Cancer Research SABCS  Jordan
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Toretsky, J. A.
Right arrow Articles by Üren, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Toretsky, J. A.
Right arrow Articles by Üren, A.
[Cancer Research 66, 5574-5581, June 1, 2006]
© 2006 American Association for Cancer Research


Molecular Biology, Pathobiology, and Genetics

Oncoprotein EWS-FLI1 Activity Is Enhanced by RNA Helicase A

Jeffrey A. Toretsky1, Verda Erkizan1, Amy Levenson1, Ogan D. Abaan1, Jeffrey D. Parvin2, Timothy P. Cripe3, Anna M. Rice4, Sean Bong Lee5 and Aykut Üren1

1 Lombardi Comprehensive Cancer Center, Georgetown University Medical Center, Washington, District of Columbia; 2 Department of Pathology, Harvard Medical School, Brigham and Women's Hospital, Boston, Massachusetts; 3 Division of Hematology/Oncology, Cincinnati Children's Hospital Medical Center, Cincinnati, Ohio; 4 Department of Pharmacology, Yale University School of Medicine, New Haven, Connecticut; and 5 Genetics of Development and Disease Branch, National Institute of Diabetes & Digestive & Kidney Diseases, NIH, Bethesda, Maryland

Requests for reprints: Jeffrey A. Toretsky, Lombardi Comprehensive Cancer Center, Georgetown University Medical Center, Research Building, Room W316, 3970 Reservoir Road Northwest, Washington D.C. 20057-1469. Phone: 202-687-8655; Fax: 202-687-1434; E-mail: jat42{at}georgetown.edu.


    Abstract
 Top
 Abstract
 Introduction
 Experimental Procedures
 Results
 Discussion
 References
 
RNA helicase A (RHA), a member of the DEXH box helicase family of proteins, is an integral component of protein complexes that regulate transcription and splicing. The EWS-FLI1 oncoprotein is expressed as a result of the chromosomal translocation t(11;22) that occurs in patients with the Ewing's sarcoma family of tumors (ESFT). Using phage display library screening, we identified an EWS-FLI1 binding peptide containing homology to RHA. ESFT cell lines and patient tumors highly expressed RHA. GST pull-down and ELISA assays showed that EWS-FLI1 specifically bound RHA fragment amino acids 630 to 1020, which contains the peptide region discovered by phage display. Endogenous RHA was identified in a protein complex with EWS-FLI1 in ESFT cell lines. Chromatin immunoprecipitation experiments showed both EWS-FLI1 and RHA bound to EWS-FLI1 target gene promoters. RHA stimulated the transcriptional activity of EWS-FLI1 regulated promoters, including Id2, in ESFT cells. In addition, RHA expression in mouse embryonic fibroblast cells stably transfected with EWS-FLI1 enhanced the anchorage-independent phenotype above that with EWS-FLI1 alone. These results suggest that RHA interacts with EWS-FLI1 as a transcriptional cofactor to enhance its function. (Cancer Res 2006; 66(11): 5574-81)


    Introduction
 Top
 Abstract
 Introduction
 Experimental Procedures
 Results
 Discussion
 References
 
RNA helicase A (RHA, also known as nuclear DNA helicase II) is a member of the DEXH family of RNA helicases and was first identified for its ability to unwind double-stranded RNA and double-stranded DNA (1, 2). RHA is an orthologue of the Drosophila melanogaster gene, maleless (mle), demonstrating conservation over evolution (1). RHA is required for proper differentiation of the embryonic ectoderm in mice (3). RHA was originally purified from nuclear complexes while searching for helicases as participants in splicing (4, 5). In addition, RHA modulates transcription through interactions with CBP/p300 and RNA polymerase II (6). RHA expression occurs in both nonmalignant brain, gonadal, and lymphoid tissues as well as multiple neoplasms (7).

There are no published reports of RHA enhancing oncogenesis, however, there is limited knowledge of the role of RNA helicases in transformation (8, 9). RNA helicases expressed from DDX6 and DDX10 have been directly implicated in oncogenesis as components of translocations or inversions, respectively (8, 10). DDX10 was identified in a reciprocal translocation in patients with myelodysplastic syndrome and acute myeloid leukemia (10, 11). DDX6 encodes the RNA helicase, rck/p54, which is expressed at higher levels in tumors than in normal tissues (8). Most recently, DDX5 (p68 RNA helicase) was found to be phosphorylated on tyrosine residues in transformed but not in nontransformed cell lines (12). None of these RNA helicases are known to directly interact with an oncogene to enhance transformation.

Ewing's sarcoma family of tumors (ESFT) are highly malignant tumors of bone and soft tissue that have a 50% mortality (13, 14). More than 95% of patients with ESFT have the balanced translocation t(11;22)(q24;q12) or a related rearrangement. The t(11;22)(q24;q12) combines the amino-terminal of EWS from chromosome 22 to the carboxyl-terminal of FLI1 to form the oncogenic EWS-FLI1 (15, 16). Despite its oncogenic activity, often measured by anchorage-independent growth, and a growing list of transcriptional targets, EWS-FLI1-induced transformation is not fully understood (17). EWS-FLI1 also regulates gene expression by modulating RNA splicing as shown by alteration of an E1A splice site and interaction with U1C (18, 19). Clear differences exist between wild-type FLI1 and EWS protein-protein interactions compared with EWS-FLI1 based on binding to components of the transcriptome (20, 21). In addition, differences exist in splice site selection between EWS and EWS-FLI1 (19). Knowing the proteins that interact with EWS-FLI1 in unique three-dimensional conformations when compared with the full-length wild-type proteins may be helpful in understanding the mechanisms of EWS-FLI1-modulated transformation.

We investigated RHA as a protein partner of EWS-FLI1 based on its homology to peptides from an unbiased screening of an M13 phage library. RHA was investigated as an EWS-FLI1 protein partner because of its function in transcription and posttranscriptional mRNA splicing. Our data suggest that EWS-FLI1 directly binds to RHA at a unique location on the RHA protein distinct from the binding sites of basal transcriptional proteins. Functional studies of EWS-FLI1 and RHA were done because RHA modulates both transcription and splicing. These functional studies showed enhanced EWS-FLI1-modulated transcription and anchorage-independent growth in the presence of overexpressed RHA. Our findings therefore suggest that RHA is a cooperative protein in EWS-FLI1-modulated transformation.


