| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Cell, Tumor, and Stem Cell Biology |
1 Institut National de la Sante et de la Recherche Medicale U673 and UPMC, Hôpital Saint-Antoine; 2 Unité de Gynécologie, AP-HP, Hôtel-Dieu de Paris, Paris, France and 3 Laboratory of Experimental Cancerology, Ghent University Hospital, Ghent, Belgium
Requests for reprints: Patricia Forgez, Institut National de la Sante et de la Recherche Medicale U673 and UPMC, Hôpital Saint-Antoine, Bâtiment Raoul Kourilsky, 184 rue du Faubourg St-Antoine, 75571 Paris Cedex 12, France. Phone: 33-1-49-28-46-69; Fax: 33-1-44-74-93-18; E-mail: forgez{at}st-antoine.inserm.fr.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
For example, the overexpression of the HER-2/neu proto-oncogene was found to correlate with increased tumor aggressiveness, recurrence, and mortality in node-positive patients (4). The combination of chemotherapy and Herceptin, a blocker of the HER-2/neu growth factor receptor, provides benefits for metastatic breast cancer patients whose tumors overexpressed HER-2, suggesting that HER-2 signaling is critically involved in the carcinogenesis of the mammary gland (5). Several additional data and converging evidence support the concept that the HER family [epidermal growth factor (EGF) receptor (EGFR), HER-2, HER-3, and HER-4] and their ligands can contribute to breast cancer development and clinical course of the disease (6). Abnormal expression of HER members results in receptor hyperactivation due to abnormal transcriptional regulation ensuing in protein overexpression and stimulation enhancement by growth factors (7). Although the functionality of HER members, especially HER-2, has been extensively studied in breast cancer (6), the pathologic conditions resulting in HER member family activation is not fully understood. Emerging paradigms suggest that several growth-promoting peptides, such as angiotensin, endothelin, vasoactive intestinal peptide, bombesin, gastrin, and neurotensin, interact in a cross-talk with the EGFR signaling pathway (8, 9). Many of these peptide receptors, belonging to the G-protein-coupled receptor (GPCR) family, are often overexpressed in human solid tumors and activate several transforming functions, including cell proliferation, survival, invasion, tumor angiogenesis, and metastasis (10).
Several reports implicate neurotensin and its high-affinity neurotensin receptor (NT1 receptor) in several detrimental functions linked to the neoplastic progression, including proliferation of the pancreas, prostate, colon, and lung cancer cells (11), protection of breast cancer cells against apoptosis (12), and induction of the proinvasive potential of colon cancer cells (13). In colon and breast cancers, the NT1 receptor is a Wnt/ß-catenin target gene (13).
The central and peripheral functions of neurotensin are mediated through its interaction with NT1, NT2, and NT3 receptors (14). NT1 and NT2 are GPCRs with high (subnanomolar) and low (nanomolar) affinity for neurotensin, respectively. In vivo and in vitro neurotensin effects are abolished by the specific antagonist of NT1 receptor SR48692, showing that NT1 receptor is the major mediator of these transforming actions (15).
Neurotensin is largely distributed along the gastrointestinal tract (16). Neurotensin is released into the blood circulation soon after a meal and persists for at least 10 hours, increasing its basal blood concentration from 10 to 20 up to 230 pmol/L (17). The physiologic functions of neurotensin include stimulation of pancreatic and biliary secretions, inhibition of small bowel and gastric motility, and facilitation of fatty acid translocation (1820). In addition, neurotensin is a trophic factor on gastric antrum, small bowel, and colon tissue regeneration (11).
The potential malignant effect of neurotensin is further sustained by data showing increased NT1 receptor expression in human cancers versus the corresponding normal epithelium (21, 22). When NT1 receptor is challenged with neurotensin, phosphatidylinositols are hydrolyzed leading to Ca2+ mobilization, and extracellular signal-regulated kinase 1/2 (ERK1/2), Rho GTPases (RhoA, Rac1, and Cdc42), and focal adhesion kinase (FAK) are activated, leading to immediate or delayed responses to neurotensin involving gene transcription activation, cell growth, death, or differentiation (2325). More recently, it was shown that neurotensin via NT1 receptor transactivates EGFR by the shedding of transforming growth factor-
(TGF-
) in pancreas and heparin- binding EGF or amphiregulin in prostate cancer cells, both leading to ERK1/2 activation (26, 27).
