-Oja SK, Koskinen WJ, et al. The MDM2 promoter polymorphism SNP309T->G and the risk of uterine leiomyosarcoma, colorectal cancer, and squamous cell carcinoma of the head and neck. J Med Genet 2005;42:694–8.[Abstract/Free Full Text]
  9. Bougeard G, Baert-Desurmont S, Tournier I, et al. Impact of the MDM2 SNP309 and TP53 Arg72Pro polymorphism on age of tumour onset in Li-Fraumeni syndrome. J Med Genet. Epub 2005 Oct 28.
  10. Hong Y, Miao X, Zhang X, et al. The role of P53 and MDM2 polymorphisms in the risk of esophageal squamous cell carcinoma. Cancer Res 2005;65:9582–7.[Abstract/Free Full Text]
  11. Swinney RM, Hsu SC, Hirschman BA, Chen TT, Tomlinson GE. MDM2 promoter variation and age of diagnosis of acute lymphoblastic leukemia. Leukemia 2005;19:1996–8.[CrossRef][Medline]
  12. Zhang X, Miao X, Guo Y, et al. Genetic polymorphisms in cell cycle regulatory genes MDM2 and TP53 are associated with susceptibility to lung cancer. Hum Mutat 2006;27:110–7.[CrossRef][Medline]
  13. Lind H, Zienolddiny S, Ekstrom PO, Skaug V, Haugen A. Association of a functional polymorphism in the promoter of the MDM2 gene with risk of nonsmall cell lung cancer. Int J Cancer. Epub 2006 Feb 22.
  14. Menin C, Scaini MC, De Salvo GL, et al. Association between MDM2-309 and age at colorectal cancer diagnosis according to p53 mutation status. J Natl Cancer Inst 2006;98:285–8.[Abstract/Free Full Text]
  15. Arva NC, Gopen TR, Talbott KE, et al. A chromatin-associated and transcriptionally inactive p53-2 complex occurs in mdm2 SNP309 homozygous cells. J Biol Chem 2005;280:26776–87.[Abstract/Free Full Text]
  16. Bond GL, Hu W, Levine A. A single nucleotide polymorphism in the MDM2 gene: from a molecular and cellular explanation to clinical effect. Cancer Res 2005;65:5481–4.[Abstract/Free Full Text]
  17. Bueso-Ramos CE, Manshouri T, Haidar MA, et al. Abnormal expression of MDM-2 in breast carcinomas. Breast Cancer Res Treat 1996;37:179–88.[CrossRef][Medline]
  18. Gudas JM, Nguyen H, Klein RC, Katayose D, Seth P, Cowan KH. Differential expression of multiple MDM2 messenger RNAs and proteins in normal and tumorigenic breast epithelial cells. Clin Cancer Res 1995;1:71–80.[Medline]
  19. Marchetti A, Buttitta F, Girlando S, et al. mdm2 gene alterations and mdm2 protein expression in breast carcinomas. J Pathol 1995;175:31–8.[CrossRef][Medline]
  20. Okumura N, Saji S, Eguchi H, Nakashima S, Saji S, Hayashi S. Distinct promoter usage of mdm2 gene in human breast cancer. Oncol Rep 2002;9:557–63.[Medline]
  21. Sheikh MS, Shao ZM, Hussain A, Fontana JA. The p53-binding protein MDM2 gene is differentially expressed in human breast carcinoma. Cancer Res 1993;53:3226–8.[Abstract/Free Full Text]
  22. Phelps M, Darley M, Primrose JN, Blaydes JP. p53-independent activation of the hdm2-2 promoter through multiple transcription factor response elements results in elevated hdm2 expression in estrogen receptor {alpha}-positive breast cancer cells. Cancer Res 2003;63:2616–23.[Abstract/Free Full Text]
  23. Kinyamu HK, Archer TK. Estrogen receptor-dependent proteasomal degradation of the glucocorticoid receptor is coupled to an increase in mdm2 protein expression. Mol Cell Biol 2003;23:5867–81.[Abstract/Free Full Text]
  24. Qi JS, Yuan Y, Desai-Yajnik V, Samuels HH. Regulation of the mdm2 oncogene by thyroid hormone receptor. Mol Cell Biol 1999;19:864–72.[Abstract/Free Full Text]
  25. Khan S, Abdelrahim M, Samudio I, Safe S. Estrogen receptor/Sp1 complexes are required for induction of cad gene expression by 17ß-estradiol in breast cancer cells. Endocrinology 2003;144:2325–35.[Abstract/Free Full Text]
  26. Petz LN, Ziegler YS, Schultz JR, Kim H, Kemper JK, Nardulli AM. Differential regulation of the human progesterone receptor gene through an estrogen response element half site and Sp1 sites. J Steroid Biochem Mol Biol 2004;88:113–22.[CrossRef][Medline]
  27. Stoner M, Wormke M, Saville B, et al. Estrogen regulation of vascular endothelial growth factor gene expression in ZR-75 breast cancer cells through interaction of estrogen receptor {alpha} and SP proteins. Oncogene 2004;23:1052–63.[CrossRef][Medline]
  28. Mitchell MK, Gregersen PK, Johnson S, Parsons R, Vlahov D. The New York Cancer Project: rationale, organization, design, and baseline characteristics. J Urban Health 2004;81:301–10.[Medline]
  29. Muller AM, Ihorst G, Mertelsmann R, Engelhardt M. Epidemiology of non-Hodgkin's lymphoma (NHL): trends, geographic distribution, and etiology. Ann Hematol 2005;84:1–12.[Medline]
