Cancer Research Prevention Award  Advances in Breast Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Qi, H.
Right arrow Articles by Ratnam, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Qi, H.
Right arrow Articles by Ratnam, M.
[Cancer Research 66, 5875-5882, June 1, 2006]
© 2006 American Association for Cancer Research


Experimental Therapeutics, Molecular Targets, and Chemical Biology

Synergistic Induction of Folate Receptor ß by All-Trans Retinoic Acid and Histone Deacetylase Inhibitors in Acute Myelogenous Leukemia Cells: Mechanism and Utility in Enhancing Selective Growth Inhibition by Antifolates

Huiling Qi and Manohar Ratnam

Department of Biochemistry and Cancer Biology, Medical University of Ohio, Toledo, Ohio

Requests for reprints: Manohar Ratnam, Department of Biochemistry and Cancer Biology, Medical University of Ohio, 3035 Arlington Avenue, Toledo, OH 43614. Phone: 419-383-3862; E-mail: mratnam{at}meduohio.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The folate receptor (FR) type ß is a promising target for therapeutic intervention in acute myelogenous leukemia (AML), owing particularly to its selective up-regulation in the leukemic cells by all-trans retinoic acid (ATRA). Here we show, using KG-1 and MV4-11 AML cells and recombinant 293 cells, that the histone deacetylase (HDAC) inhibitors trichostatin A (TSA), valproic acid (VPA), and FK228 potentiated ATRA induction of FR-ß gene transcription and FR-ß mRNA/protein expression. ATRA and/or TSA did not induce de novo FR synthesis in any of a variety of FR-negative cell lines tested. TSA did not alter the effect of ATRA on the expression of retinoic acid receptor (RAR) {alpha}, ß, or {gamma}. Chromatin immunoprecipitation assays indicate that HDAC inhibitors act on the FR-ß gene by enhancing RAR-associated histone acetylation to increase the association of Sp1 with the basal FR-ß promoter. Under these conditions, the expression level of Sp1 is unaltered. A decreased availability of putative repressor AP-1 proteins may also indirectly contribute to the effect of HDAC inhibitors. Finally, FR-ß selectively mediated growth inhibition by (6S) dideazatetrahydrofolate in a manner that was greatly potentiated in AML cells by ATRA and HDAC inhibition. Therefore, the combination of ATRA and innocuous HDAC inhibitors may be expected to facilitate selective FR-ß–targeted therapies in AML. (Cancer Res 2006; 66(11): 5875-82)


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Acute myelogenous leukemia (AML) is the most common form of leukemia in adults but <20% of AML patients will have long-term survival (1). Relapsed disease is frequently refractory to chemotherapy (2). In acute promyelocytic leukemia (FAB-M3 classification), which accounts for 10% of AMLs, complete remission can be achieved in 72% to 95% of the patients by differentiation therapy using all-trans retinoic acid (ATRA; refs. 3, 4). However, this is followed by a significant incidence of relapse, at which time the patients are often refractory to ATRA therapy due to mutations that block retinoid-induced differentiation (4). Other AML subtypes, which constitute 90% of AMLs, do not differentiate in response to ATRA (4). Our previous studies have shown that in primary AML cells and in the KG-1 AML cell line, ATRA induces up-regulation of the ß isoform of the folate receptor (FR) in a manner that is independent of cell differentiation and have supported the view that ATRA induction of FR-ß could potentially be used in developing novel FR-ß-targeted therapies for the majority of AML (58).

The two major human membrane FR isoforms, {alpha} and ß, are glycosyl phosphatidylinositol–anchored proteins that can bind and internalize folic acid and its {gamma}-carboxyl conjugates and antifolates (911). The two proteins exhibit distinct and narrow tissue specificities (12). In normal tissues, the expression of FR-{alpha} is largely restricted to luminal surfaces of certain epithelial tissues where it is inaccessible through the circulation in contrast to the receptor expressed in solid tumors (12). A broad variety of FR-targeted experimental therapies that include novel immunologic therapies, in addition to tumor-selective delivery of various folate conjugates, folate-coated nanoparticle carriers, and antifolate drugs, have focused on the {alpha} isoform of the receptor (1319) and FR-{alpha} has thus served as a paradigm for targeted drug delivery. Among normal tissues, FR-ß is only found in placenta (20) and in hematopoietic cells, specifically in the myelomonocytic lineage (21). FR-ß expression increases during neutrophil maturation (21) and macrophage activation (22). FR-ß is expressed in ~70% of AMLs and is observed consistently in M3, M4, M5, and M6 AMLs and less frequently in M1 and M2 AMLs (5, 21). Frequent coexpression of FR-ß with CD34 is also observed in AML (5), suggesting the expression of the receptor in the proliferating population of the AML cells. Several observations that further support the potential of FR-ß to serve as a target for selective drug delivery in AML include the absence of FR-ß in normal hematopoietic progenitor cells, the nonfunctionality of FR-ß in normal hematopoietic cells other than activated macrophage (5, 22, 23) in contrast to its functionality in AML cells (5), and the ability of primary FR-ß-positive human AML cells to engraft in bone marrow (6).

The expression levels for FR-ß among the receptor-positive AML specimens from patients vary over a range of ~2 orders of magnitude (5). The value of up-regulating FR-ß expression in AML cells to obtain more effective drug targeting is borne out by the observation that folate-conjugated liposomal doxorubicin was selectively growth inhibitory to the FR-ß+ KG-1 AML cells in vitro and the growth inhibition was increased by ATRA in a FR-dependent manner (5). Further, in a severe combined immunodeficient mouse ascites tumor model, the survival benefit of treatment with folate-conjugated liposomal doxorubicin was strikingly increased by coadministering ATRA (5).