In this article, we report on the coexpression of NT1 receptor and neurotensin in human breast ductal invasive adenocarcinomas. We showed the detrimental role of endogenous neurotensin and NT1 receptor activation on the tumor growth initiated by human breast cancer cells xenografted in nude mice. Neurotensin and NT1 receptor had a discernible malignant effect on human breast adenocarcinoma cell proliferation, migration, and invasion. This report is the first study to support the contribution of neurotensin and NT1 receptor in the progression of transformed human breast epithelial cells (HBEC) to malignancy.
| Materials and Methods |
|---|
|
|
|---|
Breast tumors. A total of 84 patients diagnosed for breast cancer and undergoing tumorectomy or mastectomy for complete resection of their primary tumors (Gynecology Department, Hôtel-Dieu Hospital, Paris, France) were studied. A series of 70 patients with invasive ductal breast cancers (IDC) with concomitant ductal carcinoma in situ (DCIS) were analyzed. The average age was 60.7 ± 12.1 years, with a mean tumor size of 2 ± 1.3 cm, and 28 patients exhibited invaded nodes (from a total of 67 cases studied). The malignancy of the infiltrating carcinomas was scored according to the Scarff-Bloom-Richardson (SBR) histoprognostic system (29); accordingly, 22, 26, and 22 patients were classified as grades 1, 2, and 3, respectively. Four DCIS and 10 invasive lobular breast carcinomas were also collected. Tumors were fixed in 10% formaldehyde and embedded in paraffin wax. Several sections (5 µm thick) were made for each case. The histologic diagnosis was routinely checked by microscopic examination of sections stained with H&E.
Immunohistochemistry. Immunostaining of NT1 receptor and neurotensin was carried out on deparaffinized sections using the avidin-biotin-peroxidase complex method. After inhibition of endogenous peroxidases with 3% hydrogen peroxide, slides were washed in TBS and incubated with 10% normal rabbit serum at room temperature for 30 minutes. NT1 receptor immunoreactivity was detected using a goat polyclonal antibody directed against the human COOH terminus of the receptor (1:100; C-20; Santa Cruz Biotechnology, Santa Cruz, CA). Neurotensin immunoreactivity was conducted using rabbit antibody directed against neurotensin (1:500; NA1230; Biomol International, Plymouth, PA) for 2 hours at room temperature in a humidified chamber. Neurotensin or NT1 receptor immunohistochemistry specificity was checked by omission of primary antibody and by displacement with neutralizing peptide (Santa Cruz Biotechnology) or neurotensin for 2 hours at room temperature. All slides were rinsed thrice with TBS; sections were incubated with biotinylated secondary antibody (1:200; Vector Laboratories, Burlingame, CA) for 30 minutes at room temperature. The antigen-antibody complex was revealed with avidin-biotin-peroxidase complex for 30 minutes according to the manufacturer's instructions for the Vectastain ABC kit (Vector Laboratories). Staining was done for 5 minutes with 3,3'-diaminobenzidine (Sigma-Aldrich, Lyon, France). All slides were counterstained with hematoxylin. A semiquantitative estimation of the number of positive cells was done by counting 1,000 reactive and nonreactive cells in 10 successive fields at the original x250 magnification.
