Cancer Research Versailles No Abst  Advances in Breast Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chao, C.-H.
Right arrow Articles by Wu Lee, Y.-H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chao, C.-H.
Right arrow Articles by Wu Lee, Y.-H.
[Cancer Research 66, 6579-6588, July 1, 2006]
© 2006 American Association for Cancer Research


Cell, Tumor, and Stem Cell Biology

DDX3, a DEAD Box RNA Helicase with Tumor Growth–Suppressive Property and Transcriptional Regulation Activity of the p21waf1/cip1 Promoter, Is a Candidate Tumor Suppressor

Chi-Hong Chao1, Chun-Ming Chen2, Pei-Lin Cheng1, Jing-Wen Shih1, Ann-Ping Tsou3 and Yan-Hwa Wu Lee1

1 Institute of Biochemistry and Molecular Biology, 2 Faculty of Life Sciences, and 3 Institute of Biotechnology in Medicine, National Yang-Ming University, Taipei, Taiwan, Republic of China

Requests for reprints: Yan-Hwa Wu Lee, Institute of Biochemistry and Molecular Biology, National Yang-Ming University, Taipei, Taiwan 112, Republic of China. Phone: 886-2-2826-7124; Fax: 886-2-2826-4843; E-mail: yhwulee{at}ym.edu.tw.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
DDX3 is a DEAD box RNA helicase with diverse biological functions. Using colony formation assay, our results revealed that DDX3 inhibited the colony formation ability of various tumor cells, and this inhibition might be due to a reduced growth rate caused by DDX3. Additionally, we identified p21waf1/cip1, a cyclin-dependent kinase inhibitor, as a target gene of DDX3, and the up-regulation of p21waf1/cip1 expression accounted for the colony-suppressing activity of DDX3. Moreover, DDX3 exerted its transactivation function on p21waf1/cip1 promoter through an ATPase-dependent but helicase-independent mechanism, and the four Sp1 sites located within the –123 to –63 region, relative to the transcription start site of p21waf1/cip1 promoter, were essential for the response to DDX3. Furthermore, DDX3 interacted and cooperated with Sp1 to up-regulate the promoter activity of p21waf1/cip1. To determine the relevance of DDX3 in clinical cancers, the expression profile of DDX3 in various tumors was also examined. A declined expression of DDX3 mRNA and protein was found in ~58% to 73% of hepatoma specimens, which led to the reduction of p21waf1/cip1 expression in a manner independent of p53 status. Additionally, an alteration of subcellular localization from nuclei to cytoplasm was also observed in >70% of cutaneous squamous cell carcinoma samples. Because DDX3 exhibits tumor suppressor functions, such as a growth-suppressive property and transcriptional activation of the p21waf1/cip1 promoter, and is inactivated through down-regulation of gene expression or alteration of subcellular localization in tumor cells, all these features together suggest that DDX3 might be a candidate tumor suppressor. (Cancer Res 2006; 66(13): 6579-88)


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
DDX3, also named as CAP-Rf (1) or DBX (2), is a hepatitis C virus core protein–associated cellular factor that belongs to the DEAD box RNA helicase family (1, 3, 4). DDX3 harbors nucleotide triphosphatase-deoxynucleotide triphosphatase activity (1), ATPase-dependent RNA helicase activity, and a nuclear-cytoplasmic shuttling localization function (5). However, the precise biological functions of DDX3 are still not fully understood. It has been reported that the yeast homologue of DDX3, Ded1, is essential for translation initiation (6), and DDX3 is able to rescue Ded1-deficient yeast mutants (4). Additionally, DDX3 has also been suggested to be involved in pre-mRNA splicing because of its association with functional spliceosome (7) and its possession of an RS-like domain (1). Recently, DDX3 has been reported to play a role in mRNA migration (8) and is required for HIV-1 Rev-RRE export function (5). Moreover, DDX3 is identified as a subunit of mammalian Mediator complex (9) and has a transcriptional activation function (1). These findings indicate a regulatory role for DDX3 in gene expression.

The cell cycle progression of eukaryotic cells is well controlled by cyclin, cyclin-dependent kinases (cdk), and cdk inhibitors. p21waf1/cip1 is one of the critical cdk inhibitors. Through interaction with the cdk/cyclin complexes, p21waf1/cip1 modulates their kinase activity, resulting in cell growth arrest (10). Additionally, p21waf1/cip1 also prevents DNA synthesis and regulates DNA replication through interaction with proliferating cell nuclear antigen (11). Therefore, p21waf1/cip1 may serve as a growth inhibitor and cell cycle checkpoint. In addition to the modulation of cell proliferation, p21waf1/cip1 is also involved in the regulation of apoptosis, differentiation, and stress response (11). Furthermore, although mutation of p21waf1/cip1 is uncommon in cancers (12), p21waf1/cip1-deficient mice show susceptibility to spontaneously or chemically induced tumor formation (1315). Hence, p21waf1/cip1 acts as a tumor suppressor.

Several factors have been reported to induce the expression of p21waf1/cip1 and the most important one is the tumor suppressor p53 (16). Additionally, p53-independent stimulation including certain extracellular signals, chemical drugs (17), and viral products (18, 19) also induce p21waf1/cip1 expression. The mechanism of p21waf1/cip1 induction caused by these factors often involves the action of corresponding transcription factors on the p21waf1/cip1 promoter (17). These transcription factors include signal transducers and activators of transcription, nuclear hormone receptors, Smad3, and the ubiquitous transcription factor Sp1. Sp1 binds to the GC-rich sequence on the proximal region of p21waf1/cip1 promoter and acts as a mediator for the induction of p21waf1/cip1 gene caused by transforming growth factor ß (TGF-ß; ref. 20) and several chemical drugs including mitogen-activated protein kinase inhibitor and histone deacetylase inhibitor (21, 22). Furthermore, Sp1 also interacts with other regulatory transcription factors of p21waf1/cip1 promoter physically and functionally (2325). Therefore, Sp1 plays a critical role in the regulation of p21waf1/cip1 promoter activity.

In this study, we have identified a tumor growth–suppressive property of DDX3. Additionally, we also identified p21waf1/cip1 as a downstream gene of DDX3. DDX3 enhances the expression of p21waf1/cip1 gene and up-regulates the promoter activity of p21waf1/cip1 through an ATPase-dependent but helicase-independent mechanism. The modulation of p21waf1/cip1 gene expression accounts for the growth-suppressive effect of DDX3. Moreover, our data also revealed that DDX3 transactivates the p21waf1/cip1 promoter through its multiple Sp1 sites, and DDX3 collaborates with Sp1 on p21waf1/cip1 promoter activation. Finally, we also showed that DDX3 expression was decreased in hepatocellular carcinoma (HCC) specimens, and the reduced expression of DDX3 might lead to a p53-independent decrease of p21waf1/cip1 expression. Additionally, an extensive loss of its nuclear localization was observed in cutaneous squamous cell carcinoma (SCC) compared with normal squamous cells. Together, our results show that DDX3 exerts tumor suppressor functions, including growth inhibition and transcriptional modulation of the promoter activity of p21waf1/cip1, and is inactivated through deregulated expression or nuclear exclusion in tumor cells. All these features strongly suggest that DDX3 might act as a tumor suppressor.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell lines and cultures. HuH-7 (human HCC), HepG2 (human hepatocellular blastoma), 293T (human embryonic kidney fibroblast), HeLa (human cervical cancer cells), NIH 3T3 (murine fibroblast), and HCT116 (human colon cancer) and its derived cell line HCT116 p21–/– (kindly provided by Dr. B. Vogelstein, Howard Hughes Medical Institute, Chevy Chase and the Sydney Kimmel Comprehensive Cancer Center of the Johns Hopkins University School of Medicine, Baltimore, MD; ref. 26) were grown in DMEM supplemented with 10% fetal bovine serum or bovine calf serum (NIH 3T3 cells; Invitrogen-Life Technologies Corp., Carlsbad, CA).