  30. Schottenfeld D, Fraumeni JF. Cancer epidemiology and prevention. 2nd ed. New York: Oxford University Press; 1996.
  31. Bernstein L, Ross RK. Prior medication use and health history as risk factors for non-Hodgkin's lymphoma: preliminary results from a case-control study in Los Angeles County. Cancer Res 1992;52:5510–5s.
  32. Cerhan JR, Vachon CM, Habermann TM, et al. Hormone replacement therapy and risk of non-Hodgkin lymphoma and chronic lymphocytic leukemia. Cancer Epidemiol Biomarkers Prev 2002;11:1466–71.[Abstract/Free Full Text]
  33. Nelson RA, Levine AM, Bernstein L. Reproductive factors and risk of intermediate- or high-grade B-Cell non-Hodgkin's lymphoma in women. J Clin Oncol 2001;19:1381–7.[Abstract/Free Full Text]
  34. Danel L, Menouni M, Cohen JH, et al. Distribution of androgen and estrogen receptors among lymphoid and haemopoietic cell lines. Leuk Res 1985;9:1373–8.[CrossRef][Medline]
  35. Jakob F, Tony HP, Schneider D, Thole HH. Immunological detection of the oestradiol receptor protein in cell lines derived from the lymphatic system and the haematopoietic system: variability of specific hormone binding in vitro. J Endocrinol 1992;134:397–404.[Abstract/Free Full Text]
  36. Kobayashi S, Mizuno T, Tobioka N, et al. Sex steroid receptors in diverse human tumors. Gann 1982;73:439–45.[Medline]
  37. Chaudhuri PK, Walker MJ, Beattie CW, Das Gupta TK. Presence of steroid receptors in human soft tissue sarcomas of diverse histological origin. Cancer Res 1980;40:861–5.[Abstract/Free Full Text]
  38. Chaudhuri PK, Walker MJ, Beattie CW, Das Gupta TK. Distribution of steroid hormone receptors in human soft tissue sarcomas. Surgery 1981;90:149–53.[Medline]
  39. Li XQ, Hisaoka M, Hashimoto H. Expression of estrogen receptors {alpha} and ß in soft tissue sarcomas: immunohistochemical and molecular analysis. Pathol Int 2003;53:671–9.[Medline]
  40. Suda A, Sato T, Watanabe Y, Yamakawa M, Imai Y. Immunohistochemical study of steroid hormones and an estrogen binding assay in malignant soft tissue tumors. Nippon Seikeigeka Gakkai Zasshi 1990;64:814–23.[Medline]
  41. Li CI, Anderson BO, Daling JR, Moe RE. Trends in incidence rates of invasive lobular and ductal breast carcinoma. JAMA 2003;289:1421–4.[Abstract/Free Full Text]
  42. Beckmann MW, Niederacher D, Schnurch HG, Gusterson BA, Bender HG. Multistep carcinogenesis of breast cancer and tumour heterogeneity. J Mol Med 1997;75:429–39.[CrossRef][Medline]
  43. Osborne CK. Steroid hormone receptors in breast cancer management. Breast Cancer Res Treat 1998;51:227–38.[CrossRef][Medline]
  44. Dietel M, Lewis MA, Shapiro S. Hormone replacement therapy: pathobiological aspects of hormone-sensitive cancers in women relevant to epidemiological studies on HRT: a mini-review. Hum Reprod 2005;20:2052–60.[Abstract/Free Full Text]
  45. Chen WY, Hankinson SE, Schnitt SJ, Rosner BA, Holmes MD, Colditz GA. Association of hormone replacement therapy to estrogen and progesterone receptor status in invasive breast carcinoma. Cancer 2004;101:1490–500.[CrossRef][Medline]
  46. Li CI, Malone KE, Porter PL, et al. Relationship between long durations and different regimens of hormone therapy and risk of breast cancer. JAMA 2003;289:3254–63.[Abstract/Free Full Text]
  47. Elledge RM, Green S, Pugh R, et al. Estrogen receptor (ER) and progesterone receptor (PgR), by ligand-binding assay compared with ER, PgR and pS2, by immuno-histochemistry in predicting response to tamoxifen in metastatic breast cancer: a Southwest Oncology Group Study. Int J Cancer 2000;89:111–7.[CrossRef][Medline]



This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
G. S. Atwal, T. Kirchhoff, E. E. Bond, M. Montagna, C. Menin, R. Bertorelle, M. C. Scaini, F. Bartel, A. Bohnke, C. Pempe, et al.