RNA extraction and reverse transcription-PCR. The protocols for total RNA extraction, reverse transcription, and PCR are documented by Souaze et al. (30). Reverse transcription was done on 2 µg total RNA using a specific NT1 receptor primer (5'-GCTGACGTAGAAGAG-3') or 50 pmol oligo(dT) and oligo(dN). The PCR amplification was done on a 1:5 (v/v) of the reverse transcription reaction using 25 pmol of each primer 5'-CGTGGAGCTGTACAACTTCA-3' and 5'-CAGCCAGCAGACCACAAAGG-3' for NT1 receptor and 5'-TCCAATAGGTGATGTTGTCGT-3' and 5'-TCCAATAGGTGATGTTGTCGT-3' for matrix metalloproteinase (MMP)-9 and 1 unit Taq polymerase (Applied Biosystems, Courtaboeuf, France). The amplification profile consisted of denaturation at 94°C for 30 seconds, annealing at 57°C for 45 seconds, and extension at 72°C for 45 seconds. The PCR cycles were preceded by denaturation at 95°C for 5 minutes and were followed by a final extension at 72°C for 10 minutes. Amplification was done in a DNA thermal cycler 9700 (Perkin-Elmer Applied Biosystems, Courtaboeuf, France).
NT1 receptor small interfering RNA construction and transfection. Small interfering RNAs (siRNA) for human NT1 receptor (AAGAAGTTCATCAGCGCCATC) and scramble sequence (ATCGTCCGAACGTAAGTCAA) were prepared using pSilencer 3.1-H1 according the manufacturer's instruction (Ambion, Austin, TX). MDA-MB-231 cells were transfected using Lipofectamine reagent (Invitrogen). Stable transfectants were selected with hygromycin B (400 µg/mL) and colonies were screened using NT1 receptor reverse transcription-PCR (RT-PCR) and binding assay. Two MDA siNT1 receptor clones, MDA Si1 and Si2, and one pool of clones expressing the scramble sequence, MDA Scr, were chosen for further experiments.
Wound healing. For migration assays, MDA-MB-231 cells were plated in six-well dishes. Twenty-four hours after the cells reached confluence, scarification was done in a Moscona buffer with a pipette tip. Cells were maintained in culture in low-serum medium (0.1% FCS) and treated with 108 mol/L neurotensin agonist, JMV449, in the presence or absence of NT1 receptor antagonist, SR48692. Pictures were taken at the beginning of the treatment and 18 hours later.
Collagen invasion assays. The method was adapted from Bracke et al. (31). Petri dishes were filled with 2.5 mL neutralized type I collagen (0.18%; Upstate Biotechnology, Lake Placid, NY) and allowed to gel for 4 hours at 37°C and 5% CO2. MDA-MB-231 cells were harvested and isolated using Moscona buffer and trypsin/EDTA, and 0.2 x 106 cells were seeded on top of the gel collagen. Dispersed cells were cultured for 24 hours at 37°C in the presence or absence of indicated effectors. Counting was done under code: invasive and superficial cells were counted in 12 fields of 0.157 mm2. The invasion index was calculated as the percentage of cells invading the gel divided by the total number of cells.
Gelatin zymography. Metalloproteinase activity in supernatants of MDA-MB-231 cells cultured in serum-free medium and conditioned or not conditioned for 24 hours with neurotensin agonist, JMV449, and was tested by zymography. Supernatants were desalted on G25 Sephadex column and then concentrated by lyophilization. Total protein (50 µg) was analyzed under nonreducing conditions on 8% polyacrylamide gels containing 0.1% gelatin. For development, gels were washed twice in 2.5% Triton X-100, incubated overnight at 37°C in 50 mmol/L Tris-HCl (pH 7.6), 5 mmol/L CaCl2, 0.02 mg/mL NaN3, and stained with Coomassie blue.
Animals. Xenografts were initiated by s.c. injection of 3 x 106 MDA-MB-231 wild-type (MDA wt), their silenced NT1 receptor counterparts (MDA Si1 or Si2), or the control MDA scramble cells (MDA Scr). Cells were resuspended in 100 µL PBS and 100 µL Matrigel. Three days after injection, the mice were randomly divided in two groups of 10 animals each and received the following treatments as i.p. injection: control, vehicle solution; NT1 receptor antagonist, SR48692 (1 mg/kg) resuspended daily in 0.5% Tween 20 in 9
NaCl. The treatment was continued for 27 days. The tumor volume was calculated using the formula: length x width2 x 0.4. After the treatment period, mice were sacrificed and the tumors were dissected and weighed.