Plasmid construction. Plasmid p21-Luc was constructed by insertion of a 2.3-kb HindIII fragment (spanning the promoter region –2,325 to +8 related to transcription start site of human p21waf1/cip1 gene) from pWWP-Luc (16) into HindIII-treated GL2 vector (Promega Corp., Madison, WI). To construct the serial 5'-deleted p21waf1/cip1 promoter–driven luciferase reporters (–1,002/+8)p21-Luc, (–463/+8)p21-Luc, (–223/+8)p21-Luc, (–210/+8)p21-Luc, (–159/+8)p21-Luc, (–106/+8)p21-Luc, (–84/+8)p21-Luc, (–76/+8)p21-Luc, (–63/+8)p21-Luc, and (–56/+8)p21-Luc, HindIII/BglII–treated, PCR-amplified p21waf1/cip1 promoter fragments were ligated with HindIII/BglII–treated pGL2 vector. To construct the p21waf1/cip1 internal promoter region (nucleotide –127 to –63) deleted reporter plasmid (–2,325/+8){Delta}(–127/–63)p21-Luc, the p21-Luc construct was digested with ApaI, blunted, and then self-ligated. The p21waf1/cip1 promoter–driven luciferase reporters (pGL3 derivatives) containing point mutations in six Sp1 elements, (Mut1)p21-Luc, (Mut2)p21-Luc, (Mut3)p21-Luc, (Mut4)p21-Luc, and (Mut5/6)p21-Luc and the parental wild-type reporter, (Wt)p21-Luc, were kindly provided by Dr. D. Kardassis (Department of Basic Sciences, University of Crete Medical School, Heraklion, Crete, Greece; ref. 27). Other p21waf1/cip1 promoter–driven luciferase reporters containing multiple point mutations of the Sp1 sites or point mutation of the AP-2 and E2F responsive elements (Mut1/2)p21-Luc, (Mut3/4)p21-Luc, (Mut1/2/3)p21-Luc, (Mut2/3/4)p21-Luc, (Mut1/2/3/4)p21-Luc, (mAP-2-1)p21-Luc, (mAP2-2)p21-Luc, (mE2F(b)-1)p21-Luc, and (mE2F(b)-2)p21-Luc were generated using the QuickChange site-directed mutagenesis system (Stratagene, La Jolla, CA). To obtain the pcDNA-SR{alpha}/FLAG vector, pcDNA3-FLAG vector (Invitrogen Corp., Carlsbad, CA) was treated with HindIII and NruI to eliminate the cytomegalovirus promoter fragment, blunted, and then ligated with 0.8 kb of ClaI-treated and Klenow filled-in SR{alpha} promoter fragment from pSR{alpha} vector (28). The mammalian expression vector pcDNA-SR{alpha}/FLAG-DDX3 was constructed by insertion of a 2-kb EcoRI/ApaI–treated fragment of the DDX3 gene derived by reverse transcription-PCR (RT-PCR) into EcoRI/ApaI–treated pcDNA-SR{alpha}/FLAG vector. Plasmids pcDNA-SR{alpha}/FLAG-DDX3(AAA) and pcDNA-SR{alpha}/FLAG-DDX3(DQAD), which direct the expression of the DDX3 mutants harboring mutation of the SAT or DEAD motif, were constructed by changing the Ser382 and Thr384 residues to Ala and the Glu343 residue to Gln by the QuickChange site-directed mutagenesis system (Stratagene). To obtain pGEX-5x-1/DDX3(1-226), which expresses the glutathione S-transferase/DDX3(1-226) fusion protein in E. coli, an EcoRI/XhoI–treated PCR-amplified cDNA fragment encoding NH2-terminal 1-226 amino acid region of DDX3 was ligated with EcoRI/XhoI–treated pGEX-5x-1 vector (Amersham Pharmacia Biotech, Buckinghamshire, United Kingdom). Plasmids pMC2P/FLAG-Sp1 and pMC2P/FLAG-Sp3, which direct the expression of FLAG-Sp1 or FLAG-Sp3, were kindly provided by Dr. G. Suske (Philipps University, Marburg, Germany). The plasmid pcDNA-SR{alpha}/FLAG-Sp1 was generated by direct insertion of an EcoRI/ApaI–digested, PCR-amplified Sp1 cDNA fragment into EcoRI/ApaI–treated pcDNA-SR{alpha}-FLAG. The bacterial expression vector pGEX-5x-1/Sp1 was constructed by introducing an EcoRI/XhoI–treated Sp1 gene fragment into EcoRI/XhoI–treated pGEX-5x-1 vector. All of these constructs were verified by DNA sequencing.

Antibody preparation. To generate anti-DDX3 antibody, glutathione S-transferase fusion protein containing the NH2-terminal 1-226 amino acid fragment of DDX3 [GST/DDX3(1-226)] was used as antigen for immunization. Immunization and collection of antisera were done by the Custom Antibody Services of Protech Technology Enterprise Co., Ltd. (Taipei, Taiwan). Anti-DDX3 sera were depleted with purified GST protein before application to the immunohistochemistry analysis.

Colony formation assay. For the colony formation assay, HuH-7, HeLa, HCT116, and NIH 3T3 cells were transfected with pcDNA-SR{alpha}/FLAG-DDX3 or its parental empty vector by the calcium phosphate method or by Effectene (Qiagen, Hilden, Germany). Transfected cells were under G418 (Calbiochem; Merck Ltd., Darmstadt, Germany) selection (400 µg/mL for HuH-7 and HeLa cells, 600 µg/mL for HCT116 cells, and 900 µg/mL for NIH 3T3 cells) for 2 to 3 weeks. Colonies were fixed with methanol/acetone (1:1) and stained with crystal violet (1 mg/mL). To address the p21waf1/cip1-dependent inhibition on colony formation, HCT116 and HCT116 p21–/– cells were cotransfected with pSilencer 3.1-H1 puro (Ambion, Austin, TX) and pcDNA-SR{alpha}/FLAG-DDX3 or its parental vector by Effectene (Qiagen) and selected with puromycin (0.4 µg/mL) for 2 weeks.

Reporter assay. For the luciferase reporter assay, correct amounts of cells (HuH-7, HeLa, NIH 3T3, 293T, HCT116, and HepG2 cells) were transfected with an appropriate amount of reporter plasmid, p21-Luc, or its derivatives and either the empty parental vector or the DDX3 expression construct. The TK-Relina reporter (Promega) was also cotransfected for normalization of transfection efficiency. Transfected cells were harvested at 48 hours posttransfection and a dual luciferase assay was done according to the instruction of the manufacturer. The luciferase activity was measured with an AutoLumat LB953 luminometer (Berthold) and normalized with the cotransfected Relina activity.

Determination of growth rate in DDX3-producing stable clones. HuH-7 and HeLa cells were transfected with pcDNA-SR{alpha}/FLAG-DDX3 or parental vector pcDNA-SR{alpha}/FLAG and selected with G418 (400 µg/mL) for 3 to 4 weeks. Independent clones with exogenous DDX3 expression were isolated and maintained in G418 (400 µg/mL)-containing medium. To compare the growth rate between DDX3-producing cells and control cell lines, cells were seeded at a density of 1.0 x 105 onto 6-cm plates. At each 24-hour interval, the cells were collected, stained with trypan blue, and counted with a hemocytometer. At least two independent experiments were done.

In vitro pull-down assay. GST, GST/Sp1 fusion proteins were purified as previously described (29). For the in vitro GST pull-down assay, 20 µL of glutathione-Sepharose 4B beads (Amersham Pharmacia Biotech) with immobilized GST or GST/Sp1 fusion proteins (4 µg each) were incubated with HuH-7 whole-cell extracts (500 µg) at 4°C for 6 hours. The beads were extensively washed. Proteins bound to the beads were then analyzed by Western blotting using anti-DDX3 polyclonal antibody.