    Experimental Procedures
 Top
 Abstract
 Introduction
 Experimental Procedures
 Results
 Discussion
 References
 
Antibodies, peptides, tissue microarrays, and cDNA constructs. Full-length RHA antibody was a generous gift from Dr. Chee-Gun Lee (Department of Biochemistry, UMDNJ, Newark, NJ). Rabbit polyclonal antibody against EWS was generated by immunizing rabbits with purified GST-EWS fusion protein (residues 68-171). The antibody specific for RHA amino acids 1 to 250 have been described previously (22, 23). The antibody for Fli1 was purchased from Santa Cruz Biotechnologies (Santa Cruz, CA) and the ß-tubulin antibody was purchased from MP Biomedicals, Inc. (Aurora, OH). RHA mutagenesis was done using high-pressure liquid chromatography–purified oligodeoxynucleotides with the Quick-Change Mutagenesis (Stratagene, La Jolla, CA) and this mutant was bidirectionally sequenced.

Tissue microarrays have been previously verified for ESFT and were also previously reported (24). pBabe, HEK293, and BOSC cells were a generous gift from Dr. Robert Fenton (University of Maryland, Baltimore, MD). Id2 promoter was kindly provided by Dr. Takashi Tokino (Department of Molecular Biology, Sapporo Medical University, Sapporo, Japan). A mutated ets binding sequence containing three point mutations, termed Mut14, exhibited reduced binding by ets-2 and PU.1 ets factors, yet bound Fli-1 with high affinity (25). The plasmid pM5ETL, containing five tandem repeats of Mut14, was generated by inserting a KpnI-SmaI fragment into pETL containing the TATA box from the adenovirus E1B gene into pGL3-Basic (Promega, Madison, WI). 5'-Phosphorylated oligonucleotides containing Mut14 sequences were annealed to create KpnI-compatible ends and inserted into pETL. Oligonucleotides were ligated directly upstream of the TATA box at the KpnI site. Clones were verified by sequence analysis. The oligonucleotides used included Mut14/5-top, 5'-TGAAACCGGAACTGGGTTGAAACCGGAACTGGGTTGAAACCGGAACTGGGTTGAAACCGGAACTGGG TTGAAACCGGAACTGGGTGTAC-3'; mut14/5-bottom, 5'-ACCCAGTTCCGGTTTCAACCCAGTTCCGGTTTCAACCCAGTTCCGGTTTCAACCCAGTTCCGGTTTCAACCCAGTTCCGGTTTCACATG-3'.

Screening of the phage display peptide library. An M13 library consisting of ~2 x 109 recombinant clones, each expressing a random 12–amino acid residue peptide linked to the gene III coat protein, was purchased from New England Biolabs (Beverly, MA) and screened by three rounds of binding to recombinant EWS-FLI1 (1 µg) immobilized on the surface of a well from a 96-well microtiter plate (Costar, Cambridge, MA) as previously described (26). After the third round of affinity selection, phages were plated out on a lawn of Escherichia coli DH5{alpha}F' (Invitrogen Life Technologies, Grand Island, NY) to yield individual plaques. The binding of individual phage clones to EWS-FLI1 was assessed by ELISA using an anti-M13 phage monoclonal antibody-horseradish peroxidase conjugate (Pharmacia, Piscataway, NJ). The inserts of ~100 phages, which showed at least 2-fold stronger binding to EWS-FLI1 than bovine serum albumin (BSA), were amplified and sequenced.

We did BLAST searches (http://www.ncbi.nlm.nih.gov/) for proteins with "short, nearly exact matches" using the following variables: organism, Homo sapiens; expected value, 10,000; word size, 2; matrix, Pam30; gap cost existence, 9; and extension, 1. Immunohistochemistry (24) and chromatin immunoprecipitation (ChIP; ref. 27) were done as previously reported. Primers for transforming growth factor (TGF)-ß type II receptor (TGFßRII) and hEAT have been reported (28).

Immunoprecipitation was done with protein lysates from cells growing in log-phase as previously described (29). Protein concentration was determined using bicinchoninic acid protein assay for each lysate according to the manufacturer's instructions (Pierce, Rockford, IL) and lysate was bound to 1 µg of antibody overnight at 4°C on a rotating axis. Protein G agarose beads (Invitrogen, Carlsbad, CA) were added to the lysates and incubated for 1 hour at 4°C on a rotating axis. Immunoprecipitated proteins were resolved using 8% PAGE. Proteins were transferred to a polyvinylidene difluoride transfer membrane (Millipore, Bedford, MA) using a transfer apparatus. Membranes were blotted and detected with antibodies as previously described (24). Blots were stripped with Restore Western blot stripping buffer (Pierce) at 70°C, reblocked, and then probed with various antibodies as described above.

GST-binding experiments. GST-tagged RHA fragments were prepared and GST pull-down experiments were done as described previously (6). Briefly, bacteria lysates containing comparable amounts of GST-RHA fragments were prepared in 950 µL of binding buffer [20 mmol/L Tris Acetate (pH 7.9), 120 mmol/L potassium acetate, 1 mmol/L EDTA, and 10% glycerol]. Samples were mixed with 50 µL of gluthathione-agarose beads and incubated on a rotating plate at 4°C for 1 hour. Gluthathione-agarose beads without protein lysate were used as a control. Beads were then washed thrice with 1 mL of washing buffer [20 mmol/L Tris acetate (pH 7.9), 750 mmol/L potassium acetate, 1 mmol/L EDTA, and 10% glycerol] and once with binding buffer. After the final wash, beads were resuspended in 1 mL of binding buffer and 1 mg of total ESFT cell lysate. Samples were incubated at 4°C overnight on a rotating plate. Beads were washed thrice with binding buffer. Then the final pellet was resuspended in 50 µL 2x sample buffer and analyzed by Western blotting using a Fli-1 antibody. Membranes were stripped and reblotted with GST antibody to confirm equal loading.