Altered tumor formation and evolutionary selection of genetic variants in the human MDM4 oncogene
PNAS, June 23, 2009; 106(25): 10236 - 10241.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
G. Toffoli, P. Biason, A. Russo, E. De Mattia, E. Cecchin, C. M. Hattinger, M. Pasello, M. Alberghini, C. Ferrari, K. Scotlandi, et al.
Effect of TP53 Arg72Pro and MDM2 SNP309 Polymorphisms on the Risk of High-Grade Osteosarcoma Development and Survival
Clin. Cancer Res., May 15, 2009; 15(10): 3550 - 3556.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
E. F. Firoz, M. Warycha, J. Zakrzewski, D. Pollens, G. Wang, R. Shapiro, R. Berman, A. Pavlick, P. Manga, H. Ostrer, et al.
Association of MDM2 SNP309, Age of Onset, and Gender in Cutaneous Melanoma
Clin. Cancer Res., April 1, 2009; 15(7): 2573 - 2580.
[Abstract] [Full Text] [PDF]


Home page
LupusHome page
K. Onel, D Huo, D Hastings, J Fryer-Biggs, M. Crow, and K Onel
Lack of Association of the TP53 Arg72Pro SNP and the MDM2 SNP309 with systemic lupus erythematosus in Caucasian, African American, and Asian children and adults
Lupus, January 1, 2009; 18(1): 61 - 66.
[Abstract] [PDF]


Home page
Mol Cancer ResHome page
M. Wade and G. M. Wahl
Targeting Mdm2 and Mdmx in Cancer Therapy: Better Living through Medicinal Chemistry?
Mol. Cancer Res., January 1, 2009; 7(1): 1 - 11.
[Abstract] [Full Text] [PDF]


Home page
haematolHome page
D. Wrench, R. Waters, E. Carlotti, S. Iqbal, J. Matthews, M. Calaminici, J. Gribben, T. A. Lister, and J. Fitzgibbon
Clinical relevance of MDM2 SNP 309 and TP53 Arg72Pro in follicular lymphoma
Haematologica, January 1, 2009; 94(1): 148 - 150.
[Full Text] [PDF]


Home page
Mol Cancer ResHome page
H. Taubert, F. Bartel, T. Greither, M. Bache, M. Kappler, T. Kohler, A. Bohnke, C. Lautenschlager, H. Schmidt, H.-J. Holzhausen, et al.
Association of HDM2 Transcript Levels with Age of Onset and Prognosis in Soft Tissue Sarcomas
Mol. Cancer Res., October 1, 2008; 6(10): 1575 - 1581.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S. Lu, K. A. Becker, M. J. Hagen, H. Yan, A. L. Roberts, L. A. Mathews, S. S. Schneider, H. T. Siegelmann, K. J. MacBeth, S. M. Tirrell, et al.
Transcriptional Responses to Estrogen and Progesterone in Mammary Gland Identify Networks Regulating p53 Activity
Endocrinology, October 1, 2008; 149(10): 4809 - 4820.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
N. A. Ellis, D. Huo, O. Yildiz, L. J. Worrillow, M. Banerjee, M. M. Le Beau, R. A. Larson, J. M. Allan, and K. Onel
MDM2 SNP309 and TP53 Arg72Pro interact to alter therapy-related acute myeloid leukemia susceptibility
Blood, August 1, 2008; 112(3): 741 - 749.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
T. S. Jones, S. C. Kaste, W. Liu, C. Cheng, W. Yang, K. G. Tantisira, C.-H. Pui, and M. V. Relling
CRHR1 Polymorphisms Predict Bone Density in Survivors of Acute Lymphoblastic Leukemia
J. Clin. Oncol., June 20, 2008; 26(18): 3031 - 3037.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S. Cattelani, R. Defferrari, S. Marsilio, R. Bussolari, O. Candini, F. Corradini, G. Ferrari-Amorotti, C. Guerzoni, L. Pecorari, C. Menin, et al.