In vivo coimmunoprecipitation assay. For the coimmunoprecipitation experiments, HuH-7 cells transfected with pcDNA-SR{alpha}/FLAG-Sp1 were harvested and cell lysates were prepared using immunoprecipitation lysis buffer [20 mmol/L Tris-Cl (pH 7.5), 150 mmol/L NaCl, 10% glycerol, and 1% Triton X-100]. Cell extracts (1.5 mg) were incubated with 15 µL of anti-FLAG M2-agarose affinity gel (Sigma-Aldrich, St. Louis, MO). After extensive washing with immunoprecipitation lysis buffer, the immunoprecipitated proteins were analyzed by immunoblotting using specific antibodies against DDX3 and FLAG epitope (ab1257, Abcam, Cambridge, United Kingdom).

Cancer profiling array. The cancer-profiling array II (BD Biosciences Clontech, Palo Alto, CA) includes normalized cDNA from 154 tumor specimens and corresponding normal tissues from individual patient. To address the mRNA expression profile of DDX3 in these tissues, a 0.7-kb 32P-labeled cDNA probe spanning the 3'-coding region (400 bp) and 3'-untranslated region of DDX3 (300 bp) was generated by the Rediprime II probe labeling kit (Amersham Pharmacia Biotech) and used to probe the cancer profiling array according to the user instruction.

Quantitative real-time PCR. cDNAs prepared from 45 adjacent normal-tumor paired hepatoma samples were provided by different sources (30, 31) and used in quantitative RT-PCR assay. mRNA expression of DDX3 and p21waf1/cip1 in adjacent normal liver tissues and HCC samples was examined using quantitative real-time PCR (LightCycler FastStart DNA Master SYBR Green I, Roche Applied Science, Mannheim, Germany) according to the instruction manual using the primer set DDX3-4987F, TTCTCAGATGTTTGTTGTGTGGATT; DDX3-5142R, AAACTTGCTCAAATGCTATTGCTG; p21-F, AATCCCAGCTACTTGGAAGGC; and p21-R, GCTGACTGCAACCTCTGCC. Ribosomal protein S24 (RPS24) gene served as an internal control for quantitation using the primer set TGGCTTTGGCATGATTTATGAT and CTTTTTGCCAGCACCAACATT. Real-time detection of the emission intensity of SYBR Green was done with a LightCycler 2.0 instrument (Roche Applied Science). Each experiment was repeated in triplicate, including a no-template negative control.

Identification of p53 mutations in HCC specimens. To determine the p53 status in individual HCC samples, cDNA templates (1 µg) from 45 HCC samples were mixed with the primer set p53-1-F, ATGGAGGAGCCGCAGTCAG, and p53-1181-R, TCAGTCTGAGTCAGGCCCTTC, and high-fidelity Easy-A Hi-Fi PCR cloning enzyme (Stratagene) for PCR reactions. Full-length p53 cDNA fragments were subsequently cloned with pGEM-T easy vector system (Promega) to generate p53 constructs. At least 10 constructs of each individual HCC sample were sequenced and mutations appearing in more than five constructs were considered as somatic mutations of the p53 gene, not PCR-induced errors.

Tumor specimens. Tissue specimens were obtained commercially from different sources. Human hepatoma tissues were collected from Cybrdi (Frederick, MD; liver carcinoma tissue array, CC03-02-001), AccuMax (New York, NY; liver cancer tissues-hepatocellular carcinoma array, A204), and SuperBioChips Laboratories (Seoul, South Korea; human liver cancer array, CSA2). Human normal epidermis and cutaneous SCC samples were collected from SuperBioChips Laboratories (skin cancer array CX-1 and HA1 array). All of the tissue arrays are formalin-fixed, paraffin-embedded, and 4-µm-thick sections and are pathologically confirmed.

Immunohistochemistry. Tissue sections were placed in 10 mmol/L citric acid buffer (pH 6.0) and subjected to antigen retrieval by microwaving for 20 minutes after deparaffinization and rehydration. After incubation with 3% hydrogen peroxide for 10 minutes and 0.2% horse serum for 20 minutes, a 1:200 diluted rabbit anti-DDX3 polyclonal antibody was applied for 1 hour at room temperature and followed by incubation with biotinylated linker and streptavidin-horseradish peroxidase (LSAB2 system-HRP, DAKO Cytomation, Carpinteria, CA) for 30 and 10 minutes, respectively. The signals were visualized using AEC+ (DAKO Cytomation) as the substrate-chromagen at room temperature for 13 minutes. Sections were counterstained with hematoxylin and mounted. A semiquantitative evaluation was used to score the immunoreactivity. For analysis of the normal-tumor paired HCC samples, the staining intensity was compared directly between the tumor part and the normal part. Assessment of the DDX3 staining in the normal skin and cutaneous SCC specimens was done in two ways. Specifically, the percentage of nuclear immunoreactive cells was graded into five categories: 0% to 10% cells stained, 11% to 25% cells stained, 26% to 50% cells stained, 51% to 75% cells stained, and 76% to 100% cells stained. The intensity of nuclear staining was divided into four levels: negative, slight, moderate, and strong. In addition, a {chi}2 test was used to analyze the loss of nuclear localization in SCC specimens. Differences with P < 0.05 were accepted as statistically significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
DDX3 exerts an inhibitory effect on cell growth. To explore the biological function of DDX3 on cell growth control, a colony formation assay was done in several tumor cell lines (HuH-7, HCT116, and HeLa) and normal murine fibroblast cells (NIH 3T3) under the selection of G418. As shown in Fig. 1A , forced expression of DDX3 inhibited colony formation activity of HuH-7 and NIH 3T3 cells in a dose-dependent manner and a strong suppression of colony formation was also observed in HeLa and HCT116 cells. This inhibition of colony formation was due to the growth-suppressive ability of DDX3 on tumor cells but was not a result of the inhibitory effect of DDX3 on the expression of G418 resistance gene because DDX3 up-regulated, but not down-regulated, the SV40 early promoter that directs G418 resistance gene expression (data not shown). Moreover, we also established DDX3-overproducing clones in HuH-7 and HeLa cells (Fig. 1B, top) and determined their growth rates by cell counting. As shown in Fig. 1B (bottom), the growth rates of DDX3-overproducing clones, including HuH-7/DDX3#6, HuH-7/DDX3#7, HuH-7/DDX3#8, HeLa/DDX3#9, and HeLa/DDX3#14, were much slower than the control cell line harboring parental vector without DDX3. This may account for the inhibition of colony formation by DDX3. Taken together, these results indicate that DDX3 is a negative regulator of cell growth control.


Figure 1
View larger version (29K):
[in this window]
[in a new window]
 
Figure 1. Ectopic expression of DDX3 inhibits cell growth. A, DDX3 inhibited the colony formation ability of several tumor and normal murine fibroblast cells. HuH-7, HeLa, HCT116, or NIH 3T3 cells were transfected with parental vector or FLAG-DDX3 expression plasmid at the indicated amount by the Effectene or calcium phosphate method (see Materials and Methods). The total amount of transfected DNA was kept constant by adding control vector. Transfected cells were selected with G418 for 2 to 4 weeks. Colonies were then fixed, stained with crystal violet, and counted. In all cases, the relative colony number in the absence of FLAG-DDX3 transfection was arbitrarily assigned as one. Results were derived from at lease three independent experiments done in triplicate. B, top, expression levels of DDX3 in various DDX3-overexpressing HuH-7 and HeLa cell lines and parental cells were examined by immunoblotting with anti-DDX3 specific antibody. Bottom, different clones of DDX3-overproducing cells were seeded and the numbers of viable cells were counted at various time intervals (see Materials and Methods). Results were derived from at least two independent experiments done in triplicate.

 
DDX3 up-regulates the p21waf1/cip1 gene expression and inhibits the colony formation activity of tumor cells in a p21waf1/cip1-dependent manner. Recently, several RNA helicases, such as RNA helicase A and CHAMP, have been shown to modulate the expression of cell cycle regulator p16INK4a or p21waf1/cip1 (32, 33). To address the mechanism of growth inhibition by DDX3, we examined whether the promoter activity and the expression level of the cell cycle regulator p21waf1/cip1 are regulated by DDX3. As shown in Fig. 2A , exogenous expression of DDX3 in various cell lines led to a 2- to 4-fold up-regulation of p21waf1/cip1 promoter–driven luciferase activity. Additionally, Western blot analysis indicated that the expression level of p21waf1/cip1 gene was also enhanced by the ectopic expression of DDX3 in HuH-7, HeLa, and 293T cells (Fig. 2B). Because DDX3 up-regulates the promoter activity and the expression level of p21waf1/cip1 gene without cell type specificity, this suggests that DDX3 acts as a general regulator of p21waf1/cip1 gene expression.


