Cancer Research Donn Young  Genetics and Biology of Brain Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Palamarchuk, A.
Right arrow Articles by Pekarsky, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Palamarchuk, A.
Right arrow Articles by Pekarsky, Y.
[Cancer Research 66, 6014-6017, June 15, 2006]
© 2006 American Association for Cancer Research


Priority Reports

Tal1 Transgenic Expression Reveals Absence of B Lymphocytes

Alexey Palamarchuk, Nicola Zanesi, Rami I. Aqeilan, Alexey Efanov, Vadim Maximov, Urmila Santanam, John P. Hagan, Carlo M. Croce and Yuri Pekarsky

Comprehensive Cancer Center, Human Cancer Genetics Program and Department of Molecular Virology, Immunology, and Medical Genetics, OSU School of Medicine, Ohio State University, Columbus, Ohio

Requests for reprints: Yuri Pekarsky, Comprehensive Cancer Center, Ohio State University, 435 Wiseman Hall, 410 West 12th Avenue, Columbus, OH 43210. Phone: 614-292-3120; Fax: 614-292-3312; E-mail: Pekarsky.Yuri{at}osumc.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
TAL1 oncogene encodes a helix-loop-helix transcription factor, Tal1, which is required for blood cell development, and its activation is a frequent event in T-cell acute lymphoblastic leukemia. Tal1 interacts and inhibits other helix-loop-helix factors such as E47 and HEB. To investigate the function of Tal1 in B cells, we generated Eµ-TAL1 transgenic mouse line, expressing Tal1 in mouse B-cell lineage. Fluorescence-activated cell sorting (FACS) analysis of lymphocytes isolated from spleens of five out of five founders reveals complete absence of IgM- or CD19-expressing cells. Only 2% to 3% of these cells were B220+ and 100% of B220+ cells were CD43+, indicating that these mice were able to make pro-B cells. Similarly, FACS analysis of bone marrow cells in Eµ-TAL1 mice revealed complete absence of B220+IgM+ and B220+CD19+ cells. Analysis of the recombination status of IgH genes revealed the presence of D-J but absence or drastic reduction of V-D-J rearrangements. Our results suggest that Tal1 overexpression in B cells results in a phenotype similar to that of B cells of E47/E2A knockout animals. This represents first in vivo evidence that Tal1 can completely inhibit E47/E2A function. (Cancer Res 2006; 66(12): 6014-7)


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Activation of TAL1 gene (also known as SCL or TCL5) by chromosomal rearrangements at 1p32 is a common event in T-cell acute lymphoblastic leukemia (T-ALL; ref. 1). Whereas in normal T cells Tal1 is not expressed, it is activated in the majority of T-ALL (1). Transgenic expression of Tal1 in T cells causes the development of clonal T-cell leukemias (2, 3). The TAL1 gene encodes a helix-loop-helix transcription factor (1). These factors often form homodimers and heterodimers that recognize specific DNA sequences (1). Although Tal1 cannot form homodimers, it interacts and inhibits other helix-loop-helix factors such as E47/E2A and HEB (1, 3). E47/E2A has been implicated as a gene with tumor suppressor activity because mice deficient for E2A succumb to T-cell lymphomas (4). A recent report showed that Tal1 induces T-ALL primarily by inhibiting transcriptional activity of E47 (3). Tal1 gene knockout in mice resulted in midgestational lethality and complete absence of yolk sac erythropoiesis (5). Further analysis of chimeric mice showed that Tal1 is essential for development of all hematopoietic lineages (5). Mice lacking the E2A gene showed impaired lymphoid development with reduced amount of mature T cells and complete absence of B cells, and no recombination of IgH genes was detected (6). A transgenic mouse model expressing truncated form of human Tal1 under the control of ubiquitous SIL promoter showed 30% to 60% reduction of IgM+ cells and no effect on V-D-J recombination of IgH genes was observed in these animals (7). A similar report described TAL1 transgenic mouse model expressing TAL1 under the control of lymphoid-specific Ly-6E.1 promoter. These mice also showed ~50% reduction of B220+CD19+ cells in bone marrow (8). Recently, we reported that Tal1 is phosphorylated and regulated by Akt (9). To investigate the function of Tal1 in B cells, we generated Eµ-TAL1 transgenic mouse line expressing Tal1 in mouse B-cell lineage. Here we report the phenotype of these mice.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Eµ-TAL1 transgenic mice. A 1.5-kb fragment encoding the entire open reading frame of human TAL1 with 3' HA tag was cloned into previously described pBSVE6BK (pEµ) plasmid containing a mouse VH promoter (V186.2) and the IgH-µ enhancer (10). The construct, free from vector sequences, was injected into fertilized oocytes from C57Bl/6 and FVB/N animals. Transgenic mice were produced in Ohio State University transgenic mouse facility. Transgenic heterozygote mice were genotyped by PCR using the following primers: Tal3, AGATGACCTCCTGCAAGACGTGCTT; Tal4, GGTCGACCTAAGCGTAATCTGCAA. Control primers used in Figs. 1 and 2 amplify exon 5 of mouse Fhit gene: FhitD, CTTGAATCTAGGCTGCATTCTAGCGAG; FhitR, GATTCCTTGCTTACCTTTTGGGGATGG. PCR was carried out for 30 cycles at 94° for 30 minutes, 64° for 30 minutes, and 68° for 40 minutes using Advantage 2 polymerase (Clontech, Palo Alto, CA).