The FR-ß gene lacks a functional retinoic acid response element and ATRA enhances FR-ß gene transcription by a nonclassic mechanism through its TATA-less and Sp1-driven promoter (8). It has previously been proposed that ATRA functions in this context by (i) inducing the association of its nuclear receptor retinoic acid receptor (RAR)-{alpha} with the FR-ß core promoter to function as a coactivator, (ii) inducing the dissociation of RARß/{gamma} that may act as corepressors, and (iii) decreasing the availability of unidentified putative repressor proteins that associate with activator protein 1 (AP-1) elements (8). Here, we report that ATRA-induced up-regulation of FR-ß may be greatly potentiated by relatively innocuous inhibitors of histone deacetylase (HDAC) and investigate the molecular mechanism underlying this synergy. We further show that FR-ß mediates cell growth inhibition by the antifolate dideazatetrahydrofolate (DDATHF) and that FR-ß up-regulation by the combination of ATRA and HDAC inhibitor will sensitize AML cells to this drug.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell culture and reagents. Recombinant 293 cells were generated by stably integrating a FR-ß gene promoter-luciferase reporter construct (7). Chinese hamster ovary cells (CHO) that stably expressed human FR-ß (CHO-FRß) were generated by stable integration and amplification of a human FR-ß cDNA expression construct in CHO-K1 cells (24). Cells were cultured at 37°C in 5% CO2. The cell culture media were supplemented with 100 units/mL penicillin, 100 µg/mL streptomycin, and 292 µg/mL L-glutamine (Invitrogen, Carlsbad, CA). KG-1 cells were grown in RPMI 1640 with 20% fetal bovine serum (FBS) and MV4-11 cells were grown in RPMI 1640 with 10% FBS. MV4-11A cells were grown in folate-free RPMI 1640 with 10% FBS and 10 nmol/L N5-formyl tetrahydrofolate for the cell growth inhibition assay. 293 cells were grown in Eagle's MEM with 10% FBS (Invitrogen); CHO-K1 and CHO-FRß cells were grown in folate-free RPMI 1640 with 10% FBS, 0.15 mg/mL L-proline, and 10 nmol/L N5-formyl tetrahydrofolate. ATRA, trichostatin A (TSA), valproic acid (VPA), and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) were purchased from Sigma-Aldrich (St. Louis, MO). FK228 was a kind gift from Dr. Kenneth K. Chan (College of Pharmacy, Ohio State University, Columbus, OH). 6S-DDATHF was a kind gift from Dr. J. Shih (Eli Lilly & Co., Indianapolis, IN). [3H]Folic acid was purchased from Moravek Biochemicals (Brea, CA). ATRA stock solution (5 mmol/L) was made in a mixture of 50% ethanol and 50% DMSO. TSA stock solution was prepared by dissolving in DMSO at a concentration of 1 mg/mL. VPA stock solution (2 mol/L) was made in PBS (137 mmol/L NaCl, 2.7 mmol/L KCl, 4.3 mmol/L Na2HPO4, 1.4 mmol/L KH2PO4, pH 7.3). FK228 stock solution (2 mg/mL) was made in 40% propylene glycol/10% ethanol/50% normal saline. MTT stock solution was prepared by dissolving in PBS at a concentration of 5 mg/mL. Stock solution of 6S-DDATHF was prepared in PBS and the concentration of the stock solution was spectrophotometrically determined using the {varepsilon}max value of 117,000 (mol/L)–1 cm–1 (at 272 nm) in 0.1 N NaOH. All stock solutions were stored in aliquots at –80°C. Antibodies against RAR{alpha} [rabbit polyclonal immunoglobulin G (IgG)], RARß (rabbit polyclonal IgG), RAR{gamma} (rabbit polyclonal IgG), and Sp1 (rabbit polyclonal IgG) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Antibodies against acetylated histones H3 (rabbit polyclonal IgG) and H4 (rabbit anti-serum) were purchased from Upstate Cell Signalling Solutions (Lake Placid, NY). Antibody against tubulin (mouse monoclonal IgG; 1:6:000 dilution) was purchased from Sigma-Aldrich.

Preparation of cell lysates and luciferase assay. 293 cells containing a stably integrated full-length FR-ß promoter-luciferase reporter construct were grown to 20% to 30% confluence and treated with vehicle, ATRA, TSA, VPA, and FK228 singly or in combination. On day 5, the cells were harvested in the reporter lysis buffer provided with the luciferase assay system (Promega, Madison, WI) and centrifuged at 14,000 x g for 2 minutes at room temperature. The supernatant was assayed for luciferase activity and the values were normalized to protein concentration.

Treatment of cells and preparation of nuclear extracts. KG-1 cells growing in log phase were seeded into 150-mm tissue culture plates at a density of 2.5 x 105/mL in 20 mL of medium. After a 6-hour preculture, cells were treated with vehicle, ATRA (1 µmol/L), TSA (50 ng/mL), or both for 5 days. Then the cells were harvested by centrifugation at 400 x g for 10 minutes and washed twice with PBS at 4°C. The cell pellets were snap frozen in dry ice/ethanol and stored at –80°C for 30 minutes. Nuclear extracts were prepared as described (25). The nuclear extracts were desalted using G-25 Sephadex columns (Roche Diagnostics, Indianapolis, IN) following the protocol of the supplier. The protein concentrations in the extracts were determined by the Bradford assay (Bio-Rad, Hercules, CA).

Preparation of crude plasma membranes. Crude plasma membranes were prepared as described (26). Essentially, the cell pellets were washed with PBS and then allowed to swell in lysis buffer [1 mmol/L NaHCO3, 2 mmol/L CaCl2, 5 mmol/L MgCl2, 1 mmol/L phenylmethylsulfonyl fluoride (PMSF)] for 30 minutes at 4°C and then homogenized by 50 strokes of a glass Dounce homogenizer. The homogenate was centrifuged to sediment the nuclei and residual cells. The resulting supernatant was centrifuged for 45 minutes at 40,000 x g to sediment the membranes. The resulting membrane preparation was resuspended in PBS.