Impact of a Single Nucleotide Polymorphism in the MDM2 Gene on Neuroblastoma Development and Aggressiveness: Results of a Pilot Study on 239 Patients
Clin. Cancer Res., June 1, 2008; 14(11): 3248 - 3253.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
I. Gryshchenko, S. Hofbauer, M. Stoecher, P. T. Daniel, M. Steurer, A. Gaiger, K. Eigenberger, R. Greil, and I. Tinhofer
MDM2 SNP309 Is Associated With Poor Outcome in B-Cell Chronic Lymphocytic Leukemia
J. Clin. Oncol., May 10, 2008; 26(14): 2252 - 2257.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
K. Terry, M. McGrath, I-M. Lee, J. Buring, and I. De Vivo
MDM2 SNP309 Is Associated with Endometrial Cancer Risk
Cancer Epidemiol. Biomarkers Prev., April 1, 2008; 17(4): 983 - 986.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
S. S. Lum, H. W. Chua, H. Li, W.-F. Li, N. Rao, J. Wei, Z. Shao, and K. Sabapathy
MDM2 SNP309 G allele increases risk but the T allele is associated with earlier onset age of sporadic breast cancers in the Chinese population
Carcinogenesis, April 1, 2008; 29(4): 754 - 761.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
F. Bartel, J. Jung, A. Bohnke, E. Gradhand, K. Zeng, C. Thomssen, and S. Hauptmann
Both Germ Line and Somatic Genetics of the p53 Pathway Affect Ovarian Cancer Incidence and Survival
Clin. Cancer Res., January 1, 2008; 14(1): 89 - 96.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
Z. Hu, G. Jin, L. Wang, F. Chen, X. Wang, and H. Shen
MDM2 Promoter Polymorphism SNP309 Contributes to Tumor Susceptibility: Evidence from 21 Case-Control Studies
Cancer Epidemiol. Biomarkers Prev., December 1, 2007; 16(12): 2717 - 2723.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
M. Mrkonjic, S. Raptis, R. C. Green, N. Monga, D. Daftary, E. Dicks, H.B. Younghusband, P. S. Parfrey, S. S. Gallinger, J. R. McLaughlin, et al.
MSH2 118T>C and MSH6 159C>T promoter polymorphisms and the risk of colorectal cancer
Carcinogenesis, December 1, 2007; 28(12): 2575 - 2580.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
S. Wilkening, J. L. Bermejo, and K. Hemminki
MDM2 SNP309 and cancer risk: a combined analysis
Carcinogenesis, November 1, 2007; 28(11): 2262 - 2267.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. K. Schmidt, S. Reincke, A. Broeks, L. M. Braaf, F. B.L. Hogervorst, R. A.E.M. Tollenaar, N. Johnson, O. Fletcher, J. Peto, J. Tommiska, et al.
Do MDM2 SNP309 and TP53 R72P Interact in Breast Cancer Susceptibility? A Large Pooled Series from the Breast Cancer Association Consortium
Cancer Res., October 1, 2007; 67(19): 9584 - 9590.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
D. D. Orsted, S. E. Bojesen, A. Tybjaerg-Hansen, and B. G. Nordestgaard
Tumor suppressor p53 Arg72Pro polymorphism and longevity, cancer survival, and risk of cancer in the general population
J. Exp. Med., June 11, 2007; 204(6): 1295 - 1301.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. Sanchez-Carbayo, N. D. Socci, T. Kirchoff, N. Erill, K. Offit, B. H. Bochner, and C. Cordon-Cardo
A Polymorphism in HDM2 (SNP309) Associates with Early Onset in Superficial Tumors, TP53 Mutations, and Poor Outcome in Invasive Bladder Cancer
Clin. Cancer Res., June 1, 2007; 13(11): 3215 - 3220.
[Abstract] [Full Text] [PDF]


Home page
haematolHome page
E. Hartmann, V. Fernandez, H. Stoecklein, L. Hernandez, E. Campo, and A. Rosenwald
Increased MDM2 expression is associated with inferior survival in mantle cell lymphoma, but not related to the MDM2 SNP309
Haematologica, April 1, 2007; 92(4): 574 - 575.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
W. Hu, Z. Feng, L. Ma, J. Wagner, J. J. Rice, G. Stolovitzky, and A. J. Levine
A Single Nucleotide Polymorphism in the MDM2 Gene Disrupts the Oscillation of p53 and MDM2 Levels in Cells
Cancer Res., March 15, 2007; 67(6): 2757 - 2765.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
G. S. Atwal, G. L. Bond, S. Metsuyanim, M. Papa, E. Friedman, T. Distelman-Menachem, E. Ben Asher, D. Lancet, D. A. Ross, J. Sninsky, et al.
Haplotype structure and selection of the MDM2 oncogene in humans
PNAS, March 13, 2007; 104(11): 4524 - 4529.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
G. L Bond, C. Menin, R. Bertorelle, P. Alhopuro, L. A Aaltonen, and A. J Levine
MDM2 SNP309 accelerates colorectal tumour formation in women
J. Med. Genet., December 1, 2006; 43(12): 950 - 952.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bond, G. L.
Right arrow Articles by Levine, A. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bond, G. L.
Right arrow Articles by Levine, A. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online