Figure 1
View larger version (28K):
[in this window]
[in a new window]
 
Figure 1. Absence of pro-B cells and mature B cells in spleen lymphocytes from Eµ-TAL1 transgenic mice. A, the construct used in the transgenic mouse production. B, FACS analysis of lymphocytes from spleens of wild-type (top) or Eµ-TAL1 transgenic mice (bottom).

 

Figure 2
View larger version (51K):
[in this window]
[in a new window]
 
Figure 2. Western blot analysis of whole spleen lysates from Eµ-TAL1 transgenics. Western blot analysis of whole spleen lysates from a wild-type mouse (lane 1) or transgenic Eµ-TAL1 mice from three different lines (lanes 2-4). Bottom, PCR analysis confirming correct genotypes of transgenic animals.

 
Western blot analysis. Cell proteins were extracted and Western blot analysis was carried out as previously described (11). Antibodies used were CD20 (H-170) and CD2 (TM2-5; Santa Cruz Biotechnology, Santa Cruz, CA), horseradish peroxidase-goat anti-mouse IgM (Zymed, South San Francisco, CA), and antitubulin (ab-1; Calbiochem, La Jolla, CA).

Fluorescence-activated cell sorting analysis. Spleen and bone marrow cells were isolated and analyzed by flow cytometry as previously described (12) using FACSCalibur (Becton Dickinson, Mountain View, CA). Antibodies were purchased from PharMingen (San Diego, CA): B220 (RA3-6B2), TCR ß-chain (H57-597), IgM (R6-60.2), and CD43 (S7).

PCR analysis of D-J and V-D-J rearrangements. These experiments were carried out using previously described primers and conditions (6) except nested PCR was carried out using Advantage 2 polymerase. For the first PCR reaction, 20 cycles were used, whereas in the second PCR reaction, 15 cycles were used.


    Results and Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
We generated transgenic mice in which the expression of human TAL1 was under the control of a VH promoter-IgH-Eµ enhancer of which the activity specifically targets expression of the transgene to immature and mature B cells (ref. 10; Fig. 1A). Five transgenic founders, one on C57Bl/6 background and four on FVB/N background, were generated and bred to establish five transgenic lines. Pathologic examination of 1- to 2-month-old transgenic mice did not reveal any abnormalities, except spleens of transgenic animals were, on average, half the size and weight of those of their nontransgenic littermates. Because it was previously reported that transgenic expression of the truncated form of human Tal1 under the control of ubiquitous SIL promoter showed 30% to 60% reduction of IgM+ cells (7), we used fluorescence-activated cell sorting (FACS) analysis to investigate lymphocyte lineages in spleens of Eµ-TAL1 transgenic animals. FACS analysis of lymphocytes isolated from transgenic spleens of five out of five transgenic lines reveals complete absence of IgM-expressing (Fig. 1B) or CD19-expressing (not shown) cells. Almost all (97-98%) transgenic lymphocytes were T cells and only 2% to 3% of these cells were B220+ whereas 40% of B220+ cells were present in spleen lymphocytes isolated from wild-type mice (Fig. 1B). This indicates that Eµ-TAL1 transgenic animals are unable to make pre-B cells and mature B cells. Figure 1B also shows that 100% of B220+ cells were CD43+, indicating that pro-B cells are present in the spleens of Eµ-TAL1 transgenics. These results were consistent in all five transgenic lines. To confirm our findings, we analyzed the expression of B-cell and T-cell markers by Western blot of total protein extracted from spleens of 2-month-old mice (Fig. 2). Our results showed that IgM and CD20 (B-cell–specific markers) are not expressed in spleens of transgenic animals whereas CD2 (T-cell–specific marker) was expressed at normal levels (Fig. 2, lanes 2-4 versus lane 1). These results were also consistent in all five transgenic lines. Consequently, transgenic expression of Tal1 was not detected in Western blot analysis using antihemagglutinin TAG antibody, thus confirming complete absence of pre-B cells and mature B cells in Eµ-TAL1 transgenics. To confirm our findings, we analyzed bone marrow cells of Eµ-TAL1 transgenics by FACS analysis. Figure 3 shows that bone marrow of Eµ-TAL1 mice did not contain any B220+IgM+ or B220+CD19+ cells whereas bone marrow of their wild-type littermates contained 25% of B220+IgM+ and 62% of B220+CD19+ cells. All 21% B220+ cells in Eµ-TAL1 mice were also CD43+, indicating the presence of pro-B cells but not of pre-B cells or mature B cells.


Figure 3
View larger version (20K):
[in this window]
[in a new window]
 
Figure 3. Defect of early B lymphopoiesis in bone marrow from Eµ-TAL1 transgenic mice. FACS analysis of lymphocytes from bone marrow of wild-type (top) or Eµ-TAL1 transgenic mice (bottom).

 
Because Tal1 functions as an inhibitor of E47 encoded by the E2A tumor suppressor gene (3) and E2A knockout mice show the absence of B cells and the absence of D-J and V-D-J rearrangements of IgH genes (6), we proceeded to determine the status of these rearrangements in bone marrow of Eµ-TAL1 transgenics. We used the same primers used to analyze D-J and V-D-J rearrangements in E2A knockout mice (6). Figure 4 shows that D-J rearrangements are detectable in Eµ-TAL1 transgenic B cells but no V-D-J rearrangements were observed. However, in some cases, the increase of cycle number in the nested PCR reaction (20-25 instead of 15) resulted in the appearance of faint rearranged bands (not shown).


Figure 4
View larger version (16K):
[in this window]
[in a new window]
 
Figure 4. Status of D-J and V-D-J rearrangements of IgH genes in Eµ-TAL1 transgenic mice. A, schematic representation of murine IgH locus. Of ~150 murine VH genes close to half belongs to J558 family. IgH locus also contains 12 DH genes and 4 JH genes. Arrows, positions of the primers. The sizes of the PCR products are ~145 bp (DSP2-JH) and ~300 bp (J558-JH). B, lanes 1 to 4, PCR using bone marrow genomic DNA isolated from two mice, each from a different transgenic line (lanes 1 and 2), and from two wild-type mice (lanes 3 and 4). Lane 5, DNA isolated from tails of wild-type mice was used in PCR. Lane 6, negative control with no DNA.

 
In this report, we show that transgenic expression of Tal1 in mouse B cells results in the complete absence of pre-B cells and mature B cells. The function of Tal1 as an inhibitor of E2A/E47 is well established (1, 3). Because E2A knockout mice also show complete absence of B cells (6), our results represent first in vivo evidence that overexpression of Tal1 completely inhibits E47 function in vivo. The only difference between these two phenotypes is the detection of D-J rearrangements of the IgH genes in Eµ-TAL1 transgenic B cells whereas these rearrangements were not detected in E2A knockout B cells. It is possible that our construct, which contains Eµ enhancer, starts expressing high levels of the transgene after the late pro-B-cell stage in which D-J rearrangements occur, explaining this difference in the phenotypes.

Two transgenic mouse models, expressing truncated or full-length form of human Tal1 under the control of ubiquitous SIL promoter, showing some expression in B cells or lymphoid-specific Ly-6E.1 promoter, were previously reported (7, 8). These mice showed 2- to 3-fold reduction of IgM+ cells with no effect on V-D-J recombination of IgH genes (7) or ~2-fold reduction of B220+CD19+ cells in bone marrow (8). These results suggested that Tal1 can only partially inhibit E2A function because E2A-deficient B cells did not show any pre-B cells or mature B cells (6). In contrast, Eµ-TAL1 mice did not have any IgM+ or CD19+ cells and showed absence or drastic reduction of V-D-J rearrangements. The differences in phenotypes of Eµ-TAL1 mice and two previously reported TAL1 transgenic models can be explained by possible higher expression of the transgene in Eµ-TAL1 mice or by the functional differences between the full-length and truncated forms of Tal1. A generation of a transgenic mouse model expressing the truncated form of Tal1 under the control of the Eµ enhancer would provide a more precise explanation of these differences in phenotypes.


    Acknowledgments
 
Grant support: Kimmel Scholar Award (R. Aqeilan).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 3/13/06. Accepted 4/25/06.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 

  1. Begley CG, Green AR. The SCL gene: from case report to critical hematopoietic regulator. Blood 1999;93:2760–70.[Free Full Text]
  2. O'Neil J, Billa M, Oikemus S, Kelliher M. The DNA binding activity of TAL-1 is not required to induce leukemia/lymphoma in mice. Oncogene 2001;20:3897–905.[CrossRef][Medline]
  3. O'Neil J, Shank J, Cusson N, Murre C, Kelliher M. TAL1/SCL induces leukemia by inhibiting the transcriptional activity of E47/HEB. Cancer Cell 2004;5:587–96.[CrossRef][Medline]
  4. Mikkers H, Allen J, Berns A. Proviral activation of the tumor suppressor E2a contributes to T cell lymphomagenesis in EµMyc transgenic mice. Oncogene 2002;21:6559–66.[CrossRef][Medline]
  5. Porcher C, Swat W, Rockwell K, Fujiwara Y, Alt FW, Orkin SH. The T cell leukemia oncoprotein SCL/tal-1 is essential for development of all hematopoietic lineages. Cell 1996;86:47–57.[CrossRef][Medline]
  6. Bain G, Maandag EC, Izon DJ, et al. E2A proteins are required for proper B cell development and initiation of immunoglobulin gene rearrangements. Cell 1994;79:885–92.[CrossRef][Medline]
  7. Herblot S, Aplan PD, Hoang T. Gradient of E2A activity in B-cell development. Mol Cell Biol 2002;22:886–900.[Abstract/Free Full Text]
  8. Goardon N, Schuh A, Hajar I, et al. Ectopic expression of TAL-1 protein in Ly-6E.1-htal-1 transgenic mice induces defects in B- and T-lymphoid differentiation. Blood 2002;100:491–500.[Abstract/Free Full Text]
  9. Palamarchuk A, Efanov A, Maximov V, Aqeilan RI, Croce CM, Pekarsky Y. Akt phosphorylates Tal1 oncoprotein and inhibits its repressor activity. Cancer Res 2005;65:4515–9.[Abstract/Free Full Text]
  10. Shaw AC, Swat W, Ferrini R, Davidson L, Alt FW. Activated Ras signals developmental progression of recombinase-activating gene (RAG)-deficient pro-B lymphocytes. J Exp Med 1999;189:123–9.[Abstract/Free Full Text]
  11. Pekarsky Y, Hallas C, Palamarchuk A, et al. Akt phosphorylates and regulates the orphan nuclear receptor Nur77. Proc Natl Acad Sci U S A 2001;98:3690–4.[Abstract/Free Full Text]
  12. Bichi R, Shinton SA, Martin ES, et al. Human chronic lymphocytic leukemia modeled in mouse by targeted TCL1 expression. Proc Natl Acad Sci U S A 2002;99:6955–60.[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Palamarchuk, A.
Right arrow Articles by Pekarsky, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Palamarchuk, A.
Right arrow Articles by Pekarsky, Y.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online