Figure 2
View larger version (34K):
[in this window]
[in a new window]
 
Figure 2. p21waf1/cip1 is a target gene of DDX3. A, DDX3 up-regulates the p21waf1/cip1 promoter activity. p21waf1/cip1 promoter–driven luciferase reporter (p21-Luc; 0.05-0.5 µg) and increasing amount (0.1-2 µg) of FLAG-DDX3 expression construct were cotransfected into various cell lines as indicated. The total amount of transfected DNA was kept constant by adding control vector (pcDNA3-SR{alpha}/FLAG). Luciferase activity was measured at 48 hours posttransfection. In all cases, the relative luciferase activity shown is presented as fold activation relative to the control transfection and is derived from at least three independent experiments done in triplicate. B, the expression of endogenous p21waf1/cip1 is enhanced by forced expression of DDX3. HuH-7, HeLa, and 293T cells were transfected with increasing amount (10 or 20 µg) of FLAG-DDX3 expression plasmid. After 48 hours of transfection, cell extracts were prepared and the expression level of FLAG-DDX3, p21waf1/cip1, and {alpha}-actin was detected by immunoblotting with anti-FLAG, anti-p21waf1/cip1, and anti-{alpha}-actin (Santa Cruz Biotechnology, Santa Cruz, CA) antibodies. The expression level of {alpha}-actin was served as a loading control. C, DDX3 exerts the colony suppressive effect through a p21waf1/cip1-dependent mechanism. HCT116 and HCT116 p21–/– cells were cotransfected with pSilencer 3.1-H1 puro and pcDNA-SR{alpha}/FLAG-DDX3 (FLAG-DDX3) or its parental vector at indicated amount by Effectene and selected with puromycin for 14 days. Colonies were fixed, stained with crystal violet, and the colony number was counted. Relative colony number in the absence of FLAG-DDX3 transfection was arbitrarily assigned as one. Results were derived from at lease two independent experiments done in triplicate.

 
To address the essential role of p21waf1/cip1 in DDX3-mediated colony-suppressing activity, a colony formation assay was also carried out in HCT116 and its derived cell line HCT116 p21–/– that is deficient in p21waf1/cip1 expression. As shown in Fig. 2C, forced expression of DDX3 in HCT116 cells led to an 85% reduction of colony formation, whereas in HCT116 p21–/– cells this DDX3-mediated suppression of colony formation was dramatically decreased to 20%. This result strongly suggests that DDX3 exerts its suppressing activity on colony formation in a p21waf1/cip1-dependent manner.

The ATPase activity, but not the helicase activity, of DDX3 contributes to DDX3-mediated transcriptional modulation on the p21waf1/cip1 promoter. Because DDX3 harbors ATPase and RNA unwinding activities, we are interested to know whether these two enzymatic activities are required for the transcriptional regulatory effect of DDX3 on p21waf1/cip1 promoter. To address this issue, we generated mutations within the DEAD box or SAT motif. The conversion of DEAD motif to DQAD sequence impairs both ATPase activity and ATPase-dependent helicase activity (34). On the other hand, a point mutation of the SAT motif to AAA sequence leads to a loss of RNA unwinding activity but retains the ATPase activity of the helicase (34). Using these two mutants, we are able to distinguish which activity is required for the transcriptional activation of DDX3 on p21waf1/cip1 promoter. To this end, increasing amounts of expression constructs of DDX3/DQAD, DDX3/AAA and wild-type DDX3 were cotransfected with p21waf1/cip1 promoter–driven luciferase reporter. Interestingly, our data revealed that at a higher dosage (2 µg/well), the wild-type DDX3 and mutant DDX3/AAA up-regulated the activity of p21waf1/cip1 promoter ~12-fold whereas the DDX3/DQAD mutant only activated the p21waf1/cip1 promoter activity ~5-fold (Supplementary Fig. S1). Because a similar expression level of these three DDX3 expression constructs was detected (data not shown), their differential induction of p21waf1/cip1 promoter activity suggests that the ATPase activity, but not the RNA helicase activity, contributes to the transcriptional activation of DDX3 on the p21waf1/cip1 promoter.

DDX3 transactivates the p21waf1/cip1 promoter through multiple Sp1 sites. Next, to examine the underlying mechanism by which DDX3 activates the p21waf1/cip1 promoter, we mapped the DDX3 responsive region within the p21waf1/cip1 promoter by serial 5'-deleted promoter-driven luciferase reporters (Fig. 3A and Supplementary Fig. S2A). The results suggested that the levels of activation induced by DDX3 of the luciferase activity of serial reporter constructs from (–1,002/+8)p21-Luc to (–123/+8)p21-Luc were comparable with the level of activation elicited by the full-length promoter-driven reporter p21-Luc (5- to 10-fold; Fig. 3B and Supplementary Fig. S2B). However, this DDX3-induced activation was dramatically decreased in reporter (–84+8)p21-Luc and (–76/+8)p21-Luc by ~2- to 3-fold and was completely lost in (–63/+8)p21-Luc and (–56/+8)p21-Luc reporters (Fig. 3B). This observation suggested that the DDX3 responsive region within the p21waf1/cip1 promoter was located between –123 to –63 upstream of the transcription start site. This conclusion is further supported by another reporter assay, which was directed by a p21waf1/cip1 promoter lacking the –127 to –63 nucleotide region (Fig. 3C).


Figure 3
View larger version (27K):
[in this window]
[in a new window]
 
Figure 3. Multiple Sp1 sites (Sp1-1, Sp1-2, Sp1-3, and Sp1-4) located at –123 to –63 related to transcription start site are essential for the transactivation of DDX3 on p21waf1/cip1 promoter. A, schematic representation of serial p21waf1/cip1 promoter–driven luciferase reporters used in transactivation assay: p21-Luc contains the 2.3-kb full-length of p21waf1/cip1 promoter (from –2,326 to +10 nucleotide related transcription start site); its derivatives (–159/+8)p21-Luc, (–123/+8)p21-Luc, (–84/+8)p21-Luc, (–76/+8)p21-Luc, (–63/+8)p21-Luc, and (–56/+8)p21-Luc contain a series of deleted promoters of p21waf1/cip1. (–2,326/+8){Delta}(–127/–63)p21-Luc is also a derivative of p21-Luc reporter containing the full-length p21waf1/cip1 promoter lacking –127 to –63 region. B and C, HuH-7 cells were cotransfected with a p21waf1/cip1 promoter–driven reporter (p21-Luc) or its derivatives represented in (A) (0.25 µg of each) together with DDX3 expression construct (pcDNA3-SR{alpha}/FLAG-DDX3) or control vector (pcDNA3-SR{alpha}/FLAG; 2 µg). Luciferase assay was done at 48 hours posttransfection. The fold transactivation of the various p21waf1/cip1 promoter–directed reporter constructs by DDX3 is shown as fold activation relative to the control transfection and is derived from at lease three independent experiments done in triplicate. D, analysis of the transactivation effect of DDX3 on p21waf1/cip1 promoters mutated at multiple Sp1 elements. Top, schematic representation of generated mutations within DDX3 responsive region of the human p21waf1/cip1 promoter. Nucleotide substitutions introduced into the regulatory elements of p21waf1/cip1 promoter region in mutant constructs are shown in boldface and underlined. The DDX3-mediated transactivation of p21waf1/cip1 promoter driven by mutant constructs defective in two Sp1 sites (MUT1/2 and MUT3/4), three Sp1 sites (MUT1/2/3 and MUT2/3/4), or four Sp1 sites (MUT1/2/3/4) was measured as described in (B and C).

 
As noted, several regulatory elements including six Sp1 sites, two E2F sites, and one AP-2 site reside within the DDX3 responsive region of the p21waf1/cip1 promoter (17). To delineate which element is essential for the transactivation of DDX3 on p21waf1/cip1 promoter, p21waf1/cip1 promoter–directed reporter plasmids harboring single mutation within Sp1-1, Sp1-2, Sp1-3, Sp1-4, Sp1-5/6, E2F(b)-1, E2F(b)-2, and AP-2 sites (see Supplementary Fig. S3A) were assayed for luciferase activity in the presence or absence of DDX3. Interestingly, our data indicated that the induction of reporters destroying AP-2, E2F, and each individual Sp1 site was comparable with that of wild-type reporter (Supplementary Fig. S3B and C). However, for those reporters harboring more than two Sp1 sites mutations, the DDX3-mediated induction of reporter activity was decreased compared with the wild-type reporter, and this decreased level was proportional to the numbers of Sp1 sites destroyed (Fig. 3D). All together, our results indicate that DDX3 transactivates p21waf1/cip1 promoter through multiple Sp1 sites.

Functional cooperation and physical interaction between DDX3 and Sp1. It is well known that Sp1 and Sp3 can transactivate the p21waf1/cip1 promoter through Sp1 sites (35). To examine whether DDX3 transactivates the p21waf1/cip1 promoter activity through Sp1 site-interacting proteins, the Sp1 or Sp3 expression plasmid together with the DDX3 expression construct and the p21waf1/cip1 promoter–driven luciferase reporter were introduced into HuH-7 cells. As shown in Fig. 4A , transient expression of DDX3 alone resulted in a 4-fold activation of p21waf1/cip1 promoter activity whereas transiently expressed Sp1 or Sp3 of increasing amount led to a 1.6- to 1.8-fold activation of the p21waf1/cip1 promoter. Interestingly, the induction effect of DDX3 on the p21waf1/cip1 promoter was increased to 10-fold when coexpressing with Sp1; however, this coactivation effect was not found when coexpressing with Sp3 (Fig. 4A). This result strongly suggests that Sp1, but not Sp3, is involved in the transcriptional regulation of DDX3 at the p21waf1/cip1 promoter.


Figure 4
View larger version (20K):
[in this window]
[in a new window]
 
Figure 4. DDX3 interacts with Sp1 physically and functionally. A, functional interaction between DDX3 and Sp1 on p21waf1/cip1 promoter. HuH-7 cells were cotransfected with FLAG-DDX3, FLAG-Sp1, FLAG-Sp3 expression construct, and p21-Luc reporter as indicated. The total amount of plasmid DNA was kept constant (2.25 µg) by the addition of empty vector in each transfection. The luciferase assay was done at 48 hours posttransfection. The fold transactivation of the p21waf1/cip1 promoter–driven reporter elicited by DDX3 alone or together with Sp1 or Sp3 is presented as fold activation relative to the control transfection and is derived from at lease three independent experiments done in triplicate. B, DDX3 interacts with Sp1 in vitro. GST and GST-Sp1 fusion proteins were purified and analyzed by SDS-PAGE and Coomassie blue staining (bottom). Asterisk, purified GST-Sp1 fusion protein. Total cell lysates of HuH-7 cells were incubated with GST or GST-Sp1 fusion protein–prebound glutathione-Sepharose 4B beads and the bound fractions were subjected to immunoblotting with antibody against DDX3 (top). Lane 1, input control (10% of cell extract without any treatment). C, Sp1 interacts with DDX3 in vivo. HuH-7 cells were transfected with 20 µg of FLAG-Sp1 expression construct (lanes 2 and 4). HuH-7 cell extracts (lane 3) or FLAG-Sp1-containing cell extracts (lane 4; 1.5 mg each) were immunoprecipitated with anti-FLAG antibody–conjugated beads and the immunoprecipitates were analyzed by SDS-PAGE followed by immunoblotting with anti-FLAG antibody or anti-DDX3 antibody. Lane 1, input control for mock transfection; lane 2, input control for FLAG-Sp1 expression construct transfected cells.

 
The functional cooperation between DDX3 and Sp1 proteins strongly implies the physical interactions of these two factors. To test this possibility, an in vitro GST fusion protein pull-down assay was done. As shown in Fig. 4B, endogenous DDX3 protein was pull downed by GST-Sp1 but not by GST control beads, suggesting a specific interaction between DDX3 and Sp1 in vitro. The in vivo interaction between DDX3 and Sp1 was further examined by a coimmunoprecipitation assay. As shown in Fig. 4C, transiently expressed FLAG-Sp1 and endogenous DDX3 were coimmunoprecipitated by anti-FLAG antibody, suggesting that DDX3 could interact with Sp1 in vivo. Thus, the in vitro and in vivo binding analyses clearly show that there is an interaction between DDX3 and the transcription factor Sp1.

The expression or subcellular localization of DDX3 is altered in tumor cells. Because DDX3 exhibits tumor suppressor functions, it is interesting to know whether DDX3 is inactivated in tumor cells by alteration of gene expression. To address this issue, a DDX3-specific DNA probe was hybridized against the cancer-profiling array II (see Materials and Methods). Interestingly, the mRNA expression of DDX3 was declined in the liver tumor specimens (three of three samples) and SCC of the vulva (three of five samples; Supplementary Fig. S4). To further confirm the alteration of DDX3 expression in cancer specimens, the expression profiles of DDX3 were examined in normal-tumor paired HCC samples by immunohistochemical staining analysis using specific anti-DDX3 antibody. As shown in Fig. 5A , decreased expression of DDX3 at the protein level was found in 73% of HCC from 26 patients. Additionally, the mRNA expression of DDX3 was also examined by quantitative RT-PCR, and our data revealed that the DDX3 mRNA level was reduced in 57.8% of 45 HCC specimens (Fig. 5A and B). These results clearly indicate that the expression of DDX3 is down-regulated in liver tumor cells. Furthermore, we also delineated the relationship between DDX3 and p21waf1/cip1 mRNA expression in these HCC cases by quantitative RT-PCR (Fig. 5B). Our result showed that, among 26 cases with decreased DDX3 expression status, 20 cases (77%) also showed simultaneous p21waf1/cip1 down-regulation, and the correlation between the expression status of DDX3 and p21waf1/cip1 was statistically significant (P = 0.039; Fig. 5C). Notably, a positive correlation between the mRNA expression levels of DDX3 and p21waf1/cip1 in 45 HCC specimens was also found by linear regression analysis (r = 0.501, P < 0.001; Fig. 5D). Most interestingly, among those 20 cases with DDX3 and p21waf1/cip1 reduced status, 13 cases harbored wild-type p53 and 7 had p53 mutation (Fig. 5B). Thus, it seems that the decreased DDX3 expression in HCC samples leads to a reduction of p21waf1/cip1 expression irrespective of p53 status.


Figure 5
View larger version (44K):
[in this window]
[in a new window]
 
Figure 5. The expression of DDX3 is altered in HCC. A, top, immunohistochemical staining of DDX3 in HCC and paired adjacent normal liver tissues. DDX3 was labeled with specific antibody (red stain) and nuclei were counterstained with hematoxylin (blue color). N, normal liver tissue; T, tumor. Bottom, DDX3 expression in HCC specimens. Expression levels of DDX3 mRNA in HCC samples as shown in (B) are classified into unchanged, decreased, and enhanced categories. At least 25% decrease or 2-fold increase in expression fold is considered as decreased or enhanced status, respectively. Protein expression levels of DDX3 analyzed by immunohistochemical staining are also subjected to similar classification (see Materials and Methods). B, DDX3, p21waf1/cip1 mRNA expression, and p53 status in HCC. The mRNA expression profile of DDX3 and p21waf1/cip1 in 45 normal-tumor paired HCC samples was determined by quantitative real time-PCR (see Materials and Methods) and is shown as fold expression relative to its corresponding normal tissue. The p53 status in HCC samples was determined as described in Materials and Methods. C, significant correlation between the mRNA expression status of DDX3 and p21waf1/cip1 in 45 HCC specimens. D, a positive correlation between the mRNA expression levels of DDX3 and p21waf1/cip1 in 45 HCC cases is found by linear regression analysis. P < 0.05 is considered significant.

 
Next, the expression of DDX3 in SCC patients was examined. Several cutaneous SCC and their matched normal skin specimens were stained with DDX3 antibody. Our results revealed that among the DDX3-positive cells of normal epidermis, DDX3 was localized mainly in the nuclei and less in the cytoplasm (Fig. 6A ). In contrast, in SCC cells, the nuclear distribution of DDX3 was significantly decreased or completely absent, and DDX3 was predominantly detected in the cytosolic compartments instead (Fig. 6A). To further confirm this observation, the intensity of nuclear staining and the percentage of nuclear positive cells obtained from immunohistochemistry analysis of 17 normal epidermis and 34 SCC specimens were analyzed statistically. As shown in Fig. 6B, both the nuclear staining intensity of DDX3 and the percentage of cells positive in DDX3 nuclear staining were much higher in normal epidermis as compared with neoplastic squamous cells (normal versus SCC, 94% versus 18% cases for strong and moderate grade intensity; 94% versus 12% cases with >50% DDX3 nuclear staining positive cells; P < 0.001). This observation indicates that the loss of DDX3 nuclear localization is a frequent event in cutaneous SCC. Together, our results suggest that the decreased expression or loss of nuclear localization of DDX3 may play a regulatory role in the formation of liver tumor and cutaneous SCC.


Figure 6
View larger version (78K):
[in this window]
[in a new window]
 
Figure 6. The nuclear localization of DDX3 is altered in SCC. A, immunohistochemical staining of DDX3 in cutaneous SCC and paired normal skin. DDX3 was strongly immunolocalized in the nucleus and less intensively in the cytosol of squamous cells in normal skin, but the nuclear staining was lost or dramatically decreased in cutaneous SCC. N, normal skin; T, cutaneous SCC. B, DDX3 nuclear staining in normal and neoplastic squamous tissues of skin. The intensity of DDX3 nuclear staining and the percentage of DDX3 nuclear staining positive cells in normal skin and cutaneous SCC tissues are summarized.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
DEAD box RNA helicases participate in disparate cellular functions (36). Here, we have shown by a colony formation assay that DDX3 RNA helicase harbors a growth-suppressive property. Forced expression of DDX3 leads to the suppression of colony formation activity of HCC, cervical carcinoma, colon cancer, and murine fibroblast cells (see Fig. 1A). Furthermore, the growth rate is delayed by ectopic expression of DDX3 (see Fig. 1B). These results support the notion that DDX3 plays a negative role in growth regulation.

In this study, we also identify p21waf1/cip1 as a target gene of DDX3, and the up-regulation of p21waf1/cip1 expression is linked to the growth-suppressive effect exerted by DDX3 (see Fig. 2). DDX3 enhances p21waf1/cip1 gene expression through up-regulation of promoter activity of p21waf1/cip1. Because the activation of p21waf1/cip1 promoter activity was shown in various cell lines with diverse p53 status (p53 wild-type in HepG2, HCT116, and NIH 3T3; p53 mutation in HuH-7; p53 degraded by human papillomavirus E7 in HeLa; p53 inactivated by SV40 large T antigen in 293T), this DDX3-mediated up-regulation on p21waf1/cip1 promoter seems to be p53 independent. Supporting this notion is the fact that the DDX3-induced activation level of serial 5'-deleted p21waf1/cip1 promoter–directed reporters that lack two p53 responsive elements (at the –2,301 and –1,394 nucleotide region upstream of the transcription start site; ref. 17) is comparable with the full-length p21waf1/cip1 promoter–driven reporter, p21-Luc (see Supplementary Fig. S2B). Moreover, in this work, the DDX3-responsive region is delineated to 60 bp (between –123 and –63) of the p21waf1/cip1 proximal promoter region (see Fig. 3B), and the integrity of multiple tandem Sp1 sites in this region is required for the activation induced by DDX3 (see Fig. 3C). This requirement of multiple Sp1 sites to confer DDX3-mediated transactivation of the p21waf1/cip1 promoter is different from other stimuli targeting to this GC-rich responsive region of the p21waf1/cip1 promoter. For example, TGF-ß and lovastatin target to the Sp1-3 site (17) whereas both of Sp1-3 and Sp1-4 sites are required for the action of the histone deacetylase inhibitor suberoylanilide hydroxamic acid (22). Most interestingly, our data also reveal that, like other p21waf1/cip1 promoter–regulating factors acting on this GC-rich responsive region, such as Smad3 (24), KLF6 (37), and c-Myc (38), DDX3 up-regulates p21waf1/cip1 promoter through physical interaction with Sp1 (see Fig. 4).

Recently, several RNA helicases involving in transcriptional regulation have been reported. They may exert a transcriptional function or act as comodulators for other transcription factors. However, whether the enzymatic activities of the RNA helicase (ATP hydrolysis and RNA unwinding) are required or contribute to the transcriptional modulation depends on individual case (3943). Moreover, although several studies addressed the involvement of enzyme activity in the transcriptional regulation activities of certain RNA helicases, most of them do not distinguish precisely which activity is involved. For example, an ATPase- and/or helicase-dependent mechanism is essential for RNA helicase A–mediated transactivation function (41) and the functional interaction with nuclear factor {kappa}B (42). This requirement also exists in functional interaction between RNA helicase DP103 and SF-1 (40). In our case, we show that the ATPase activity, but not the helicase activity, contributes to the DDX3-mediated transactivation (see Supplementary Fig. S1). Thus, a dual mechanism including the involvement of ATP hydrolysis and recruitment of other transcription factors (e.g., Sp1) would seem to occur with DDX3-mediated transcriptional regulation.

Because DDX3 harbors growth-suppressive ability and transcriptional modulation activity of the p21waf1/cip1 promoter, in this work we further examined the deregulated expression of DDX3 in tumors by a cancer profiling array and immunohistochemical staining analysis. Our results clearly indicate that the expression of DDX3 is decreased in HCC and the subcellular localization of DDX3 is altered in cutaneous SCC (see Figs. 5 and 6). Cutaneous SCC is a clinically aggressive cancer, and the inactivation of p21waf1/cip1 has been shown to play a critical role in the formation of skin tumor in knockout mice models (14, 15). Because DDX3 harbors a dominant nuclear localization in normal squamous cells and exerts a transactivation function on p21waf1/cip1 promoter, presumably the inactivation of transcriptional modulation function of DDX3 through cytoplasmic mislocalization is relevant to the deregulation of cell growth in cancerous squamous cells.

Recently, Huang et al. (44) have reported that the mRNA expression of DDX3 is up-regulated in HCC, and they considered DDX3 to be a promoter for hepatocarcinogenesis. However, according to our present study and recent report (45), both the mRNA and protein expressions of DDX3 are down-regulated in 58% to 73% of HCC specimens (see Fig. 5A). Furthermore, a tendency that DDX3 may regulate p21waf1/cip1 expression independently from p53 is also noted in HCC specimens (see Fig. 5B-D). This observation is consistent with our in vitro studies (see Figs. 2 and 3), which indicate that DDX3 up-regulates p21waf1/cip1 promoter activity in a p53-independent manner. Taking into account that it acts as a positive regulator of p21waf1/cip1 expression and has growth-suppressive ability on liver cancer cells, presumably DDX3 is a candidate tumor suppressor gene in liver. Support for this notion comes from several studies that have indicated the involvement of the p21waf1/cip1 inactivation in hepatocellular carcinogenesis (46, 47).

During the multistep process of carcinogenesis, decreased expression of tumor suppressors is often caused by epigenetic modification or abnormal degradation (48, 49). Additionally, alterations of subcellular localization through aberrant splicing or genetic mutations also provide ways to inactivate tumor suppressor genes (50). In view of these, further work to delineate the deregulation of DDX3 expression or localization will shed light on diverse mechanisms for inactivation of DDX3 in different cancers. In conclusion, our study characterizes the biological function of DDX3 as a putative candidate tumor suppressor gene, at least in HCC and cutaneous SCC. Most importantly, due to the universal tumor growth–suppressive property of this gene in various kinds of neoplasm regardless of p53 status, DDX3 is a potential therapeutic target for gene therapy.


    Acknowledgments
 
Grant support: National Science Council grants NSC-91-2320-B-010-072MH, NSC-92-2320-B-010-014MH, and NSC-93-2320-B-010-049MH and National Health Research Institute grants NHRI-EX94-9002BL and NHRI-EX95-9501BI (Y-H. Wu Lee).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Drs. D. Kardassis, G. Suske, B. Vogelstein, Y.M. Chen, and T.S. Su for generously providing experimental materials used in this study, and Dr. R. Kirby for critical reading and comments on this manuscript.


    Footnotes
 
Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/).

Received 7/11/05. Revised 2/28/06. Accepted 4/ 3/06.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. You LR, Chen CM, Yeh TS, et al. Hepatitis C virus core protein interacts with cellular putative RNA helicase. J Virol 1999;73:2841–53.[Abstract/Free Full Text]
  2. Lahn BT, Page DC. Functional coherence of the human Y chromosome. Science 1997;278:675–80.[Abstract/Free Full Text]
  3. Owsianka AM, Patel AH. Hepatitis C virus core protein interacts with a human DEAD box protein DDX3. Virology 1999;257:330–40.[CrossRef][Medline]
  4. Mamiya N, Worman HJ. Hepatitis C virus core protein binds to a DEAD box RNA helicase. J Biol Chem 1999;274:15751–6.[Abstract/Free Full Text]
  5. Yedavalli VS, Neuveut C, Chi YH, Kleiman L, Jeang KT. Requirement of DDX3 DEAD box RNA helicase for HIV-1 Rev-RRE export function. Cell 2004;119:381–92.[CrossRef][Medline]
  6. Chuang RY, Weaver PL, Liu Z, Chang TH. Requirement of the DEAD-Box protein ded1p for messenger RNA translation. Science 1997;275:1468–71.[Abstract/Free Full Text]
  7. Zhou Z, Licklider LJ, Gygi SP, Reed R. Comprehensive proteomic analysis of the human spliceosome. Nature 2002;419:182–5.[CrossRef][Medline]
  8. Kanai Y, Dohmae N, Hirokawa N. Kinesin transports RNA: isolation and characterization of an RNA-transporting granule. Neuron 2004;43:513–25.[CrossRef][Medline]
  9. Sato S, Tomomori-Sato C, Parmely TJ, et al. A set of consensus mammalian mediator subunits identified by multidimensional protein identification technology. Mol Cell 2004;14:685–91.[CrossRef][Medline]
  10. Sherr CJ, Roberts JM. CDK inhibitors: positive and negative regulators of G1-phase progression. Genes Dev 1999;13:1501–12.[Free Full Text]
  11. Dotto GP. p21(WAF1/Cip1): more than a break to the cell cycle? Biochim Biophys Acta 2000;1471:M43–56.[Medline]
  12. Shiohara M, el-Deiry WS, Wada M, et al. Absence of WAF1 mutations in a variety of human malignancies. Blood 1994;84:3781–4.[Abstract/Free Full Text]
  13. Jackson RJ, Adnane J, Coppola D, Cantor A, Sebti SM, Pledger WJ. Loss of the cell cycle inhibitors p21(Cip1) and p27(Kip1) enhances tumorigenesis in knockout mouse models. Oncogene 2002;21:8486–97.[CrossRef][Medline]
  14. Martin-Caballero J, Flores JM, Garcia-Palencia P, Serrano M. Tumor susceptibility of p21(Waf1/Cip1)-deficient mice. Cancer Res 2001;61:6234–8.[Abstract/Free Full Text]
  15. Topley GI, Okuyama R, Gonzales JG, Conti C, Dotto GP. p21(WAF1/Cip1) functions as a suppressor of malignant skin tumor formation and a determinant of keratinocyte stem-cell potential. Proc Natl Acad Sci U S A 1999;96:9089–94.[Abstract/Free Full Text]
  16. el-Deiry WS, Tokino T, Velculescu VE, et al. WAF1, a potential mediator of p53 tumor suppression. Cell 1993;75:817–25.[CrossRef][Medline]
  17. Gartel AL, Tyner AL. Transcriptional regulation of the p21(WAF1/CIP1) gene. Exp Cell Res 1999;246:280–9.[CrossRef][Medline]
  18. Park US, Park SK, Lee YI, Park JG, Lee YI. Hepatitis B virus-X protein up-regulates the expression of p21waf1/cip1 and prolongs G1->S transition via a p53-independent pathway in human hepatoma cells. Oncogene 2000;19:3384–94.[CrossRef][Medline]
  19. Wu FY, Chen H, Wang SE, et al. CCAAT/enhancer binding protein {alpha} interacts with ZTA and mediates ZTA-induced p21(CIP-1) accumulation and G(1) cell cycle arrest during the Epstein-Barr virus lytic cycle. J Virol 2003;77:1481–500.[Medline]
  20. Datto MB, Yu Y, Wang XF. Functional analysis of the transforming growth factor ß responsive elements in the WAF1/Cip1/p21 promoter. J Biol Chem 1995;270:28623–8.[Abstract/Free Full Text]
  21. De Siervi A, Marinissen M, Diggs J, Wang XF, Pages G, Senderowicz A. Transcriptional activation of p21(waf1/cip1) by alkylphospholipids: role of the mitogen-activated protein kinase pathway in the transactivation of the human p21(waf1/cip1) promoter by Sp1. Cancer Res 2004;64:743–50.[Abstract/Free Full Text]
  22. Huang L, Sowa Y, Sakai T, Pardee AB. Activation of the p21WAF1/CIP1 promoter independent of p53 by the histone deacetylase inhibitor suberoylanilide hydroxamic acid (SAHA) through the Sp1 sites. Oncogene 2000;19:5712–9.[CrossRef][Medline]
  23. Koutsodontis G, Tentes I, Papakosta P, Moustakas A, Kardassis D. Sp1 plays a critical role in the transcriptional activation of the human cyclin-dependent kinase inhibitor p21(WAF1/Cip1) gene by the p53 tumor suppressor protein. J Biol Chem 2001;276:29116–25.[Abstract/Free Full Text]
  24. Pardali K, Kurisaki A, Moren A, ten Dijke P, Kardassis D, Moustakas A. Role of Smad proteins and transcription factor Sp1 in p21(Waf1/Cip1) regulation by transforming growth factor-ß. J Biol Chem 2000;275:29244–56.[Abstract/Free Full Text]
  25. Lu S, Jenster G, Epner DE. Androgen induction of cyclin-dependent kinase inhibitor p21 gene: role of androgen receptor and transcription factor Sp1 complex. Mol Endocrinol 2000;14:753–60.[Abstract/Free Full Text]
  26. Waldman T, Kinzler KW, Vogelstein B. p21 is necessary for the p53-mediated G1 arrest in human cancer cells. Cancer Res 1995;55:5187–90.[Abstract/Free Full Text]
  27. Koutsodontis G, Moustakas A, Kardassis D. The role of Sp1 family members, the proximal GC-rich motifs, and the upstream enhancer region in the regulation of the human cell cycle inhibitor p21WAF-1/Cip1 gene promoter. Biochemistry 2002;41:12771–84.[CrossRef][Medline]
  28. Takebe Y, Seiki M, Fujisawa J, et al. SR {alpha} promoter: an efficient and versatile mammalian cDNA expression system composed of the simian virus 40 early promoter and the R-U5 segment of human T-cell leukemia virus type 1 long terminal repeat. Mol Cell Biol 1988;8:466–72.[Abstract/Free Full Text]
  29. Shih CM, Lo SJ, Miyamura T, Chen SY, Lee YH. Suppression of hepatitis B virus expression and replication by hepatitis C virus core protein in HuH-7 cells. J Virol 1993;67:5823–32.[Abstract/Free Full Text]
  30. Yang CW, Su JY, Tsou AP, et al. Integrative genomics based identification of potential human hepatocarcinogenesis-associated cell cycle regulators: RHAMM as an example. Biochem Biophys Res Commun 2005;330:489–97.[Medline]
  31. Chao HK, Tsai TF, Lin CS, Su TS. Evidence that mutational activation of the ras genes may not be involved in aflatoxin B(1)-induced human hepatocarcinogenesis, based on sequence analysis of the ras and p53 genes. Mol Carcinog 1999;26:69–73.[CrossRef][Medline]
  32. Liu ZP, Olson EN. Suppression of proliferation and cardiomyocyte hypertrophy by CHAMP, a cardiac-specific RNA helicase. Proc Natl Acad Sci U S A 2002;99:2043–8.[Abstract/Free Full Text]
  33. Myohanen S, Baylin SB. Sequence-specific DNA binding activity of RNA helicase A to the p16INK4a promoter. J Biol Chem 2001;276:1634–42.[Abstract/Free Full Text]
  34. Tanner NK, Linder P. DExD/H box RNA helicases: from generic motors to specific dissociation functions. Mol Cell 2001;8:251–62.[CrossRef][Medline]
  35. Gartel AL, Goufman E, Najmabadi F, Tyner AL. Sp1 and Sp3 activate p21 (WAF1/CIP1) gene transcription in the Caco-2 colon adenocarcinoma cell line. Oncogene 2000;19:5182–8.[CrossRef][Medline]
  36. Rocak S, Linder P. DEAD-box proteins: the driving forces behind RNA metabolism. Nat Rev Mol Cell Biol 2004;5:232–41.[CrossRef][Medline]
  37. Narla G, Heath KE, Reeves HL, et al. KLF6, a candidate tumor suppressor gene mutated in prostate cancer. Science 2001;294:2563–6.[Abstract/Free Full Text]
  38. Gartel AL, Ye X, Goufman E, et al. Myc represses the p21(WAF1/CIP1) promoter and interacts with Sp1/Sp3. Proc Natl Acad Sci U S A 2001;98:4510–5.[Abstract/Free Full Text]
  39. Endoh H, Maruyama K, Masuhiro Y, et al. Purification and identification of p68 RNA helicase acting as a transcriptional coactivator specific for the activation function 1 of human estrogen receptor {alpha}. Mol Cell Biol 1999;19:5363–72.[Abstract/Free Full Text]
  40. Ou Q, Mouillet JF, Yan X, Dorn C, Crawford PA, Sadovsky Y. The DEAD box protein DP103 is a regulator of steroidogenic factor-1. Mol Endocrinol 2001;15:69–79.[Abstract/Free Full Text]
  41. Aratani S, Fujii R, Oishi T, et al. Dual roles of RNA helicase A in CREB-dependent transcription. Mol Cell Biol 2001;21:4460–9.[Abstract/Free Full Text]
  42. Tetsuka T, Uranishi H, Sanda T, et al. RNA helicase A interacts with nuclear factor {kappa}B p65 and functions as a transcriptional coactivator. Eur J Biochem 2004;271:3741–51.[Medline]
  43. Bates GJ, Nicol SM, Wilson BJ, et al. The DEAD box protein p68: a novel transcriptional coactivator of the p53 tumour suppressor. EMBO J 2005;24:543–53.[CrossRef][Medline]
  44. Huang JS, Chao CC, Su TL, et al. Diverse cellular transformation capability of overexpressed genes in human hepatocellular carcinoma. Biochem Biophys Res Commun 2004;315:950–8.[CrossRef][Medline]
  45. Chang PC, Chi CW, Chau GY, et al. DDX3, a DEAD box RNA helicase, is deregulated in hepatitis virus-associated hepatocellular carcinoma and is involved in cell growth control. Oncogene 2006;25:1991–2003.[Medline]
  46. Feitelson MA, Sun B, Satiroglu Tufan NL, Liu J, Pan J, Lian Z. Genetic mechanisms of hepatocarcinogenesis. Oncogene 2002;21:2593–604.[CrossRef][Medline]
  47. Fukushima K, Ueno Y, Yamagiwa Y, et al. Correlation between p21(waf1) and p16(INK4a) expression in hepatocellular carcinoma. Hepatol Res 2001;20:52–67.[Medline]
  48. Futreal PA, Coin L, Marshall M, et al. A census of human cancer genes. Nat Rev Cancer 2004;4:177–83.[CrossRef][Medline]
  49. Pagano M, Benmaamar R. When protein destruction runs amok, malignancy is on the loose. Cancer Cell 2003;4:251–6.[CrossRef][Medline]
  50. Fabbro M, Henderson BR. Regulation of tumor suppressors by nuclear-cytoplasmic shuttling. Exp Cell Res 2003;282:59–69.[CrossRef][Medline]



This article has been cited by other articles:


Home page
Am. J. Pathol.Home page
S. Z. Torabian, D. de Semir, M. Nosrati, S. Bagheri, A. A. Dar, S. Fong, Y. Liu, S. Federman, J. Simko, C. Haqq, et al.
Ribozyme-Mediated Targeting of I{kappa}B{gamma} Inhibits Melanoma Invasion and Metastasis
Am. J. Pathol., March 1, 2009; 174(3): 1009 - 1016.
[Abstract] [Full Text] [PDF]


Home page
J ANIM SCIHome page
J. S. Bates, D. B. Petry, J. Eudy, L. Bough, and R. K. Johnson
Differential expression in lung and bronchial lymph node of pigs with high and low responses to infection with porcine reproductive and respiratory syndrome virus
J Anim Sci, December 1, 2008; 86(12): 3279 - 3289.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
M.-C. Lai, Y.-H. W. Lee, and W.-Y. Tarn
The DEAD-Box RNA Helicase DDX3 Associates with Export Messenger Ribonucleoproteins as well asTip-associated Protein and Participates in Translational Control
Mol. Biol. Cell, September 1, 2008; 19(9): 3847 - 3858.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
C.-S. Lee, A. P. Dias, M. Jedrychowski, A. H. Patel, J. L. Hsu, and R. Reed
Human DDX3 functions in translation and interacts with the translation initiation factor eIF3
Nucleic Acids Res., August 1, 2008; 36(14): 4708 - 4718.
[Abstract] [Full Text] [PDF]


Home page
Reproductive SciencesHome page
B.-Y. Kang, S. Tsoi, Shan Zhu, Shenghui Su, and H. H. Kay
Differential Gene Expression Profiling in HELLP Syndrome Placentas
Reproductive Sciences, March 1, 2008; 15(3): 285 - 294.
[Abstract] [PDF]


Home page
Mol. Cell. Biol.Home page
A. M. Ambrus, B. N. Nicolay, V. I. Rasheva, R. J. Suckling, and M. V. Frolov
dE2F2-Independent Rescue of Proliferation in Cells Lacking an Activator dE2F1
Mol. Cell. Biol., December 15, 2007; 27(24): 8561 - 8570.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
Y. Ariumi, M. Kuroki, K.-i. Abe, H. Dansako, M. Ikeda, T. Wakita, and N. Kato
DDX3 DEAD-Box RNA Helicase Is Required for Hepatitis C Virus RNA Replication
J. Virol., December 15, 2007; 81(24): 13922 - 13926.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Yendamuri, F. Trapasso, M. Ferracin, R. Cesari, C. Sevignani, M. Shimizu, S. Rattan, T. Kuroki, K. R. Dumon, F. Bullrich, et al.
Tumor Suppressor Functions of ARLTS1 in Lung Cancers
Cancer Res., August 15, 2007; 67(16): 7738 - 7745.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
H. Qiu, B. Tian, R. G. Resuello, F. F. Natividad, A. Peppas, Y.-T. Shen, D. E. Vatner, S. F. Vatner, and C. Depre
Sex-specific regulation of gene expression in the aging monkey aorta
Physiol Genomics, April 24, 2007; 29(2): 169 - 180.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chao, C.-H.
Right arrow Articles by Wu Lee, Y.-H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chao, C.-H.
Right arrow Articles by Wu Lee, Y.-H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online