Statistical analysis. The biochemical data were compared by Student's t test or ANOVA followed by Neuman-Keuls' test.
| Results |
|---|
|
|
|---|
|
Among the breast carcinomas studied, the majority exhibited a high proportion of NT1 receptorpositive cells (50-100%). Nonetheless, patients were considered positive with
10% positive cells. According to this assessment, we observed that 9 of 10 invasive lobular breast cancers, 4 of 4 DCIS, and 64 of 70 (91%) of the patients with IDCs were positive. Interestingly, NT1 receptor expression was not homogeneous in the ductal or the invasive compartment and varied according to the SBR grade. We observed that in 59% of patients with histologic grade 1 NT1 receptor reactivity was restricted to the intraductal compartment compared with only 4% for grade 3. In sharp contrast, the NT1 receptorpositive patients in the invasive component were predominantly in the histologic grade 3 (90%), with only 36% in grade 1.
Neurotensin is expressed in human breast carcinomas. Neurotensin expression was studied by immunohistochemistry on 50 patients previously studied for NT1 receptor expression to establish the potential NT1 receptor activation via neurotensin. As shown in Fig. 2 , neurotensin labeling was detected in the IDCs. The labeling was cytoplasmic in both ductal and invasive compartments. Neurotensin reactivity was either absent or intense in both compartments (Fig. 2, 1 and 2). Neurotensin antibody specificity was assessed by antibody preincubation with neurotensin as well as by the omission of primary antibody; in both cases, no labeling was observed (Fig. 2, 3 and 4). Among the 50 patients, 44 (88%) were NT1 receptor positive, 17 (34%) neurotensin positive, and 15 (30%) positive for both NT1 receptor and neurotensin.
|
|
This result substantiates NT1 receptor involvement in promoting breast tumor growth. To validate the in vivo effect, xenografted nude mice with MDA wt cells were administrated with daily doses of the specific NT1 receptor antagonist, SR48692 (15), for 27 days. Five days after inoculation, the initial breast tumor volume was the same in control and treated groups (191 ± 10 and 192 ± 3.4 mm3, respectively). As shown in Fig. 3C, SR48692 reduced by 25% and 30% the volume and weight of the MDA-MB-231 breast tumor xenografts and, accordingly, lengthened the tumor doubling time by 35%.
Neurotensin-induced motility and cellular invasion of breast cancer cell lines through NT1 receptor activation. Because active migration and invasive growth of transformed cells are characteristics of cancer progression, we examined the effect of neurotensin and NT1 receptor in the wound closure and collagen type I invasion assays using MDA wt and Si1 and Si2 cells. As shown in Fig. 4 , the weakly degradable neurotensin agonist, JMV449, remarkably increased the migration and wound healing of parental MDA-MB-231 cell layers. The residual gap size after 18 hours was smaller in cells treated with JMV449 compared with control cells (35% of the original open gap in the treated cells versus 50% in control cells). The specific NT1 receptor antagonist, SR48692, completely inhibited the agonist-induced wound healing effect in MDA wt (Fig. 4). The Scr cells exhibited the same response as the parental cells (data not shown). In contrast, wound repair was not accelerated in the presence of JMV449 for the silenced cell lines. Compared with the original gap, after 18 hours, the MDA Si1 residual gap was 64% for treated cells and 67% for nontreated control cells, respectively (Fig. 4). The residual gap sizes after 18 hours were similar for control and treated MDA Si2 cells (42% and 38%; data not shown).
|
. As control, MDA Scr cells were shown to be responsive to neurotensin, JMV449, and TGF-
(Fig. 5B).
|
q/Gß
and PKC signaling pathways in this cellular response. Equally interesting, the proinvasive activity of the NT1 receptor remained in the presence of pharmacologic inhibitors for phosphatidylinositol 3-kinase (PI3K; wortmannin), Rho GTPases and Rho kinase (C3T and Y27632), and G
o/i subunits (pertussis toxin) and protein kinase A (KT5720), two signaling elements involved in the cyclic AMP (cAMP) pathways.