ELISA experiments were done as described by coating a 96-well plate with recombinant EWS-FLI1 or BSA (100 ng/w; ref. 30). Nonspecific binding sites were blocked with 200 µL of blocking reagent (Pierce) for 1 hour at room temperature. Wells were washed five times with TAPS (PBS containing 0.05% Tween 20 and 0.02% NaN3). GST-RHA proteins were added as 150 µL of total bacterial lysates. Plates were incubated for 2 hours at room temperature and washed five times. GST-RHA fragments bound to EWS-FLI1 or BSA were detected by a GST antibody (Santa Cruz Biotechnologies) and an alkaline phosphatase–conjugated anti-mouse antibody (Sigma, St. Louis, MO).

Functional assays. EWS-FLI1-modulated transcription was measured in TC71 and TC32 cells that were electroporated with pM5ETL, pID2-166, pRHA, and Rous sarcoma virus (RSV)-ß-galactosidase plasmids. Electroporated cells were plated into collagen-treated 12-well plates with RPMI 1640 + 10% fetal bovine serum, and were incubated overnight in humidified 5% CO2 atmosphere at 37°C. Cells were lysed with a lysis buffer (Promega) and assayed for luciferase and ß-galactosidase activity. Luciferase readings were divided by the ß-galactosidase readings to standardize for transfection efficiencies. Protein lysates were resolved by SDS-PAGE and analyzed by Western blotting.

Preparation of stable expression clones. EWS-FLI1 type 1 was cloned into pBABE-puro and retroviruses were made in the packaging cell line BOSC. Mouse embryonic fibroblasts (W cells) were infected with the virus to obtain stably expressing EWS-FLI1 cells (WEF1). WEF1 and W cells were electroporated with 20 µg of His-tag RHA plasmid and selected with Geneticin G418 (Invitrogen). Soft agar assays were done as previously described (29).


    Results
 Top
 Abstract
 Introduction
 Experimental Procedures
 Results
 Discussion
 References
 
Phage library screening identified peptides that bind to recombinant EWS-FLI1. The molecular mechanisms of EWS-FLI1 oncogenesis are poorly understood. We hypothesized that protein-protein interactions between EWS-FLI1 and other members of the transcriptome may regulate oncogenic functions. Toward this aim, we sought novel proteins that directly interact and functionally modulate EWS-FLI1. Recombinant EWS-FLI1 (31) was used as a target for screening a commercial peptide display phage library, which express 12 amino acid–long peptides on M13 phage with 2 x 109 complexity. Twenty-eight novel peptides that differentially bind to EWS-FLI1 were identified from phage sequencing. We then searched the database for human homologous proteins to these peptides using the National Center for Biotechnology Information web page. Peptide E9, with sequence, YTPPPLIEAFAT, showed significant homology to human RHA (GenBank accession number A47363) at the amino acid 822 to 831 region.

RHA expressed in ESFT cell lines and patient tumors. After identifying RHA as a potential protein partner of EWS-FLI1, we evaluated a series of ESFT cell lines and patient tumors for evidence of RHA protein expression. Antibodies were optimized and titrated on paraffin-embedded tissue using a TC32 xenograft from a nude mouse which shows the nuclear staining of RHA (Fig. 1A ), whereas the control stained with control rabbit preimmune antiserum shows no background (Fig. 1B). A tissue microarray of ESFT was evaluated by RHA immunohistochemistry (example of positive staining, Fig. 1C). RHA was found in 21 of 21 primary and 19 of 19 metastatic tumors on the array (small part of array shown, Fig. 1D). Seven of seven ESFT cell lines expressed RHA protein compared with mouse embryo fibroblasts (Fig. 1E). Because RHA is expressed in ESFT, we proceeded to determine where RHA binds to EWS-FLI1.


Figure 1
View larger version (46K):
[in this window]
[in a new window]
 
Figure 1. RHA is expressed in both ESFT cell lines and patient tumors. An ESFT mouse xenograft (TC32) was stained with either anti-RHA (A) or control antiserum (B). A tissue array with validated ESFT tumor specimens was stained with anti-RHA, with a representative example of positive nuclear staining (original magnification, x400; C); a small section of the stained array (original magnification, x40; D). Seven different ESFT cell lines were probed with the same anti-RHA following PAGE and showed a single 150 kDa band, consistent with the expected molecular weight of RHA (E).

 
EWS-FLI1 binds to RHA at a unique location. Human GST-tagged RHA fragments, amino acids 1 to 88, 1 to 250, 230 to 325, 326 to 650, 630 to 1020, and 1000 to 1279 (22), were tested for binding to endogenous EWS-FLI1 from ESFT cell lysate. RHA has previously been shown to complex with transcriptional regulators at amino acids 1 to 88, 1 to 250, 230 to 325, and 326 to 650 (6, 22, 32). Fragment GST-RHA 630 to 1020 coprecipitated with endogenous EWS-FLI1 in an ESFT cell lysate (Fig. 2A ). Although fragment 1000 to 1279 also seemed to bind to EWS-FLI1, this fragment actually showed multiple bands suggesting nonspecific binding (Fig. 2A). Therefore, in order to identify the specificity of binding, we used GST-RHA protein fragments and recombinant EWS-FLI1. Binding was analyzed in an ELISA assay normalized by comparing GST-RHA protein fragment binding to EWS-FLI1 or BSA (Fig. 2B). Our results showed that EWS-FLI1 bound to GST-RHA 630 to 1020 14-fold greater than it bound to BSA, whereas all other fragments showed binding close to that of the background GST alone. GST-RHA 630 to 1020 contains homology (amino acids 822-831) to the E9 peptide sequence (Fig. 2C). These ELISA results were supportive of the phage display discovery because the regions of binding were similar and led to further analysis of RHA binding to EWS-FLI1.


Figure 2
View larger version (20K):
[in this window]
[in a new window]
 
Figure 2. RHA identified as a binding partner of EWS-FLI1. GST-RHA protein fragments were prepared from bacteria and used to identify the portion of RHA that binds to EWS-FLI1. Total ESFT cell lysate was used as a source of EWS-FLI1 for immunoprecipitation using GST-RHA fragments (A). PAGE-separated samples were transferred to a membrane that was probed with the FLI1 antibody. First lane, total ESFT cell lysate (TC32). An ELISA assay measured the relative binding of GST-RHA fragments 1 to 88, 1 to 25 to, 250 to 325, 326 to 650, 630 to 1020, and 1000 to 1279 to recombinant EWS-FLI1 compared with BSA (B). Last lane, control GST with ELISA values normalized to 1.0 based on GST binding to EWS-FLI1 compared with albumin. Alignment of RHA protein sequence (amino acids 822-831) to E9 peptide that was discovered by phage display library screening (C). Identical amino acids are indicated with vertical lines between the sequences.

 
Endogenous RHA complexes with EWS-FLI1 in ESFT cells. Our results show GST-RHA binding to recombinant EWS-FLI1; therefore, we wanted to determine whether EWS-FLI1 and RHA exist in a protein complex in ESFT. Total protein from log phase cell lysates were immunoprecipitated with anti-FLI1 or anti-EWS antibodies; immune complexes were resolved using PAGE and immunoblotted for FLI1 or RHA. EWS antibodies precipitated a complex that contained RHA from both ESFT cell lines (Fig. 3A, lanes 2 and 6, top ), but not the HEK293 cells (Fig. 3B). The presence of EWS-FLI1 was confirmed in both ESFT cell lines (Fig. 3A, bottom), is not expressed in HEK293 (Fig. 3B). EWS-FLI1 expressed in STA-ET-7.2 is a slightly larger molecular species, as expected, because this cell line contains the type 2 translocation fusing exon 7 of EWS to exon 5 of FLI1, whereas TC71 contains the type 1 fusion which lacks FLI1 exon 5 (33). Preimmune control serum showed a faint background band near the molecular weight of RHA, however, the antibody immunoprecipitated signal was always stronger than background (Fig. 3A, lanes 1 and 5). The EWS antibody immunoprecipitates RHA along with EWS-FLI1 from STA-ET-7.2, which lacks wild-type EWS (33), indicating that the RHA is in a complex with EWS-FLI1. In the HEK293 cells, RHA is not present in the EWS antibody immunoprecipitate (Fig. 3B, lane 2). The EWS-FLI1/RHA complex was further supported by coimmunoprecipitation of RHA with an antibody directed toward the FLI1 epitope of EWS-FLI1 (Fig. 3A, lanes 3 and 7, top). Analysis of total protein lysate showed the expression of RHA in all three cell lines (Fig. 3A, lanes 4 and 8; and Fig. 3B, lane 4), whereas EWS-FLI1 was expressed in only ESFT cell lines (Fig. 3A, bottom). Due to the relatively large amount of RHA in cells, only 20 µg of total protein was loaded in the total protein lanes to avoid an overwhelming RHA signal, but this was too little to detect EWS-FLI1 in total protein. A third ESFT cell line, TC32, also showed RHA in anti-EWS and anti-FLI1 immunoprecipitates (data not shown). Input total protein lysate was equalized by protein assay as well as confirmatory ß-tubulin immunoblotting (data not shown). RHA immunoprecipitating with germ line FLI1 is unlikely in ESFT because these cells lack FLI1 expression. FLI1 immunoprecipitation followed by FLI1 immunoblot as well as total protein immunoblotted for FLI1 did not show protein at 55 kDa, the expected size of FLI1 as shown in MOLT-4 lysate control (Fig. 3C and D, respectively).


Figure 3
View larger version (26K):
[in this window]
[in a new window]
 
Figure 3. RHA occurs in a complex with EWS-FLI1 in ESFT cells and could directly bind to recombinant EWS-FLI1. Immunocomplexes were isolated from ESFT cell lines (A, STA-ET-7.2 and TC71) and non–EWS-FLI1 cell line (B, HEK293) from total protein lysate using antibodies to EWS (lanes 2 and 6), FLI1 (lanes 3 and 7), and EWS preimmune serum (lanes 1 and 5). Total protein levels (lanes 4 and 8). Top, RHA was identified in those complexes isolated by immunoprecipitation with antibodies to EWS and FLI1 only in STA-ET-7.2 and TC71 (A, top), but not in HEK293 cells (B, top). EWS-FLI1 was identified both from immunoprecipitation (A, bottom). FLI1 immunoprecipitations from two ESFT cell lines show only rearranged EWS-FLI1 but not a 55 kDa FLI1 protein band (C). Total protein immunoblotted with anti-FLI1 show only EWS-FLI1 in ESFT cell lines, whereas MOLT-4 cells (T cell leukemia), show the wild-type FLI1 protein (D). Standard 96-well ELISA plates were coated with 500 ng of recombinant EWS-FLI1 or BSA. Wells were incubated with 250 ng of RHA and bound RHA was detected with a polyclonal anti-RHA antibody. RHA bound specifically to recombinant EWS-FLI1-coated wells. When the experiment was done in the reciprocal order, RHA immobilized to surface, recombinant EWS-FLI1 bound specifically to RHA (E). Wells were coated with 500 ng EWS-FLI1 ({blacksquare}) or BSA (bullet), whereas increasing concentrations of RHA (0.0133-13.3 nmol/L) was incubated in wells and detected by anti-RHA antibody (F).

 
ELISA assay further corroborated the direct binding of recombinant EWS-FLI1 to RHA (Fig. 3E). RHA protein specifically bound recombinant EWS-FLI1 compared with BSA in a dose-dependent manner (Fig. 3F). These studies identify a protein complex that includes RHA and EWS-FLI1 in ESFT and confirm the ability of RHA to directly bind to EWS-FLI1. To further support EWS-FLI1 and RHA occurring in a complex, we directly examined promoter sequences regulated by EWS-FLI1.

EWS-FLI1 and RHA are both bound to the EWS-FLI1-modulated promoters. Our recent work identified the protein tyrosine phosphatase L1 (PTPL1) as a direct transcriptional target of EWS-FLI1 (27), whereas previous investigators identified TGFßRII as a direct target (28, 34). Because RHA was found in a complex with EWS-FLI1, we used a ChIP assay to determine whether RHA is also present on the PTPL1 and TGFßRII promoters (Fig. 4 ). Whereas in log-phase growth, two ESFT cell lines (TC71 and TC32) were treated with a cross-linking reagent to covalently link proteins that were bound to DNA at the time of treatment. Antibodies to either RHA or FLI1 were used to immunoprecipitate the respective proteins. The washed precipitates were amplified with PCR using primers to the PTPL1, TGFßRII, or hEAT promoter regions. Amplified PCR products from ChIP, with both EWS-FLI1 and RHA, showed that both proteins could occupy the PTPL1 and TGFßRII promoters (Fig. 4, top and middle). hEAT was identified as a promoter that does not directly bind EWS-FLI1 (28), and our results confirm that neither EWS-FLI1 nor RHA bind to the hEAT promoter (Fig. 4, bottom). Control immunoprecipitation with nonreactive antibody did not show promoter DNA. These ChIP results suggest that RHA is present on promoters that are regulated by EWS-FLI1. To evaluate the functional significance of this complex formation, we measured EWS-FLI1-activated transcription and anchorage-independent colony formation.


Figure 4
View larger version (18K):
[in this window]
[in a new window]
 
Figure 4. RHA and EWS-FLI1 immunoprecipitated from both PTPL1 and TGFßRII promoters. Log-phase Ewing's sarcoma cells (both TC32 and TC71) were cross-linked with 1% formaldehyde and sonicated. To precipitate EWS-FLI1 and RHA, anti-FLI1 and anti-RHA antibodies were used. RHA preimmune sera was used as control for the immunoprecipitation. Input represents the starting cross-linked chromatin before immunoprecipitation. A region of each of the promoters was amplified by specific PCR primers that span EWS-FLI1 binding sites for PTPL1 (top), TGFßRII (middle), and hEAT (bottom). (–) control lacks DNA and (+) control contains HEK293 genomic DNA.

 
RHA enhances EWS-FLI1-modulated transcription. To identify a functional interaction between EWS-FLI1 and RHA, transcriptional activation assays were done. EWS-FLI1 binds to GGAA containing DNA sequences and activates transcription. These studies used two different promoter sequences fused to a luciferase reporter gene as a measurement of transcriptional activation. The Id2 promoter has been well-characterized as an EWS-FLI1-responsive transcriptional target (28, 35). The pM5ETL vector was produced with a pentamer of the GGAA core in order to evaluate EWS-FLI1 activity. The ESFT cell line, TC32, was cotransfected with a cytomegalovirus promoter full-length RHA expression vector, the promoter-luciferase construct, and a RSV-ß-galactosidase plasmid to equalize transfection efficiency. Protein lysates were evaluated for luciferase activity 24 hours after transfection using standard luminometer techniques. Results are standardized for ß-galactosidase expression and normalized to the control lacking RHA plasmids. Plasmid DNA was equilibrated across experiments using empty vector pCI.neo so that all experiments were done with equal amounts of transfected DNA. A dose-dependent increase in pM5ETL promoter-activated luciferase expression was seen with increasing amounts of RHA transfected into ESFT cells (Fig. 5A ). This increase corresponded with increased RHA expression by immunoblotting (shown below the graph without a change in EWS-FLI1 levels). A second reporter construct, pId2-166, showed similar results to that of pM5ETL and showed a dose-dependent increase in transcriptional activity with increasing RHA levels (Fig. 5B). In the presence of increasing RHA, two different EWS-FLI1 reporter activities increased. These results suggest that RHA interacts with EWS-FLI1 and enhances its transcriptional activity. Increasing RHA concentration did not affect transcription from the non–EWS-FLI1-responsive RSV-long terminal repeat promoter (Fig. 5C).


Figure 5
View larger version (21K):
[in this window]
[in a new window]
 
Figure 5. RHA enhances promoter activation of EWS-FLI1 targets. ESFT TC32 cells were transfected by electroporation with increasing amounts of FLAG-RHA expression vector (and decreasing amounts of empty vector with a constant total of 20 µg) along with a constant amount of either pM5ETL or pId2 reporter vector. Luciferase activity was standardized to ß-galactosidase expressed from a RSV-long terminal repeat vector. Two experiments were done with each reporter construct and relative luciferase activity was standardized to 1.0 for cells transfected with only empty vector (A, pM5ETL and B, pID2). Protein lysate from representative experiments of transfected cells were resolved with PAGE and immunoblotted for either FLAG (RHA; top) or EWS-FLI1 (bottom). RSV activity based on ß-galactosidase expression in all four experiments is standardized to 1.0 based on absence of RHA plasmid (C), protein expression for representative experiments in (A) and (B).

 
EWS-FLI1-induced anchorage-independent growth was further enhanced by RHA. EWS-FLI1 function includes the activation or suppression of many gene targets, as well as modulation of splicing. Because EWS-FLI1-initiated oncogenesis likely results from many related events, the transformation of fibroblasts was measured to assess overall EWS-FLI1 function. Mouse embryonic fibroblasts (W cells) or those with stable expression of EWS-FLI1 (WEF1 cells) were transfected with an RHA expressing plasmid or empty vector control and selected with G418 for 2 weeks. Equal numbers of trypan blue, excluding surviving cells, were assayed for soft agar colony formation. W cells transfected with empty vector control plasmid had virtually no growth in soft agar assays (Fig. 6A ), whereas the expression of EWS-FLI1 (WEF cells, also transfected here with pCI.neo control plasmid) induced colony formation (Fig. 6B). The expression of RHA did not increase colony formation of W cells in the absence of EWS-FLI1 (Fig. 6C). However, when RHA was expressed in WEF cells, there was an increase in colony formation (Fig. 6D). Three independent transfections of W and WEF cells, with RHA or empty vector control, were done followed by soft agar colony assays in which a 33% increase in colony formation was reproducibly seen (Fig. 6E). Representative protein levels show low but detectable levels of RHA protein in W and WEF1 cells; however, RHA protein levels are significantly increased in the RHA-transfected cells (Fig. 6F, top). The expression of EWS-FLI1 did not increase RHA levels (Fig. 6F, top) nor did RHA expression alter EWS-FLI1 levels (Fig. 6F, middle). All lanes showed equal protein loading and similar ß-tubulin levels (Fig. 6F, bottom).


Figure 6
View larger version (23K):
[in this window]
[in a new window]
 
Figure 6. RHA increases soft agar colony formation in EWS-FLI1-expressing fibroblasts. Mouse embryonic fibroblasts (W cells) and those stably expressing EWS-FLI1 (WEF1 cells) were transfected with either pcDNA3-RHA or empty vector (e.v.). Transfected cells were selected for 14 days in G418 and then transferred to soft agar for assay of colony formation. W + e.v. cells (A), WEF1 + e.v. cells (B), W + RHA (C), and WEF1 + RHA (D). E, columns, mean of three independent experiments with triplicate wells; bars, SE. F, representative total protein immunoblots for RHA (top), EWS-FLI1 (middle), and ß-tubulin (bottom).

 
RHA NTPase activity is necessary for the enhancement of EWS-FLI1 function. RHA functions as a NTPase-dependent helicase. Mutations in the NTP binding domain render RHA nonfunctional (6). We mutated RHA using PCR mutagenesis to ablate NTPase function by causing a point mutation at nucleotide 1330 that results in amino acid substitution K417R. This RHA-K417R was transfected into WEF cells, whereas control cells were transfected with an empty vector. Following G418 selection, these derived polyclonal cells were placed in soft agar. The RHA-K417R-transfected WEF cells grew 75% fewer colonies than the empty vector control, suggesting a dominant-negative function (Fig. 7A ). Colony counts of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide–stained colonies, following 14 days of incubation, showed 22 ± 2 colonies/six-well plate for empty vector–transfected cells, whereas RHA-K417R grew only 5 ± 3 colonies/six-well plate for triplicate experiments (Fig. 7B). Protein expression for the derived cell lines is shown for both the empty vector and RHA-K417R-transfected cells (Fig. 7C). These data support the hypothesis that RHA function enhances EWS-FLI1-mediated soft agar colony growth.


Figure 7
View larger version (23K):
[in this window]
[in a new window]
 
Figure 7. RHA NTP binding mutant functions as dominant-negative to wild-type RHA. WEF1 cells were transfected either with RHA K417R, wild-type cDNA, or empty vector. A, the number of mutant K417R-transfected WEF soft agar colonies were reduced compared with WEF alone. B, columns, mean cell counts for triplicate studies; bars, SD. C, transfected flag-tagged RHA protein was immunoprecipitated with FLAG antibody (left), whereas total RHA levels are increased in the K417R compared with empty vector–transfected cells (right).

 

    Discussion
 Top
 Abstract
 Introduction
 Experimental Procedures
 Results
 Discussion
 References
 
Aberrant transcription is a central abnormality in cancer cells. RNA helicases modulate the synthesis, metabolism, and transport of mRNA, and a role for RNA helicases in malignancy is emerging. Our data show that RHA is present in a complex with EWS-FLI1 and modulates EWS-FLI1 transcription and anchorage-independent cell growth. Thus, RHA could be a functional partner for EWS-FLI1 transcriptional activation and modulation of splice site selection.

Our data shows EWS-FLI1 binding to a region of RHA at the distal portion of the helicase domain that has not previously been shown to interact with any other protein, in particular, those proteins of basal transcription. We do not suggest that RHA only interacts with EWS-FLI1, as that would require demonstrating that RHA is not interacting with any other proteins in ESFT cells, including the untranslocated EWS. However, based on the absence of EWS in the HEK293 cell RHA complex, it is possible that RHA recognizes a unique protein domain that occurs as a result of the fusion of EWS to FLI1 in ESFT. Further studies are necessary to more precisely evaluate the structural interaction of EWS-FLI1 with RHA. Yet, we conclude that RHA augments EWS-FLI1 function and that this functional augmentation enhances the oncogenic activity of EWS-FLI1. In addition, RHA function seems to be necessary to enhance EWS-FLI1 transformation.

The EWS-FLI1 transcriptional complex is slowly being identified through a series of protein interaction studies. Besides RHA, other proteins identified to bind to EWS-FLI1 include hsRPB7 coimmunoprecipitated from Ewing's sarcoma cell lines that seem to link EWS-FLI1 to the core transcriptional apparatus (21). We chose to search for EWS-FLI1 binding partners to better characterize its function. The phage display peptide identified RHA as a potential binding partner of EWS-FLI1. Although the sequence alignment to RHA is only 60% based on the full 12 amino acid peptide sequence, the binding is supported by the finding that the peptide sequence (homologous to RHA amino acids 822-831) is contained in the GST-RHA protein (amino acids 630-1020) that most tightly bound to EWS-FLI1. This binding was consistent with both the recombinant EWS-FLI1 and ESFT cell lysate. The immunoprecipitation studies support the conclusion that RHA and EWS-FLI1 occur in a complex. This conclusion is supported by immunoprecipitation studies done in an ESFT cell line that lacks EWS (STA-ET-7.2). In HEK293 cells, RHA does not seem to complex with EWS, however, we cannot exclude the possibility that RHA binds to wild-type EWS in ESFT. EWS-FLI1 and EWS both share some protein partners, like BARD1 (36), but uniquely bind others, such as YB1 (37). Further functional and biochemical analyses might reveal that RHA may function differently in the complexes with EWS versus EWS-FLI1, thus leading to transformation in the presence of EWS-FLI1.

RHA likely augments the transcriptional activities of EWS-FLI1, because EWS-FLI1 is a well-described transcriptional activator and retains the conserved Ets DNA binding domain from FLI1 in the fusion protein (15, 38). DEAD box helicases have been identified as transcriptional coactivators of both growth-promoting and tumor-suppressor proteins. The p68 RNA helicase acts as a transcriptional coactivator of p53, where small interfering RNA reduction of p68 led to a decrease in p53 transcript and protein levels (39). The RNA helicase RHII/Gu was found as a cofactor of c-Jun and its subnuclear localization is modulated by c-Jun-NH2-kinase phosphorylation (40). RHA is also shuttled between nuclear compartments based on the physiologic status of the cell (41), and this localization could play a role in the functional activities with EWS-FLI1.

EWS-FLI1 complexes containing proteins responsible for RNA splicing and RHA was purified based on the evaluation of helicases as participants in splicing (4, 5). For example, U1C, a member of the U1 small nuclear ribonucleoprotein–specific protein family, was isolated using the yeast two-hybrid system with the EWS domain of EWS/FLI1 as bait (18). Functionally, EWS-FLI1 inhibits RNA splicing in an in vivo E1A splicing assay (19, 37). RHA could link EWS-FLI1 to the spliceosome. Because RHA is a member of the DEXH family, it has the potential for these multiple functions. This association between EWS-FLI1 and RHA might lead to a better understanding of how splicing contributes to the development of ESFT.

Our data support fully functional RHA enhancing EWS-FLI1 function. Many reports that eliminate EWS-FLI1 by antisense describe a lethal effect on ESFT cells (42, 43). Further evaluation is needed to conclude whether RHA is critical for EWS-FLI1 oncogenic function. A small molecule or peptide that is capable of disrupting EWS-FLI1 and RHA could elucidate the role of RHA and EWS-FLI1 interaction without eliminating RHA from cells. On a wider scope, many difficult to treat sarcomas have translocations involving EWS including desmoplastic small round cell tumor, clear cell sarcoma, myxoid liposarcoma, and chondrosarcoma (44). This work could serve as a model for these other diseases in that RHA or a related helicase could be responsible, or at least supportive, of the mechanism of chromosomal translocation and subsequent cellular transformation.


    Acknowledgments
 
Grant support: The Children's Cancer Foundation, Baltimore, MD, NIH CA88004 (J.A. Toretsky), and GM53504 (J.D. Parvin). This investigation was conducted in part in a facility constructed with support from the Research Facilities Improvement grant C06 RR14567 from the National Center for Research Resources, NIH and supported by the National Cancer Institute Cancer Center Support Grant to the Lombardi Comprehensive Cancer Center.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Drs. Chee-Gun Lee for antibodies, RHA cDNA, and advice; Robert Fenton provided cell lines and viral vectors as well as training in their use; STA-ET-7.2 cells were kindly provided by Dr. Heinrich Kovar; tissue multi-array of ESFT was generously provided by Dr. Marc Ladanyi; recombinant RHA was provided by Frank Grosse and Suisheng Zhang, recombinant EWS-FLI1 was prepared by Linshan Yuan in our laboratory; and Howard Ungar and Jonathan Epstein for informatics assistance.

Received 9/13/05. Revised 3/23/06. Accepted 4/ 3/06.


    References
 Top
 Abstract
 Introduction
 Experimental Procedures
 Results
 Discussion
 References
 

  1. Lee CG, Hurwitz J. Human RNA helicase A is homologous to the maleless protein of Drosophila. J Biol Chem 1993;268:16822–30.[Abstract/Free Full Text]
  2. Zhang S, Maacke H, Grosse F. Molecular cloning of the gene encoding nuclear DNA helicase II. A bovine homologue of human RNA helicase A and Drosophila Mle protein. J Biol Chem 1995;270:16422–7.[Abstract/Free Full Text]
  3. Lee CG, da Costa Soares V, Newberger C, Manova K, Lacy E, Hurwitz J. RNA helicase A is essential for normal gastrulation. Proc Natl Acad Sci U S A 1998;95:13709–13.[Abstract/Free Full Text]
  4. Furneaux HM, Perkins KK, Freyer GA, Arenas J, Hurwitz J. Isolation and characterization of two fractions from HeLa cells required for mRNA splicing in vitro. Proc Natl Acad Sci U S A 1985;82:4351–5.[Abstract/Free Full Text]
  5. Pruzan R, Furneaux H, Lassota P, Hong GY, Hurwitz J. Assemblage of the prespliceosome complex with separated fractions isolated from HeLa cells. J Biol Chem 1990;265:2804–13.[Abstract/Free Full Text]
  6. Nakajima T, Uchida C, Anderson SF, et al. RNA helicase A mediates association of CBP with RNA polymerase II. Cell 1997;90:1107–12.[CrossRef][Medline]
  7. Su AI, Cooke MP, Ching KA, et al. Large-scale analysis of the human and mouse transcriptomes. Proc Natl Acad Sci U S A 2002;99:4465–70.[Abstract/Free Full Text]
  8. Akao Y, Marukawa O, Morikawa H, et al. The rck/p54 candidate proto-oncogene product is a 54-kilodalton D-E-A-D box protein differentially expressed in human and mouse tissues. Cancer Res 1995;55:3444–9.[Abstract/Free Full Text]
  9. Poppe B, Vandesompele J, Schoch C, et al. Expression analyses identify MLL as a prominent target of 11q23 amplification and support an etiologic role for MLL gain of function in myeloid malignancies. Blood 2004;103:229–35.[Abstract/Free Full Text]
  10. Ikeda T, Ikeda K, Sasaki K, Kawakami K, Takahara J. The inv(11)(p15q22) chromosome translocation of therapy-related myelodysplasia with NUP98-DDX10 and DDX10-NUP98 fusion transcripts. Int J Hematol 1999;69:160–4.[Medline]
  11. Nakao K, Nishino M, Takeuchi K, et al. Fusion of the nucleoporin gene, NUP98, and the putative RNA helicase gene, DDX10, by inversion 11 (p15q22) chromosome translocation in a patient with etoposide-related myelodysplastic syndrome. Intern Med 2000;39:412–5.[Medline]
  12. Yang L, Lin C, Liu ZR. Phosphorylations of DEAD box p68 RNA helicase are associated with cancer development and cell proliferation. Mol Cancer Res 2005;3:355–63.[Abstract/Free Full Text]
  13. Grier HE, Krailo MD, Tarbell NJ, et al. Addition of ifosfamide and etoposide to standard chemotherapy for Ewing's sarcoma and primitive neuroectodermal tumor of bone. N Engl J Med 2003;348:694–701.[Abstract/Free Full Text]
  14. Meyers PA, Krailo MD, Ladanyi M, et al. High-dose melphalan, etoposide, total-body irradiation, and autologous stem-cell reconstitution as consolidation therapy for high-risk Ewing's sarcoma does not improve prognosis. J Clin Oncol 2001;19:2812–20.[Abstract/Free Full Text]
  15. Delattre O, Zucman J, Plougastel B, et al. Gene fusion with an ETS DNA-binding domain caused by chromosome translocation in human tumours. Nature 1992;359:162–5.[CrossRef][Medline]
  16. May WA, Denny CT. Biology of EWS/FLI and related fusion genes in Ewing's sarcoma and primitive neuroectodermal tumor. Curr Top Microbiol Immunol 1997;220:143–50.[Medline]
  17. Arvand A, Denny CT. Biology of EWS/ETS fusions in Ewing's family tumors. Oncogene 2001;20:5747–54.[CrossRef][Medline]
  18. Knoop LL, Baker SJ. The splicing factor U1C represses EWS/FLI-mediated transactivation. J Biol Chem 2000;275:24865–71.[Abstract/Free Full Text]
  19. Knoop LL, Baker SJ. EWS/FLI alters 5'-splice site selection. J Biol Chem 2001;276:22317–22.[Abstract/Free Full Text]
  20. Bertolotti A, Melot T, Acker J, Vigneron M, Delattre O, Tora L. EWS, but not EWS-FLI-1, is associated with both TFIID and RNA polymerase II: interactions between two members of the TET family, EWS and hTAFII68, and subunits of TFIID and RNA polymerase II complexes. Mol Cell Biol 1998;18:1489–97.[Abstract/Free Full Text]
  21. Petermann R, Mossier BM, Aryee DN, Khazak V, Golemis EA, Kovar H. Oncogenic EWS-Fli1 interacts with hsRPB7, a subunit of human RNA polymerase II. Oncogene 1998;17:603–10.[CrossRef][Medline]
  22. Anderson SF, Schlegel BP, Nakajima T, Wolpin ES, Parvin JD. BRCA1 protein is linked to the RNA polymerase II holoenzyme complex via RNA helicase A. Nat Genet 1998;19:254–6.[CrossRef][Medline]
  23. Schlegel BP, Starita LM, Parvin JD. Overexpression of a protein fragment of RNA helicase A causes inhibition of endogenous BRCA1 function and defects in ploidy and cytokinesis in mammary epithelial cells. Oncogene 2003;22:983–91.[CrossRef][Medline]
  24. Uren A, Merchant MS, Sun CJ, et al. Beta-platelet-derived growth factor receptor mediates motility and growth of Ewing's sarcoma cells. Oncogene 2003;22:2334–42.[CrossRef][Medline]
  25. Klemsz MJ, Maki RA, Papayannopoulou T, Moore J, Hromas R. Characterization of the ets oncogene family member, fli-1. J Biol Chem 1993;268:5769–73.[Abstract/Free Full Text]
  26. Kay BK, Kasanov J, Yamabhai M. Screening phage-displayed combinatorial peptide libraries. Methods 2001;24:240–6.[CrossRef][Medline]
  27. Abaan OD, Levenson A, Khan O, Furth PA, Uren A, Toretsky JA. PTPL1 is a direct transcriptional target of EWS-FLI1 and modulates Ewing's sarcoma tumorigenesis. Oncogene 2005;24:2715–22.[CrossRef][Medline]
  28. Fukuma M, Okita H, Hata J, Umezawa A. Upregulation of Id2, an oncogenic helix-loop-helix protein, is mediated by the chimeric EWS/ets protein in Ewing sarcoma. Oncogene 2003;22:1–9.[CrossRef][Medline]
  29. Toretsky JA, Kalebic T, Blakesley V, LeRoith D, Helman LJ. The insulin-like growth factor-I receptor is required for EWS/FLI-1 transformation of fibroblasts. J Biol Chem 1997;272:30822–7.[Abstract/Free Full Text]
  30. Uren A, Reichsman F, Anest V, et al. Secreted frizzled-related protein-1 binds directly to Wingless and is a biphasic modulator of Wnt signaling. J Biol Chem 2000;275:4374–82.[Abstract/Free Full Text]
  31. Uren A, Tcherkasskaya O, Toretsky JA. Recombinant EWS-FLI1 oncoprotein activates transcription. Biochemistry 2004;43:13579–89.[Medline]
  32. Tetsuka T, Uranishi H, Sanda T, et al. RNA helicase A interacts with nuclear factor {kappa}B p65 and functions as a transcriptional coactivator. Eur J Biochem 2004;271:3741–51.[Medline]
  33. Kovar H, Jug G, Hattinger C, et al. The EWS protein is dispensable for Ewing tumor growth. Cancer Res 2001;61:5992–7.[Abstract/Free Full Text]
  34. Hahm KB, Cho K, Lee C, et al. Repression of the gene encoding the TGF-ß type II receptor is a major target of the EWS-FLI1 oncoprotein. Nat Genet 1999;23:222–7.[CrossRef][Medline]
  35. Nishimori H, Sasaki Y, Yoshida K, et al. The Id2 gene is a novel target of transcriptional activation by EWS-ETS fusion proteins in Ewing family tumors. Oncogene 2002;21:8302–9.[CrossRef][Medline]
  36. Spahn L, Petermann R, Siligan C, Schmid JA, Aryee DN, Kovar H. Interaction of the EWS NH2 terminus with BARD1 links the Ewing's sarcoma gene to a common tumor suppressor pathway. Cancer Res 2002;62:4583–7.[Abstract/Free Full Text]
  37. Chansky HA, Hu M, Hickstein DD, Yang L. Oncogenic TLS/ERG and EWS/Fli-1 fusion proteins inhibit RNA splicing mediated by YB-1 protein. Cancer Res 2001;61:3586–90.[Abstract/Free Full Text]
  38. Karim FD, Urness LD, Thummel CS, et al. The ETS-domain: a new DNA-binding motif that recognizes a purine-rich core DNA sequence. Genes Dev 1990;4:1451–3.[Free Full Text]
  39. Bates GJ, Nicol SM, Wilson BJ, et al. The DEAD box protein p68: a novel transcriptional coactivator of the p53 tumour suppressor. EMBO J 2005;24:543–53.[CrossRef][Medline]
  40. Westermarck J, Weiss C, Saffrich R, et al. The DEXD/H-box RNA helicase RHII/Gu is a co-factor for c-Jun-activated transcription. EMBO J 2002;21:451–60.[CrossRef][Medline]
  41. Fuchsova B, Hozak P. The localization of nuclear DNA helicase II in different nuclear compartments is linked to transcription. Exp Cell Res 2002;279:260–70.[Medline]
  42. Tanaka K, Iwakuma T, Harimaya K, Sato H, Iwamoto Y. EWS-Fli1 antisense oligodeoxynucleotide inhibits proliferation of human Ewing's sarcoma and primitive neuroectodermal tumor cells. J Clin Invest 1997;99:239–47.[Medline]
  43. Toretsky JA, Connell Y, Neckers L, Bhat NK. Inhibition of EWS-FLI-1 fusion protein with antisense oligodeoxynucleotides. J Neurooncol 1997;31:9–16.[CrossRef][Medline]
  44. Borden EC, Baker LH, Bell RS, et al. Soft tissue sarcomas of adults: state of the translational science. Clin Cancer Res 2003;9:1941–56.[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Toretsky, J. A.
Right arrow Articles by Üren, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Toretsky, J. A.
Right arrow Articles by Üren, A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online