Western blot analysis. Cell membrane preparations were used in Western blots to detect FR-ß. KG-1 cell nuclear extracts were used in Western blots to detect RAR{alpha}, RARß, or RAR{gamma} (the antibodies were all used at 1:200 dilution). Whole-cell lysates in 400 mmol/L NaCl/100 mmol/L/Tris (pH 8.0)/1 mmol/L EDTA/1 mmol/L EGTA/0.0075% ß-mercaptoethanol/0.1% Triton X-100/proteinase inhibitor cocktail were used to detect Sp1 (the antibody was used at 1:200 dilution). Samples were mixed with an equal volume of 2x SDS-PAGE loading buffer [62.5 mmol/L Tris-HCl (pH 6.8), 10% glycerol, 2% SDS, 5% 2-mercaptoethanol, and 0.00125% bromophenol blue]. The samples were resolved on 12% (for FR-ß, RAR{alpha}, RARß, or RAR{gamma}) or 6% (for Sp1) SDS-PAGE gels and electrophoretically transferred to nitrocellulose filters. The blots were probed with corresponding rabbit anti-human antibodies followed by goat anti-rabbit immunoglobulin G (IgG) conjugated with horseradish peroxidase. The bands were visualized by enhanced chemiluminescence.

Purification of total RNA and real-time reverse transcription-PCR analysis. Total RNA from KG-1 cells treated with vehicle, ATRA, TSA, or both were extracted using RNeasy Mini Kit purchased from Qiagen (Chatsworth, CA) following the protocol of the manufacturer. Real-time reverse transcription-PCR (RT-PCR) was used to measure endogenous mRNAs for FR-ß as well as glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in the same samples. The reverse transcription step was carried out using TaqMan Reverse Transcript Reagents from Applied Biosystems (Foster City, CA) following the protocol of the manufacturer. Essentially, 400 ng of total RNA were mixed with random hexamer primers (50 µmol/L), RNase inhibitor (1 unit/µL), MultiScribe reverse transcriptase (5 units/µL), and deoxynucleoside triphosphates mix (2.5 mmol/L each) in reverse transcriptase buffer. The 10-µL reaction mixture was first incubated at 25°C for 10 minutes, then at 48°C for 30 minutes, and finally at 95°C for 5 minutes. The subsequent real-time PCR step for FR-ß was carried out in the presence of 12.5 µL of PCR Mastermix (Applied Biosystems), 0.5 µL each of forward primer (CTGGCTCCTTGGCTGAGTTC) and reverse primer (GCCCAGCCTGGTTATCCA), and 0.5 µL of the TaqMan probe (6FAM-TCCTCCCAGACTACCTGCCCTCAGC-TAMERA). The primers and the TaqMan probe for the control GAPDH gene were purchased from Applied Biosystems. The PCR conditions were 2 minutes at 50°C, then 10 minutes at 95°C, followed by 40 cycles of 15 seconds each at 95°C, and finally 1 minute at 60°C. Fluorescence data generated were monitored and recorded by the Gene Amp 5700 sequence detection system (Applied Biosystems). All samples were set up in triplicate and normalized to GAPDH values.

Chromatin immunoprecipitation. This protocol was adapted from our previous report (8) with the following modifications: the protein-DNA complex was eluted from the protein A-sepharose–coated beads with 250 µL of 1% SDS, 100 mmol/L NaHCO3 by rotating at room temperature for 20 minutes. The beads were sedimented at 16,000 x g for 30 seconds, the supernatant transferred to another tube, and the process repeated. Then 20 µL of 5 mol/L NaCl were added to the 500-µL eluted protein-DNA complex and incubated at 65°C for 6 hours. The DNA was purified using the QIAquick gel extracton kit (Qiagen). The precipitated DNA was quantified by real-time PCR using forward primer (AATGCAAGCAGGAATGACTAAATG), reverse primer (TCCTCTCTTCCTTCCCTTCCA), and a TaqMan probe (6FAM-ACAGACTCAGGGAGCCTTGAAGAGGGTG-TAMERA). Samples were set up in triplicate. A portion of the DNA recovered from an aliquot of sheared chromatin was used as the "input" sample. Normal rabbit IgG or serum was used as a negative control.

Electrophoretic mobility shift assay. KG-1 nuclear extracts were incubated with 1 µg of poly(deoxyinosinic-deoxycytidylic acid) at 4°C for 15 minutes in binding buffer [12 mmol/L HEPES (pH 7.9), 60 mmol/L KCl, 4 mmol/L MgCl, 1 mmol/L EDTA, 12% glycerol, 1 mmol/L DTT, and 0.5 mmol/L PMSF]. Then 30,000 cpm of the 32P-labeled double-stranded synthetic oligonucleotide probe were added and the reaction mixture was incubated at 4°C for 20 minutes. The reaction mixtures were electrophoresed on 6% polyacrylamide gels at 175 V for 2 hours; the gel was dried for 30 minutes and then subjected to autoradiography.

MTT growth inhibition assay. In vitro sensitivity of cells to 6S-DDATHF was determined by plating 3 x 103 CHO-FRß cells, 7 x 103 CHO-K1 cells, or 0.3 x 105 MV4-11A cells treated with vehicle, 1 µmol/L ATRA, 50 ng/mL TSA, or both for 3 days in 100 µL growth medium containing serial dilutions of the drug in 96-well microplates. Each concentration of the drug was repeated in three wells. After incubation for 3 days (CHO-FRß and CHO-K1 cells) or 4 days (MV4-11 cells) at 37°C with 5% CO2, cell viability was determined using the MTT assay based on a previously reported method (27). Briefly, 10 µL of MTT (5 mg/mL) were added to each well and incubated for 4 hours at 37°C. The medium and MTT were removed from the wells after sedimenting the cells and the formazan crystals were dissolved in 100 µL of DMSO. The absorance was recorded in a VERSAmax tunable microplate reader (Molecular Devices, Sunnyvale, CA) at a wavelength of 570 nm. The absorance (A) directly correlates with cell number and the percentage of cell survival was calculated as follows: (Atreated / Auntreated) x 100. The data were plotted as drug concentration (log scale) versus percentage of cell survival.

[3H]Folic acid binding assay. Cells were washed with cold PBS twice. The cells were then incubated with 1 mL PBS containing 16.5 pmol of [3H]folic acid (30 Ci/mmol) at 4°C for 1 hour. After the incubation, the cells were washed twice with cold PBS. Acid buffer [10 mmol/L sodium acetate (pH 3.5) containing 0.5 mL of 150 mmol/L NaCl] was used to extract bound [3H]folic acid and the radioactivity was measured by liquid scintillation counting. Nonspecific binding of [3H]folic acid was measured in identical assays in which 330 pmol of unlabeled folic acid were incorporated before the addition of [3H]folic acid.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Effect of TSA on ATRA induction of FR-ß promoter activity and FR-ß gene expression. Because a major mechanism by which nuclear receptor ligands activate genes is by inducing their receptors to recruit proteins that modulate histone acetylation, it was undertaken to test whether known inhibitors of histone deacetylation may promote the positive regulation of the FR-ß gene by ATRA. Accordingly, the effect of TSA, which is a well-characterized inhibitor of class I and II HDACs, was first tested.

In Fig. 1A , 293 cells stably transfected with an FR-ß promoter-luciferase reporter construct were treated with ATRA at a concentration (1 µmol/L) previously determined to produce optimal activation of the promoter. Under these conditions, treatment of the cells with TSA resulted in a dose-dependent increase in the ATRA activation of the promoter (Fig. 1A). TSA by itself produced only a relatively small increase in the promoter activity (Fig. 1A). At the higher (nontoxic) concentrations of TSA (50-100 ng/mL), the ATRA-induced activation of the FR-ß promoter was further amplified by a factor of 10. In Fig. 1B, the same cells were treated with a fixed (50 ng/mL) concentration of TSA and a range of ATRA concentrations. Here, TSA increased ATRA activation of the promoter even at suboptimal concentrations of ATRA. These results show a strong synergy between ATRA and TSA in the activation of the FR-ß promoter.


Figure 1
View larger version (15K):
[in this window]
[in a new window]
 
Figure 1. Effect of TSA on the induction of FR-ß by ATRA. A, 293 cells stably transfected with an FR-ß promoter-luciferase construct were treated with 1 µmol/L ATRA and different concentrations of TSA for 5 days. The reporter luciferase activity was then measured in the cell lysates. B, the same cells were treated with different concentrations of ATRA and 50 ng/mL TSA for 5 days. The reporter luciferase activity was then measured in the cell lysates. C, KG-1 AML cells were treated with 1 µmol/L ATRA and different concentrations of TSA for 5 days. Total mRNA was then extracted and the FR-ß mRNA was quantified by real-time RT-PCR. D, KG-1 AML cells were treated with 1 µmol/L ATRA and different concentrations of TSA for 5 days. Cell membrane preparations were made and then subjected to Western blot analysis to detect endogenous FR-ß protein expression. Uniformity of sample loading in the blot was confirmed by Coomassie blue staining.

 
Next, KG-1 AML cells were treated with a concentration of ATRA (1 µmol/L), previously known to produce the optimal increase in the expression of the endogenous FR-ß and with different concentrations of TSA. In the presence of ATRA, a TSA dose-dependent increase was observed in both the FR-ß mRNA (measured by real-time RT-PCR; Fig. 1C) and the FR-ß protein, detected by Western blot (Fig. 1D). The results show a strong potentiation of the ATRA induction of FR-ß mRNA and FR-ß protein by TSA in AML cells.

Effect of VPA and depsipeptide on FR-ß promoter activity and endogenous FR-ß expression. VPA and depsipeptide (FK228) are drugs that are in clinical use and are known HDAC inhibitors. In Fig. 2A and B , 293 cells stably transfected with an FR-ß promoter-luciferase reporter construct were treated with ATRA at a concentration (1 µmol/L) previously determined to produce optimal activation of the promoter. Under these conditions, treatment of the cells with VPA (Fig. 2A) or FK228 (Fig. 2B) in pharmacologic concentration ranges resulted in a dose-dependent increase in the ATRA activation of the promoter. At each concentration, VPA or FK228 alone produced a relatively modest increase in the promoter activity (Fig. 2A and B). In Fig. 2C and D, KG-1 AML cells were treated with a fixed (1 µmol/L) concentration of ATRA and different concentrations of VPA (Fig. 2C) or FK228 (Fig. 2D). For both VPA and FK228, a dose-dependent increase was observed in ATRA up-regulation of the endogenous FR-ß. These results show that the synergistic effect of TSA on ATRA activation of the FR-ß promoter can be extended to other HDAC inhibitors (i.e., VPA and FK228).


Figure 2
View larger version (19K):
[in this window]
[in a new window]
 
Figure 2. Effect of VPA, FK228, or TSA on FR-ß induction by ATRA. 293 cells stably transfected with an FR-ß promoter-luciferase construct were treated with 1 µmol/L ATRA, different concentrations of VPA (A), or different concentrations of FK228 (B) for 5 days and the reporter luciferase activity was measured in the cell lysates. KG-1 AML cells (C and D) or MV4-11 AML cells (E and F) were treated with 1 µmol/L ATRA and different concentrations of VPA (C and F), FK228 (D), or TSA (E) for 5 days. Plasma membranes were then prepared and the FR-ß protein was visualized by Western blot. Uniformity of sample loading in the blots was confirmed by Coomassie blue staining.

 
Specificity of the ATRA/HDAC inhibitor effects for FR-ß–positive AML cells. Among the available human AML cell lines, KG-1 and MV4-11 cells are positive for FR-ß. In contrast, other myeloid cell lines, including NB4, HL60, KCL22, K562, and the KG-1a variant, were FR negative. In MV4-11 cells, ATRA (1 µmol/L) substantially increased FR-ß expression as observed by Western blot (Fig. 2E and F), and similar to KG-1 cells, TSA (Fig. 2E) or VPA (Fig. 2F) up-regulated FR-ß in a dose-dependent and ATRA-dependent manner. In contrast, ATRA and TSA, either individually or in combination, failed to turn on FR expression in NB4, HL60, KCL22, K562, and KG-1a cells or a wide variety of other FR-negative cell types (293, Caki1, L1210, SVG, and MG63; data not shown). They also did not up-regulate either FR-ß or FR-{alpha} in FR-{alpha}+ cell lines (e.g., SKOV3, JAR, and HeLa; data not shown). These results suggest that ATRA and/or HDAC inhibitors will not alter the tissue distribution of FRs by inducing de novo FR synthesis in FR-negative cells.

Effect of TSA on the expression of RAR subtypes. To investigate the effect of HDAC inhibition on various aspects of ATRA action on the FR-ß gene, we first tested the influence of TSA on the expression levels of RAR subtypes {alpha}, ß, and {gamma}. As seen from the Western blot of nuclear extracts obtained from KG-1 cells, TSA treatment, either in the presence or in the absence of ATRA, did not appreciably alter the expression of RAR{alpha}, ß, or {gamma} (Fig. 3 ).


Figure 3
View larger version (11K):
[in this window]
[in a new window]
 
Figure 3. Effect of TSA on the expression of RAR subtypes. Nuclear extracts were made from KG-1 cells treated with 1 µmol/L ATRA and/or 50 ng/mL TSA for 5 days and subjected to Western blot. In each lane, 15 µg protein (for RAR{alpha}) or 30 µg protein (for RARß/{gamma}) was loaded. Uniformity of sample loading in the blots was confirmed by Coomassie blue staining.

 
Effect of TSA on the association of RARs and Sp1 with the FR-ß promoter in situ. We have previously reported by chromatin immunoprecipitation that ATRA causes an increase in the association of RAR{alpha} and a decrease in the association of RARs ß and {gamma} with the basal promoter in the endogenous FR-ß gene. The influence of HDAC inhibition on these aspects of ATRA action was tested in KG-1 cells using the chromatin immunoprecipitation assay. In this and in other chromatin immunoprecipitation assays used in this study, the signal was measured by real-time PCR. As expected, ATRA increased the association of RAR{alpha} with the FR-ß promoter but TSA did not appreciably alter this ATRA-induced association (Fig. 4A ). TSA also appreciably increased ATRA-induced dissociation of RAR{gamma} from the promoter (Fig. 4C) but did not affect the release of RARß (Fig. 4B).


Figure 4
View larger version (19K):
[in this window]
[in a new window]
 
Figure 4. Effect of ATRA and/or TSA on the associations of RARs and Sp1 with the FR-ß promoter and on the expression of Sp1. KG-1 cells were treated with 1 µmol/L ATRA and/or 50 ng/mL TSA for 24 hours and subjected to chromatin immunoprecipitation (ChIP) assay. The precipitated DNA fragment was measured by real-time PCR using primers flanking the Sp1 element. A, effect of ATRA and/or TSA on the association of RAR{alpha} with the FR-ß promoter. B, effect of ATRA and/or TSA on the association of RARß with the FR-ß promoter. C, effect of ATRA and/or TSA on the association of RAR{gamma} with the FR-ß promoter. D, effect of ATRA and/or TSA on the association of Sp1 with the FR-ß promoter. E, KG-1 cells were treated with 1 µmol/L ATRA and/or 50 ng/mL TSA for 24 hours and the whole-cell lysate was subjected to Western blot to detect Sp1. The same blot was then stripped and reprobed for tubulin. Fifty-microgram protein was loaded in each lane.

 
Because the association of Sp1 with the TATA-less FR-ß promoter is a key requirement in maintaining its basal activity, it was undertaken to use the chromatin immunoprecipitation assay to test the effect of TSA on the association of Sp1 with the promoter. As shown in Fig. 4D, ATRA increased the association of Sp1 with the promoter and TSA caused a further striking increase in this association. However, TSA by itself did not increase the association of Sp1 with the FR-ß promoter (Fig. 4D). It may be noted here that in our previous report, we had not observed the increased association of Sp1 with the FR-ß promoter on treatment with ATRA; this discrepancy may be attributed to the fact that in that study, the chromatin immunoprecipitation assays were not quantitative and the relatively small increase in Sp1 association caused by ATRA treatment alone would have gone unnoticed. The results in Fig. 4D clearly show that whereas ATRA increases the association of Sp1 with the FR-ß promoter, TSA greatly increases this association, but in an ATRA-dependent manner. The TSA-induced increase in the ATRA-dependent association of Sp1 with the FR-ß promoter region was not accompanied by a change in the expression level of Sp1 (Fig. 4E).

Effect of TSA on histone acetylation in the FR-ß promoter region. To test a possible basis for the ATRA-dependent increase in Sp1 binding induced by TSA, the effect of these reagents on the level of histone acetylation in the FR-ß basal promoter region was examined by the chromatin immunoprecipitation assay. TSA increased the acetylation of both histones H3 and H4 in this region of the FR-ß promoter and the effect was the greatest when the cells were treated with both ATRA and TSA (Fig. 5A and B ).


Figure 5
View larger version (9K):
[in this window]
[in a new window]
 
Figure 5. Effect of ATRA and/or TSA on the associations of acetylated histones H3 and H4 with the FR-ß promoter. KG-1 cells were treated with 1 µmol/L ATRA and/or 50 ng/mL TSA for 24 hours and subjected to chromatin immunoprecipitation assay. The precipitated DNA fragment was measured by real-time PCR using primers flanking the Sp1 element. A, effect of ATRA and/or TSA on the association of acetylated histone H3 with the FR-ß promoter. B, effect of ATRA and/or TSA on the association of acetylated histone H4 with the FR-ß promoter.

 
Effect of TSA on the availability of AP-1 repressor proteins. We have previously identified two AP-1 elements at nucleotides (nt) –358 to –352 and –319 to –313 that repress the basal FR-ß promoter activity, and showed by electrophoretic mobility shift assay (EMSA) that they associate with unidentified proteins including Fos family proteins that act as putative repressors. We have also reported that when cells are first treated with ATRA, there is a decreased association of the proteins with the AP-1 elements presumably contributing to ATRA induction of the FR-ß gene. To test whether TSA influenced this likely indirect action of ATRA, nuclear proteins obtained after treating cells with ATRA and/or TSA were tested by EMSA using the FR-ß nt –338 to –308 sequence as the labeled probe (Fig. 6 ). As previously observed, ATRA decreased the association of AP-1 proteins represented by the major shift in Fig. 6. TSA further contributed to this decrease (Fig. 6), suggesting that a negative effect of HDAC inhibition on the availability of the putative repressor AP-1 proteins may indirectly contribute to the synergy between ATRA and HDAC inhibitors in up-regulating FR-ß.


Figure 6
View larger version (20K):
[in this window]
[in a new window]
 
Figure 6. EMSA to detect the effect of ATRA and/or TSA on the binding of the putative repressor AP-1 proteins in the FR-ß promoter. KG-1 cells were treated with vehicle or with ATRA (1 µmol/L) and/or TSA (50 ng/mL) for 5 days. Nuclear extracts from the cells and a 32P-labeled synthetic DNA duplex corresponding to the FR-ß gene sequence nt –338 to –308 were used in the EMSA as described in Materials and Methods. Lanes 1 to 9, 30,000 cpm 32P-labeled probe; lane 1, probe only; lane 2, 2.5 µg KG-1 cell nuclear extract; lanes 3 to 9, 5 µg KG-1 cell nuclear extract; lane 4, 50-fold excess unlabeled probe; lane 5, 100-fold excess unlabeled probe; lanes 3 to 6, 5 µg nuclear extract from KG-1 cells without treatment; lane 7, 5 µg nuclear extract from KG-1 cells treated with 1 µmol/L ATRA; lane 8, 5 µg nuclear extract from KG-1 cells treated with 50 ng/mL TSA; lane 9, 5 µg nuclear extract from KG-1 cells treated with 1 µmol/L ATRA and 50 ng/mL TSA.

 
FR-ß mediation of the cell growth inhibition by DDATHF and the effect of up-regulating the receptor with ATRA/HDAC inhibitor. To obtain initial proof-of-principle for the selective advantage of up-regulating FR-ß on FR-mediated drug delivery, the purine synthesis inhibitor DDATHF was chosen based on its high affinity for FR despite the fact that (in contrast with some newer antifolate drugs) this drug is known to also be transported by other membrane carriers, principally by the reduced folate carrier. The {alpha} isoform of FR is known to mediate cell growth inhibition by DDATHF by transporting the drug into the cell. FR-ß is known to bind folate compounds with affinities and stereospecificities that are distinct from those of FR-{alpha} (26). Therefore, the ability of the ß isoform of FR to mediate growth inhibition by DDATHF was first tested using recombinant CHO-FRß cells. In Fig. 7A , the MTT assay was used to compare the cell growth inhibition by 6S-DDATHF in the recombinant CHO-FRß cells versus the parental CHO-K1 cells. CHO-FRß cells were considerably (~23-fold) more sensitive than the parental CHO-K1 cells, and this difference in their sensitivity was abrogated by treating the cells with folic acid (200 nmol/L) before addition of the drug to block FR-mediated drug uptake. These results show a major contribution of FR-ß expression to the cell growth inhibition by DDATHF.


Figure 7
View larger version (16K):
[in this window]
[in a new window]
 
Figure 7. Functionality of FR-ß in mediating growth inhibition by DDATHF in CHO-FRß cells and in binding [3H]folic acid in MV4-11A cells. A, CHO-K1 or CHO-FRß cells were treated with or without 200 nmol/L folic acid (FA) 1 hour before adding different concentrations of 6S-DDATHF for 3 days. Cell viability was then determined by the MTT assay and the percentage of cell survival was calculated as described in Materials and Methods. B, MV4-11A cells were treated with vehicle or with 1 µmol/L ATRA + 50 ng/mL TSA for different periods and the expression of functional FR-ß on the cell surface was determined by the [3H]folic acid binding assay as described in Materials and Methods.

 
Because AML cell lines generally contain a heterogeneous cell population, a clonal population of MV4-11 (MV4-11A) cells was randomly isolated for the growth inhibition studies. The ability of FR-ß induced in these cells by the combination of ATRA and TSA to bind folate was first tested (Fig. 7B). Treatment of the cells with ATRA + TSA greatly increased their cell-surface binding of [3H]folic acid, reaching an optimal level of ~5 x 105 [3H]folic acid binding sites (FR molecules) per cell by day 5 of the treatment (Fig. 7B).

The growth inhibition by 6S-DDATHF was determined in cells that were previously treated with ATRA and TSA alone or in combination or with a vehicle control (Table 1 ). In control assays, folic acid (200 nmol/L) was added to the media before the addition of DDATHF to block FR-ß-mediated drug uptake. As seen in Table 1, in MV4-11A cells, ATRA treatment increased FR-ß expression and TSA enhanced this effect. ATRA treatment increased the growth inhibition by 6S-DDATHF compared with the untreated vehicle control cells, whereas TSA treatment did not have an appreciable effect (Table 1). The combination of ATRA and TSA produced the highest level of growth inhibition by 6S-DDATHF. In all cases, pretreatment of the cells with folic acid decreased the growth inhibition by 6S-DDATHF to IC50 values that were comparable (Table 1), showing that increased FR-ß expression/function contributed to growth inhibition by the antifolate. It may be noted in Table 1 that 6S-DDATHF inhibited the growth of MV4-11 cells with an IC50 of ~8.6 x 10–9 mol/L in the control cells treated with vehicle alone and that blocking FR-mediated drug uptake with folic acid only increased the IC50 value to ~10.5 x 10–9 mol/L. The magnitude of the effect of inducing FR-ß by the combination of ATRA and TSA (a decrease in IC50 to ~1.5 x 10–9 mol/L) may be appreciated in the context of this "background" of FR-independent growth inhibition by the antifolate that is presumably mediated by other antifolate transporters.


View this table:
[in this window]
[in a new window]
 
Table 1. Effect of ATRA and/or TSA on MV4-11 cell growth inhibition by 6S-DDATHF

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have previously reported that the mechanism of induction of FR-ß expression by ATRA in AML cells is atypical because it occurs by direct and ligand-dependent interaction of RARs with the FR-ß promoter in the absence of a retinoic acid response element (8). Multiple events in this interaction seem to contribute to the ATRA effect; they include an increase in the association of RAR{alpha}, a decrease in the association of RARs ß and {gamma}, and a decrease in the association of repressor AP-1 proteins. An additional event revealed in this study is an increase in the association of Sp1. The present study was undertaken on the premise that regardless of the exact mechanism involved, transcriptional up-regulation of genes by nuclear receptors is generally mediated in large part by increasing histone acetylation. Because coregulators are the principal mediators of modulation of histone acetylation by nuclear receptors, it follows that the variable coregulator complement of AML cells may determine the degree to which ATRA will up-regulate FR-ß. By the same reasoning, inhibitors of histone deacetylation may be expected to optimize the ATRA effect. Because HDAC inhibitors with acceptable toxicity profiles are available, the use of such agents in combination with ATRA is a viable option when the degree of FR-ß induction by ATRA is less than optimal for FR-targeted therapy.

The results of this study confirm the hypothesis that HDAC inhibition will potentiate ATRA-induced increase in FR-ß expression in AML cells. The inhibitors include TSA, the prototypical class I/II HDAC inhibitor, as well as VPA and depsipeptide that have been approved for administration in humans. Like ATRA, HDAC inhibition either by itself or in combination with ATRA did not induce FR expression in FR-negative cells but only enhanced transcription of the gene in the receptor-positive cells, in particular, AML cells. This mode of TSA action is clearly advantageous in facilitating selective targeting of AML cells with drugs that are selective for FR. In view of the heterogeneous nature of AMLs, it is important to understand the mechanism of action of HDAC inhibitors and ATRA in inducing FR-ß expression because this could provide a rational basis from which to infer the clinical contexts in which they could be used in FR-targeted therapy of AML to optimize the treatment and to circumvent potential problems.

At both the level of FR-ß promoter activity (in recombinant 293 cells) and endogenous FR-ß expression (in KG-1 and MV4-11 AML cells), at the optimal ATRA dose for induction of FR-ß, HDAC inhibitors potentiated the ATRA effect in a dose-dependent manner. A systematic examination of factors that are known to affect FR-ß gene transcription and its regulation by ATRA revealed several events that were affected by HDAC inhibitors in a manner that was both ATRA dependent and synergistic with the ATRA effect. HDAC inhibition caused an increase in the acetylation of histones H3 and H4 within the FR-ß promoter region and this increase was optimal in the presence of ATRA, providing a likely mechanistic basis for the action of HDAC inhibitors at the level of the promoter. Perhaps the most striking effect of HDAC inhibition is to increase the association of Sp1 with the basal FR-ß promoter that occurred to a relatively modest extent in the presence of ATRA alone. The combination of ATRA and HDAC inhibitor did not alter the Sp1 level in the cells. The increased association of Sp1 caused by HDAC inhibition was entirely ATRA dependent. However, this increase in Sp1 induced by HDAC inhibition was not accompanied by a further change in the association of RAR{alpha} with the promoter. This observation indicates that notwithstanding previous reports (28, 29) that Sp1 can directly associate with RAR{alpha}, neither protein recruits the other to the FR-ß promoter but rather they are independently recruited. A reasonable explanation for the observations is that histone acetylation caused by recruiting RAR{alpha} to the core promoter facilitates Sp1 binding to the promoter and that HDAC inhibitors promote histone acetylation by RAR{alpha}-associated coregulators. ATRA-induced association of RAR{alpha} with the FR-ß core promoter is consistent with recent findings of core promoter diversity (30) combined with the known ability of RAR{alpha} to associate with general transcription factors (31). Additional events that seem to contribute to the effect of HDAC inhibition on ATRA induction of FR-ß include facilitating dissociation of RAR{gamma} and decreasing the association of putative AP-1 repressor proteins. HDAC inhibition did not alter the expression levels of RARs but because the identity of the AP-1 repressor proteins is not yet known, it has not been possible to determine whether they are down-regulated.

Evidence is also presented in this study that FR-ß mediates growth inhibition by the antifolate DDATHF and that increased induction of FR-ß in AML cells by ATRA or a combination of ATRA and a HDAC inhibitor substantially contributes to their sensitivity to the drug. These observations offer proof-of-principle for translating the effect of ATRA and HDAC inhibitors on AML cells to therapeutic benefit in FR-ß targeted drug delivery.


    Acknowledgments
 
Grant support: NIH R01 grants CA 80183 and CA 103964 and subcontract from CA095673 (M. Ratnam).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 11/ 9/05. Revised 2/ 3/06. Accepted 3/22/06.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Bishop JF. Adult acute myeloid leukaemia: update on treatment. Med J Aust 1999;170:39–43.[Medline]
  2. List A. Role of multidrug resistance and its pharmacological modulation in acute myeloid leukemia. Leukemia 1996;10:937–42.[Medline]
  3. Huang ME, Ye YC, Chen SR, et al. Use of all-trans retinoic acid in the treatment of acute promyelocytic leukemia. Blood 1988;72:567–72.[Abstract/Free Full Text]
  4. Tallman MS, Andersen JW, Schiffer CA, et al. All-trans-retinoic acid in acute promyelocytic leukemia. N Engl J Med 1997;337:1021–8.[Abstract/Free Full Text]
  5. Pan XQ, Zheng X, Shi G, Wang H, Ratnam M, Lee RJ. Strategy for the treatment of acute myelogenous leukemia based on folate receptor ß-targeted liposomal doxorubicin combined with receptor induction using all-trans retinoic acid. Blood 2002;100:594–602.[Abstract/Free Full Text]
  6. Ratnam M, Hao H, Zheng X, et al. Receptor induction and targeted drug delivery: a new antileukaemia strategy. Expert Opin Biol Ther 2003;3:563–74.[CrossRef][Medline]
  7. Wang H, Zheng X, Behm FG, Ratnam M. Differentiation-independent retinoid induction of folate receptor type ß, a potential tumor target in myeloid leukemia. Blood 2000;96:3529–36.[Abstract/Free Full Text]
  8. Hao H, Qi H, Ratnam M. Modulation of the folate receptor type ß gene by coordinate actions of retinoic acid receptors at activator Sp1/ets and repressor AP-1 sites. Blood 2003;101:4551–60.[Abstract/Free Full Text]
  9. Kamen BA, Smith AK. A review of folate receptor {alpha} cycling and 5-methyltetrahydrofolate accumulation with an emphasis on cell models in vitro. Adv Drug Deliv Rev 2004;56:1085–97.[CrossRef][Medline]
  10. Lu Y, Low PS. Folate-mediated delivery of macromolecular anticancer therapeutic agents. Adv Drug Deliv Rev 2002;54:675–93.[CrossRef][Medline]
  11. Theti DS, Bavetsias V, Skelton LA, et al. Selective delivery of CB300638, a cyclopenta[g]quinazoline-based thymidylate synthase inhibitor into human tumor cell lines overexpressing the {alpha}-isoform of the folate receptor. Cancer Res 2003;63:3612–8.[Abstract/Free Full Text]
  12. Elnakat H, Ratnam M. Distribution, functionality and gene regulation of folate receptor isoforms: implications in targeted therapy. Adv Drug Deliv Rev 2004;56:1067–84.[CrossRef][Medline]
  13. Leamon CP, Low PS. Folate-mediated targeting: from diagnostics to drug and gene delivery. Drug Discov Today 2001;6:44–51.[CrossRef][Medline]
  14. Jackman AL, Theti DS, Gibbs DD. Antifolates targeted specifically to the folate receptor. Adv Drug Deliv Rev 2004;56:1111–25.[CrossRef][Medline]
  15. Leamon CP, Reddy JA. Folate-targeted chemotherapy. Adv Drug Deliv Rev 2004;56:1127–41.[CrossRef][Medline]
  16. Gabizon A, Shmeeda H, Horowitz AT, Zalipsky S. Tumor cell targeting of liposome-entrapped drugs with phospholipid-anchored folic acid-PEG conjugates. Adv Drug Deliv Rev 2004;56:1177–92.[CrossRef][Medline]
  17. Lu Y, Sega E, Leamon CP, Low PS. Folate receptor-targeted immunotherapy of cancer: mechanism and therapeutic potential. Adv Drug Deliv Rev 2004;56:1161–76.[CrossRef][Medline]
  18. Roy EJ, Gawlick U, Orr BA, Kranz DM. Folate-mediated targeting of T cells to tumors. Adv Drug Deliv Rev 2004;56:1219–31.[CrossRef][Medline]
  19. Zhao XB, Lee RJ. Tumor-selective targeted delivery of genes and antisense oligodeoxyribonucleotides via the folate receptor. Adv Drug Deliv Rev 2004;56:1193–204.[CrossRef][Medline]
  20. Ratnam M, Marquardt H, Duhring JL, Freisheim JH. Homologous membrane folate binding proteins in human placenta: cloning and sequence of a cDNA. Biochemistry 1989;28:8249–54.[CrossRef][Medline]
  21. Ross JF, Wang H, Behm FG, et al. Folate receptor type ß is a neutrophilic lineage marker and is differentially expressed in myeloid leukemia. Cancer 1999;85:348–57.[CrossRef][Medline]
  22. Nakashima-Matsushita N, Homma T, Yu S, et al. Selective expression of folate receptor ß and its possible role in methotrexate transport in synovial macrophages from patients with rheumatoid arthritis. Arthritis Rheum 1999;42:1609–16.[CrossRef][Medline]
  23. Reddy JA, Haneline LS, Srour EF, Antony AC, Clapp DW, Low PS. Expression and functional characterization of the ß-isoform of the folate receptor on CD34(+) cells. Blood 1999;93:3940–8.[Abstract/Free Full Text]
  24. Wu M, Fan J, Gunning W, Ratnam M. Clustering of GPI-anchored folate receptor independent of both cross-linking and association with caveolin. J Membr Biol 1997;159:137–47.[CrossRef][Medline]
  25. Dignam JD, Lebovitz RM, Roeder RG. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 1983;11:1475–89.[Abstract/Free Full Text]
  26. Wang X, Shen F, Freisheim JH, Gentry LE, Ratnam M. Differential stereospecificities and affinities of folate receptor isoforms for folate compounds and antifolates. Biochem Pharmacol 1992;44:1898–901.[CrossRef][Medline]
  27. Plumb JA, Milroy R, Kaye SB. Effects of the pH dependence of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide-formazan absorption on chemosensitivity determined by a novel tetrazolium-based assay. Cancer Res 1989;49:4435–40.[Abstract/Free Full Text]
  28. Suzuki Y, Shimada J, Shudo K, Matsumura M, Crippa MP, Kojima S. Physical interaction between retinoic acid receptor and Sp1: mechanism for induction of urokinase by retinoic acid. Blood 1999;93:4264–76.[Abstract/Free Full Text]
  29. Shimada J, Suzuki Y, Kim SJ, Wang PC, Matsumura M, Kojima S. Transactivation via RAR/RXR-Sp1 interaction: characterization of binding between Sp1 and GC box motif. Mol Endocrinol 2001;15:1677–92.[Abstract/Free Full Text]
  30. Smale ST, Kadonaga JT. The RNA polymerase II core promoter. Annu Rev Biochem 2003;72:449–79.[CrossRef][Medline]
  31. Schulman IG, Chakravarti D, Juguilon H, Romo A, Evans RM. Interactions between the retinoid X receptor and a conserved region of the TATA-binding protein mediate hormone-dependent transactivation. Proc Natl Acad Sci U S A 1995;92:8288–92.[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Qi, H.
Right arrow Articles by Ratnam, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Qi, H.
Right arrow Articles by Ratnam, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online