Neurotensin-induced cell invasion requires MMP-9 activation. Tumor cell invasion through matrix and tissue barriers requires the combined effects of increased cell motility and regulated proteolytic degradation of the matrix. In breast tumors, the MMP-9 has been detected in vascular pericytes, cancer cells, and tumor stromal cells (32, 33). Elevated levels of the MMP-9 in tumor tissue have been generally correlated with cancer cell invasion and metastasis (34). To show the requirement for MMP-9 activation in neurotensin induced invasion, we preincubated MDA-MB-231 cells with a specific MMP-9 inhibitor for 30 minutes (35). The invasive activity induced by the NT1 receptor agonist JMV449 was selectively abolished because these breast cancer cells remained sensitive to the EGFR agonist TGF-
(Fig. 6A
). We further confirmed that neurotensin induced MMP-9 expression by raising the levels of MMP-9 mRNA (Fig. 6B). As a consequence, the MMP-9 gelatinase activity was elevated as visualized by zymography in MDA-MB-231 cells (Fig. 6C).
|
| Discussion |
|---|
|
|
|---|
Cancer progression involves a sequential series of critical genetic and molecular alterations inducing the deregulation of cell proliferation, adhesion, migration, and invasion and leading to the lethality associated with metastatic spread of malignant tumors. It has been shown previously that NT1 receptor gene is a target of the Wnt/APC oncogenic pathways connected with the ß-catenin/Tcf transcriptional complex, known to activate genes involved in cell proliferation and transformation (13). Because an exact correlation was found between NT1 receptor expression and ß-catenin cytoplasmic or nuclear localization in colonic adenomas, we concluded that NT1 receptor overexpression in cancer is an early event in colonic cell transformation (13).
Wnt genes are frequently up-regulated in breast cancer and are associated with mammary tumorigenesis (36). We observed previously that Wnt factors activate NT1 receptor gene expression in normal human epithelial breast cells (13), indicating a possible up-regulation of NT1 receptor in breast cancer. In the present study, we observed NT1 receptor expression mainly located in the ductal compartment within histologic grade 1, reinforcing the concept that NT1 receptor expression is an early event of breast epithelial cell transformation. In addition, we also detected intracellular NT1 receptor localization as well as neurotensin labeling predominantly in the invasive compartment in histologic grades 2 and 3, suggesting that intensive internalization follows receptor activation by intense and sustained ligand exposure. This event is associated with a chronic self-activation loop between neurotensin and the NT1 receptor and is a mechanism driving constitutive activation of the MAPK signaling pathways coupled with cell division (37). These critical agonist exposure conditions would seem to occur in breast cancer patients expressing both ligand and NT1 receptor and consequently enable the potential action of neurotensin/NT1 receptor in human breast cancer.
The molecular mechanisms involved in neurotensin gene up-regulation observed in human colon tumors (38), carcinoid tumors (39), and pancreatic tumors (40) are not fully clarified. Evidence shows that neurotensin gene hypomethylation (41), along with the activation of transcription factors activator protein-1 (AP-1) and cAMP-responsive element-binding protein and the oncogenic signaling factors RAS and Src, are potential mechanisms leading to neurotensin overexpression and secretion during cancer progression (42). It is noteworthy that estrogens can also activate neurotensin expression in the brain through the cAMP cascade and through an additional, nonconventional, steroid receptor pathway (43). A future challenge will be to evaluate the possible participation of estrogens in neurotensin expression in breast cancer.
No clear correlation has been described today between circulating neurotensin and the stages of pancreas, prostate, or medullar thyroid tumors (44) probably due to its high degradability and rapid clearance by the liver. Nevertheless, neurotensin was found to be released from gut and pancreas cancers and has been identified as a gene associated with enhanced metastasis in a lung carcinoma cell line (40, 45). Additionally, it has been shown that the NT1 receptor antagonist SR48692 inhibited the growth of human colon and lung cancer cells xenografted in mice (46). In this report, we further establish the contribution of endogenous or tumoral neurotensin within the breast cancer progression by showing the reversibility of its tumorigenic effects through silencing RNA and direct pharmacologic blockades. Nevertheless, direct determination of the local neurotensin concentration, at the tumor vicinity, would provide the clearest evaluation of neurotensin secretions by the tumor and its sequential placement within cancer progression.
Neurotensin signaling-associated effectors, such as nuclear factor-
B, ERK1/2, AP-1, Ras, Src, Rho family protein, and FAK, substantiate the potential neurotensin/NT1 receptor oncogenic role (2325, 47, 48). These signaling factors are correlated with cell and tissue growth, cell death, and differentiation. Here, we illustrated the proinvasive activity of neurotensin and the NT1 receptor in MDA-MB-231 cells mediated by MMP-9. Interestingly, expression of MMP-9 has been also associated with high potential of metastasis in several human carcinomas, including breast carcinomas. MMP-9 immunohistochemistry revealed MMP-9 in malignant and stromal cells, predicting a poor survival index when expressed in stromal cells within a hormone-responsive tumor, whereas it has a favorable survival index when expressed in carcinoma cells (49).
This article is the first report on neurotensin/NT1 receptor in human breast cancer and brings new data on neurotensin malignant effects in breast cancer cells, suggesting that NT1 receptor may not only be a marker but also participates as part of the process of breast cancer progression. Further analysis will detail the position and the participation of neurotensin in breast tumorigenesis, particularly the signaling, its partner (HER, EGF-like ligands, interleukin, etc.), and its place in the clinical course. The data described here should aid in the search for neurotensinergic-blocking agents to be joined to the adjuvant antihormonal or the chemotherapy treatments for breast cancer.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Dr. D. Gully (Sanofi-Synthelabo) for providing the NT1 receptor antagonist (SR48692), Dr. D. Pélaprat (U 773 EP 11 Hôpital Bichat) and Dr. N. Insdorf for very useful discussions, Isabelle Renault (Hôpital Saint-Antoine) for assistance with the animals, and Dr. D. Hugol (Laboratoire d'Anatomie Pathologique, Hôtel-Dieu de Paris) for reviewing the pathology of breast cancer biopsies.
Received 2/ 7/06. Revised 3/31/06. Accepted 4/18/06.
| References |
|---|
|
|
|---|
B pathways. Am J Physiol Cell Physiol 2003;284:C1397404.
release mediates neurotensin-stimulated MAP kinase activation in human colonic epithelial cells. J Biol Chem 2004;279:4354754.This article has been cited by other articles:
![]() |
Y. Heakal and M. Kester Nanoliposomal Short-Chain Ceramide Inhibits Agonist-Dependent Translocation of Neurotensin Receptor 1 to Structured Membrane Microdomains in Breast Cancer Cells Mol. Cancer Res., May 1, 2009; 7(5): 724 - 734. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Broet, S. Camilleri-Broet, S. Zhang, M. Alifano, D. Bangarusamy, M. Battistella, Y. Wu, M. Tuefferd, J.-F. Regnard, E. Lim, et al. Prediction of Clinical Outcome in Multiple Lung Cancer Cohorts by Integrative Genomics: Implications for Chemotherapy Selection Cancer Res., February 1, 2009; 69(3): 1055 - 1062. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Gong, L. Meng, B. Jiang, J. Zhang, H. Yang, J. Wu, and C. Shou p37 from Mycoplasma hyorhinis promotes cancer cell invasiveness and metastasis through activation of MMP-2 and followed by phosphorylation of EGFR Mol. Cancer Ther., March 1, 2008; 7(3): 530 - 537. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Wei and H. Li A Markov random field model for network-based analysis of genomic data Bioinformatics, June 15, 2007; 23(12): 1537 - 1544. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |