| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Cell, Tumor, and Stem Cell Biology |
1 Institute of Biochemistry and Molecular Biology, 2 Faculty of Life Sciences, and 3 Institute of Biotechnology in Medicine, National Yang-Ming University, Taipei, Taiwan, Republic of China
Requests for reprints: Yan-Hwa Wu Lee, Institute of Biochemistry and Molecular Biology, National Yang-Ming University, Taipei, Taiwan 112, Republic of China. Phone: 886-2-2826-7124; Fax: 886-2-2826-4843; E-mail: yhwulee{at}ym.edu.tw.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
58% to 73% of hepatoma specimens, which led to the reduction of p21waf1/cip1 expression in a manner independent of p53 status. Additionally, an alteration of subcellular localization from nuclei to cytoplasm was also observed in >70% of cutaneous squamous cell carcinoma samples. Because DDX3 exhibits tumor suppressor functions, such as a growth-suppressive property and transcriptional activation of the p21waf1/cip1 promoter, and is inactivated through down-regulation of gene expression or alteration of subcellular localization in tumor cells, all these features together suggest that DDX3 might be a candidate tumor suppressor. (Cancer Res 2006; 66(13): 6579-88) |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The cell cycle progression of eukaryotic cells is well controlled by cyclin, cyclin-dependent kinases (cdk), and cdk inhibitors. p21waf1/cip1 is one of the critical cdk inhibitors. Through interaction with the cdk/cyclin complexes, p21waf1/cip1 modulates their kinase activity, resulting in cell growth arrest (10). Additionally, p21waf1/cip1 also prevents DNA synthesis and regulates DNA replication through interaction with proliferating cell nuclear antigen (11). Therefore, p21waf1/cip1 may serve as a growth inhibitor and cell cycle checkpoint. In addition to the modulation of cell proliferation, p21waf1/cip1 is also involved in the regulation of apoptosis, differentiation, and stress response (11). Furthermore, although mutation of p21waf1/cip1 is uncommon in cancers (12), p21waf1/cip1-deficient mice show susceptibility to spontaneously or chemically induced tumor formation (13–15). Hence, p21waf1/cip1 acts as a tumor suppressor.
Several factors have been reported to induce the expression of p21waf1/cip1 and the most important one is the tumor suppressor p53 (16). Additionally, p53-independent stimulation including certain extracellular signals, chemical drugs (17), and viral products (18, 19) also induce p21waf1/cip1 expression. The mechanism of p21waf1/cip1 induction caused by these factors often involves the action of corresponding transcription factors on the p21waf1/cip1 promoter (17). These transcription factors include signal transducers and activators of transcription, nuclear hormone receptors, Smad3, and the ubiquitous transcription factor Sp1. Sp1 binds to the GC-rich sequence on the proximal region of p21waf1/cip1 promoter and acts as a mediator for the induction of p21waf1/cip1 gene caused by transforming growth factor ß (TGF-ß; ref. 20) and several chemical drugs including mitogen-activated protein kinase inhibitor and histone deacetylase inhibitor (21, 22). Furthermore, Sp1 also interacts with other regulatory transcription factors of p21waf1/cip1 promoter physically and functionally (23–25). Therefore, Sp1 plays a critical role in the regulation of p21waf1/cip1 promoter activity.
In this study, we have identified a tumor growth–suppressive property of DDX3. Additionally, we also identified p21waf1/cip1 as a downstream gene of DDX3. DDX3 enhances the expression of p21waf1/cip1 gene and up-regulates the promoter activity of p21waf1/cip1 through an ATPase-dependent but helicase-independent mechanism. The modulation of p21waf1/cip1 gene expression accounts for the growth-suppressive effect of DDX3. Moreover, our data also revealed that DDX3 transactivates the p21waf1/cip1 promoter through its multiple Sp1 sites, and DDX3 collaborates with Sp1 on p21waf1/cip1 promoter activation. Finally, we also showed that DDX3 expression was decreased in hepatocellular carcinoma (HCC) specimens, and the reduced expression of DDX3 might lead to a p53-independent decrease of p21waf1/cip1 expression. Additionally, an extensive loss of its nuclear localization was observed in cutaneous squamous cell carcinoma (SCC) compared with normal squamous cells. Together, our results show that DDX3 exerts tumor suppressor functions, including growth inhibition and transcriptional modulation of the promoter activity of p21waf1/cip1, and is inactivated through deregulated expression or nuclear exclusion in tumor cells. All these features strongly suggest that DDX3 might act as a tumor suppressor.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Plasmid construction. Plasmid p21-Luc was constructed by insertion of a 2.3-kb HindIII fragment (spanning the promoter region –2,325 to +8 related to transcription start site of human p21waf1/cip1 gene) from pWWP-Luc (16) into HindIII-treated GL2 vector (Promega Corp., Madison, WI). To construct the serial 5'-deleted p21waf1/cip1 promoter–driven luciferase reporters (–1,002/+8)p21-Luc, (–463/+8)p21-Luc, (–223/+8)p21-Luc, (–210/+8)p21-Luc, (–159/+8)p21-Luc, (–106/+8)p21-Luc, (–84/+8)p21-Luc, (–76/+8)p21-Luc, (–63/+8)p21-Luc, and (–56/+8)p21-Luc, HindIII/BglII–treated, PCR-amplified p21waf1/cip1 promoter fragments were ligated with HindIII/BglII–treated pGL2 vector. To construct the p21waf1/cip1 internal promoter region (nucleotide –127 to –63) deleted reporter plasmid (–2,325/+8)
(–127/–63)p21-Luc, the p21-Luc construct was digested with ApaI, blunted, and then self-ligated. The p21waf1/cip1 promoter–driven luciferase reporters (pGL3 derivatives) containing point mutations in six Sp1 elements, (Mut1)p21-Luc, (Mut2)p21-Luc, (Mut3)p21-Luc, (Mut4)p21-Luc, and (Mut5/6)p21-Luc and the parental wild-type reporter, (Wt)p21-Luc, were kindly provided by Dr. D. Kardassis (Department of Basic Sciences, University of Crete Medical School, Heraklion, Crete, Greece; ref. 27). Other p21waf1/cip1 promoter–driven luciferase reporters containing multiple point mutations of the Sp1 sites or point mutation of the AP-2 and E2F responsive elements (Mut1/2)p21-Luc, (Mut3/4)p21-Luc, (Mut1/2/3)p21-Luc, (Mut2/3/4)p21-Luc, (Mut1/2/3/4)p21-Luc, (mAP-2-1)p21-Luc, (mAP2-2)p21-Luc, (mE2F(b)-1)p21-Luc, and (mE2F(b)-2)p21-Luc were generated using the QuickChange site-directed mutagenesis system (Stratagene, La Jolla, CA). To obtain the pcDNA-SR
/FLAG vector, pcDNA3-FLAG vector (Invitrogen Corp., Carlsbad, CA) was treated with HindIII and NruI to eliminate the cytomegalovirus promoter fragment, blunted, and then ligated with 0.8 kb of ClaI-treated and Klenow filled-in SR promoter fragment from pSR vector (28). The mammalian expression vector pcDNA-SR/FLAG-DDX3 was constructed by insertion of a 2-kb EcoRI/ApaI–treated fragment of the DDX3 gene derived by reverse transcription-PCR (RT-PCR) into EcoRI/ApaI–treated pcDNA-SR/FLAG vector. Plasmids pcDNA-SR/FLAG-DDX3(AAA) and pcDNA-SR/FLAG-DDX3(DQAD), which direct the expression of the DDX3 mutants harboring mutation of the SAT or DEAD motif, were constructed by changing the Ser382 and Thr384 residues to Ala and the Glu343 residue to Gln by the QuickChange site-directed mutagenesis system (Stratagene). To obtain pGEX-5x-1/DDX3(1-226), which expresses the glutathione S-transferase/DDX3(1-226) fusion protein in E. coli, an EcoRI/XhoI–treated PCR-amplified cDNA fragment encoding NH2-terminal 1-226 amino acid region of DDX3 was ligated with EcoRI/XhoI–treated pGEX-5x-1 vector (Amersham Pharmacia Biotech, Buckinghamshire, United Kingdom). Plasmids pMC2P/FLAG-Sp1 and pMC2P/FLAG-Sp3, which direct the expression of FLAG-Sp1 or FLAG-Sp3, were kindly provided by Dr. G. Suske (Philipps University, Marburg, Germany). The plasmid pcDNA-SR/FLAG-Sp1 was generated by direct insertion of an EcoRI/ApaI–digested, PCR-amplified Sp1 cDNA fragment into EcoRI/ApaI–treated pcDNA-SR-FLAG. The bacterial expression vector pGEX-5x-1/Sp1 was constructed by introducing an EcoRI/XhoI–treated Sp1 gene fragment into EcoRI/XhoI–treated pGEX-5x-1 vector. All of these constructs were verified by DNA sequencing.
Antibody preparation. To generate anti-DDX3 antibody, glutathione S-transferase fusion protein containing the NH2-terminal 1-226 amino acid fragment of DDX3 [GST/DDX3(1-226)] was used as antigen for immunization. Immunization and collection of antisera were done by the Custom Antibody Services of Protech Technology Enterprise Co., Ltd. (Taipei, Taiwan). Anti-DDX3 sera were depleted with purified GST protein before application to the immunohistochemistry analysis.
Colony formation assay. For the colony formation assay, HuH-7, HeLa, HCT116, and NIH 3T3 cells were transfected with pcDNA-SR/FLAG-DDX3 or its parental empty vector by the calcium phosphate method or by Effectene (Qiagen, Hilden, Germany). Transfected cells were under G418 (Calbiochem; Merck Ltd., Darmstadt, Germany) selection (400 µg/mL for HuH-7 and HeLa cells, 600 µg/mL for HCT116 cells, and 900 µg/mL for NIH 3T3 cells) for 2 to 3 weeks. Colonies were fixed with methanol/acetone (1:1) and stained with crystal violet (1 mg/mL). To address the p21waf1/cip1-dependent inhibition on colony formation, HCT116 and HCT116 p21–/– cells were cotransfected with pSilencer 3.1-H1 puro (Ambion, Austin, TX) and pcDNA-SR/FLAG-DDX3 or its parental vector by Effectene (Qiagen) and selected with puromycin (0.4 µg/mL) for 2 weeks.
Reporter assay. For the luciferase reporter assay, correct amounts of cells (HuH-7, HeLa, NIH 3T3, 293T, HCT116, and HepG2 cells) were transfected with an appropriate amount of reporter plasmid, p21-Luc, or its derivatives and either the empty parental vector or the DDX3 expression construct. The TK-Relina reporter (Promega) was also cotransfected for normalization of transfection efficiency. Transfected cells were harvested at 48 hours posttransfection and a dual luciferase assay was done according to the instruction of the manufacturer. The luciferase activity was measured with an AutoLumat LB953 luminometer (Berthold) and normalized with the cotransfected Relina activity.
Determination of growth rate in DDX3-producing stable clones. HuH-7 and HeLa cells were transfected with pcDNA-SR/FLAG-DDX3 or parental vector pcDNA-SR/FLAG and selected with G418 (400 µg/mL) for 3 to 4 weeks. Independent clones with exogenous DDX3 expression were isolated and maintained in G418 (400 µg/mL)-containing medium. To compare the growth rate between DDX3-producing cells and control cell lines, cells were seeded at a density of 1.0 x 105 onto 6-cm plates. At each 24-hour interval, the cells were collected, stained with trypan blue, and counted with a hemocytometer. At least two independent experiments were done.
In vitro pull-down assay. GST, GST/Sp1 fusion proteins were purified as previously described (29). For the in vitro GST pull-down assay, 20 µL of glutathione-Sepharose 4B beads (Amersham Pharmacia Biotech) with immobilized GST or GST/Sp1 fusion proteins (4 µg each) were incubated with HuH-7 whole-cell extracts (500 µg) at 4°C for 6 hours. The beads were extensively washed. Proteins bound to the beads were then analyzed by Western blotting using anti-DDX3 polyclonal antibody.
In vivo coimmunoprecipitation assay. For the coimmunoprecipitation experiments, HuH-7 cells transfected with pcDNA-SR/FLAG-Sp1 were harvested and cell lysates were prepared using immunoprecipitation lysis buffer [20 mmol/L Tris-Cl (pH 7.5), 150 mmol/L NaCl, 10% glycerol, and 1% Triton X-100]. Cell extracts (1.5 mg) were incubated with 15 µL of anti-FLAG M2-agarose affinity gel (Sigma-Aldrich, St. Louis, MO). After extensive washing with immunoprecipitation lysis buffer, the immunoprecipitated proteins were analyzed by immunoblotting using specific antibodies against DDX3 and FLAG epitope (ab1257, Abcam, Cambridge, United Kingdom).
Cancer profiling array. The cancer-profiling array II (BD Biosciences Clontech, Palo Alto, CA) includes normalized cDNA from 154 tumor specimens and corresponding normal tissues from individual patient. To address the mRNA expression profile of DDX3 in these tissues, a 0.7-kb 32P-labeled cDNA probe spanning the 3'-coding region (400 bp) and 3'-untranslated region of DDX3 (300 bp) was generated by the Rediprime II probe labeling kit (Amersham Pharmacia Biotech) and used to probe the cancer profiling array according to the user instruction.
Quantitative real-time PCR. cDNAs prepared from 45 adjacent normal-tumor paired hepatoma samples were provided by different sources (30, 31) and used in quantitative RT-PCR assay. mRNA expression of DDX3 and p21waf1/cip1 in adjacent normal liver tissues and HCC samples was examined using quantitative real-time PCR (LightCycler FastStart DNA Master SYBR Green I, Roche Applied Science, Mannheim, Germany) according to the instruction manual using the primer set DDX3-4987F, TTCTCAGATGTTTGTTGTGTGGATT; DDX3-5142R, AAACTTGCTCAAATGCTATTGCTG; p21-F, AATCCCAGCTACTTGGAAGGC; and p21-R, GCTGACTGCAACCTCTGCC. Ribosomal protein S24 (RPS24) gene served as an internal control for quantitation using the primer set TGGCTTTGGCATGATTTATGAT and CTTTTTGCCAGCACCAACATT. Real-time detection of the emission intensity of SYBR Green was done with a LightCycler 2.0 instrument (Roche Applied Science). Each experiment was repeated in triplicate, including a no-template negative control.
Identification of p53 mutations in HCC specimens. To determine the p53 status in individual HCC samples, cDNA templates (1 µg) from 45 HCC samples were mixed with the primer set p53-1-F, ATGGAGGAGCCGCAGTCAG, and p53-1181-R, TCAGTCTGAGTCAGGCCCTTC, and high-fidelity Easy-A Hi-Fi PCR cloning enzyme (Stratagene) for PCR reactions. Full-length p53 cDNA fragments were subsequently cloned with pGEM-T easy vector system (Promega) to generate p53 constructs. At least 10 constructs of each individual HCC sample were sequenced and mutations appearing in more than five constructs were considered as somatic mutations of the p53 gene, not PCR-induced errors.
Tumor specimens. Tissue specimens were obtained commercially from different sources. Human hepatoma tissues were collected from Cybrdi (Frederick, MD; liver carcinoma tissue array, CC03-02-001), AccuMax (New York, NY; liver cancer tissues-hepatocellular carcinoma array, A204), and SuperBioChips Laboratories (Seoul, South Korea; human liver cancer array, CSA2). Human normal epidermis and cutaneous SCC samples were collected from SuperBioChips Laboratories (skin cancer array CX-1 and HA1 array). All of the tissue arrays are formalin-fixed, paraffin-embedded, and 4-µm-thick sections and are pathologically confirmed.
Immunohistochemistry. Tissue sections were placed in 10 mmol/L citric acid buffer (pH 6.0) and subjected to antigen retrieval by microwaving for 20 minutes after deparaffinization and rehydration. After incubation with 3% hydrogen peroxide for 10 minutes and 0.2% horse serum for 20 minutes, a 1:200 diluted rabbit anti-DDX3 polyclonal antibody was applied for 1 hour at room temperature and followed by incubation with biotinylated linker and streptavidin-horseradish peroxidase (LSAB2 system-HRP, DAKO Cytomation, Carpinteria, CA) for 30 and 10 minutes, respectively. The signals were visualized using AEC+ (DAKO Cytomation) as the substrate-chromagen at room temperature for 13 minutes. Sections were counterstained with hematoxylin and mounted. A semiquantitative evaluation was used to score the immunoreactivity. For analysis of the normal-tumor paired HCC samples, the staining intensity was compared directly between the tumor part and the normal part. Assessment of the DDX3 staining in the normal skin and cutaneous SCC specimens was done in two ways. Specifically, the percentage of nuclear immunoreactive cells was graded into five categories: 0% to 10% cells stained, 11% to 25% cells stained, 26% to 50% cells stained, 51% to 75% cells stained, and 76% to 100% cells stained. The intensity of nuclear staining was divided into four levels: negative, slight, moderate, and strong. In addition, a 
2 test was used to analyze the loss of nuclear localization in SCC specimens. Differences with P < 0.05 were accepted as statistically significant.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
|
The ATPase activity, but not the helicase activity, of DDX3 contributes to DDX3-mediated transcriptional modulation on the p21waf1/cip1 promoter. Because DDX3 harbors ATPase and RNA unwinding activities, we are interested to know whether these two enzymatic activities are required for the transcriptional regulatory effect of DDX3 on p21waf1/cip1 promoter. To address this issue, we generated mutations within the DEAD box or SAT motif. The conversion of DEAD motif to DQAD sequence impairs both ATPase activity and ATPase-dependent helicase activity (34). On the other hand, a point mutation of the SAT motif to AAA sequence leads to a loss of RNA unwinding activity but retains the ATPase activity of the helicase (34). Using these two mutants, we are able to distinguish which activity is required for the transcriptional activation of DDX3 on p21waf1/cip1 promoter. To this end, increasing amounts of expression constructs of DDX3/DQAD, DDX3/AAA and wild-type DDX3 were cotransfected with p21waf1/cip1 promoter–driven luciferase reporter. Interestingly, our data revealed that at a higher dosage (2 µg/well), the wild-type DDX3 and mutant DDX3/AAA up-regulated the activity of p21waf1/cip1 promoter 12-fold whereas the DDX3/DQAD mutant only activated the p21waf1/cip1 promoter activity 5-fold (Supplementary Fig. S1). Because a similar expression level of these three DDX3 expression constructs was detected (data not shown), their differential induction of p21waf1/cip1 promoter activity suggests that the ATPase activity, but not the RNA helicase activity, contributes to the transcriptional activation of DDX3 on the p21waf1/cip1 promoter.
DDX3 transactivates the p21waf1/cip1 promoter through multiple Sp1 sites. Next, to examine the underlying mechanism by which DDX3 activates the p21waf1/cip1 promoter, we mapped the DDX3 responsive region within the p21waf1/cip1 promoter by serial 5'-deleted promoter-driven luciferase reporters (Fig. 3A
and Supplementary Fig. S2A). The results suggested that the levels of activation induced by DDX3 of the luciferase activity of serial reporter constructs from (–1,002/+8)p21-Luc to (–123/+8)p21-Luc were comparable with the level of activation elicited by the full-length promoter-driven reporter p21-Luc (5- to 10-fold; Fig. 3B and Supplementary Fig. S2B). However, this DDX3-induced activation was dramatically decreased in reporter (–84+8)p21-Luc and (–76/+8)p21-Luc by 2- to 3-fold and was completely lost in (–63/+8)p21-Luc and (–56/+8)p21-Luc reporters (Fig. 3B). This observation suggested that the DDX3 responsive region within the p21waf1/cip1 promoter was located between –123 to –63 upstream of the transcription start site. This conclusion is further supported by another reporter assay, which was directed by a p21waf1/cip1 promoter lacking the –127 to –63 nucleotide region (Fig. 3C).
|
Functional cooperation and physical interaction between DDX3 and Sp1. It is well known that Sp1 and Sp3 can transactivate the p21waf1/cip1 promoter through Sp1 sites (35). To examine whether DDX3 transactivates the p21waf1/cip1 promoter activity through Sp1 site-interacting proteins, the Sp1 or Sp3 expression plasmid together with the DDX3 expression construct and the p21waf1/cip1 promoter–driven luciferase reporter were introduced into HuH-7 cells. As shown in Fig. 4A , transient expression of DDX3 alone resulted in a 4-fold activation of p21waf1/cip1 promoter activity whereas transiently expressed Sp1 or Sp3 of increasing amount led to a 1.6- to 1.8-fold activation of the p21waf1/cip1 promoter. Interestingly, the induction effect of DDX3 on the p21waf1/cip1 promoter was increased to 10-fold when coexpressing with Sp1; however, this coactivation effect was not found when coexpressing with Sp3 (Fig. 4A). This result strongly suggests that Sp1, but not Sp3, is involved in the transcriptional regulation of DDX3 at the p21waf1/cip1 promoter.
|
The expression or subcellular localization of DDX3 is altered in tumor cells. Because DDX3 exhibits tumor suppressor functions, it is interesting to know whether DDX3 is inactivated in tumor cells by alteration of gene expression. To address this issue, a DDX3-specific DNA probe was hybridized against the cancer-profiling array II (see Materials and Methods). Interestingly, the mRNA expression of DDX3 was declined in the liver tumor specimens (three of three samples) and SCC of the vulva (three of five samples; Supplementary Fig. S4). To further confirm the alteration of DDX3 expression in cancer specimens, the expression profiles of DDX3 were examined in normal-tumor paired HCC samples by immunohistochemical staining analysis using specific anti-DDX3 antibody. As shown in Fig. 5A , decreased expression of DDX3 at the protein level was found in 73% of HCC from 26 patients. Additionally, the mRNA expression of DDX3 was also examined by quantitative RT-PCR, and our data revealed that the DDX3 mRNA level was reduced in 57.8% of 45 HCC specimens (Fig. 5A and B). These results clearly indicate that the expression of DDX3 is down-regulated in liver tumor cells. Furthermore, we also delineated the relationship between DDX3 and p21waf1/cip1 mRNA expression in these HCC cases by quantitative RT-PCR (Fig. 5B). Our result showed that, among 26 cases with decreased DDX3 expression status, 20 cases (77%) also showed simultaneous p21waf1/cip1 down-regulation, and the correlation between the expression status of DDX3 and p21waf1/cip1 was statistically significant (P = 0.039; Fig. 5C). Notably, a positive correlation between the mRNA expression levels of DDX3 and p21waf1/cip1 in 45 HCC specimens was also found by linear regression analysis (r = 0.501, P < 0.001; Fig. 5D). Most interestingly, among those 20 cases with DDX3 and p21waf1/cip1 reduced status, 13 cases harbored wild-type p53 and 7 had p53 mutation (Fig. 5B). Thus, it seems that the decreased DDX3 expression in HCC samples leads to a reduction of p21waf1/cip1 expression irrespective of p53 status.
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In this study, we also identify p21waf1/cip1 as a target gene of DDX3, and the up-regulation of p21waf1/cip1 expression is linked to the growth-suppressive effect exerted by DDX3 (see Fig. 2). DDX3 enhances p21waf1/cip1 gene expression through up-regulation of promoter activity of p21waf1/cip1. Because the activation of p21waf1/cip1 promoter activity was shown in various cell lines with diverse p53 status (p53 wild-type in HepG2, HCT116, and NIH 3T3; p53 mutation in HuH-7; p53 degraded by human papillomavirus E7 in HeLa; p53 inactivated by SV40 large T antigen in 293T), this DDX3-mediated up-regulation on p21waf1/cip1 promoter seems to be p53 independent. Supporting this notion is the fact that the DDX3-induced activation level of serial 5'-deleted p21waf1/cip1 promoter–directed reporters that lack two p53 responsive elements (at the –2,301 and –1,394 nucleotide region upstream of the transcription start site; ref. 17) is comparable with the full-length p21waf1/cip1 promoter–driven reporter, p21-Luc (see Supplementary Fig. S2B). Moreover, in this work, the DDX3-responsive region is delineated to 60 bp (between –123 and –63) of the p21waf1/cip1 proximal promoter region (see Fig. 3B), and the integrity of multiple tandem Sp1 sites in this region is required for the activation induced by DDX3 (see Fig. 3C). This requirement of multiple Sp1 sites to confer DDX3-mediated transactivation of the p21waf1/cip1 promoter is different from other stimuli targeting to this GC-rich responsive region of the p21waf1/cip1 promoter. For example, TGF-ß and lovastatin target to the Sp1-3 site (17) whereas both of Sp1-3 and Sp1-4 sites are required for the action of the histone deacetylase inhibitor suberoylanilide hydroxamic acid (22). Most interestingly, our data also reveal that, like other p21waf1/cip1 promoter–regulating factors acting on this GC-rich responsive region, such as Smad3 (24), KLF6 (37), and c-Myc (38), DDX3 up-regulates p21waf1/cip1 promoter through physical interaction with Sp1 (see Fig. 4).
Recently, several RNA helicases involving in transcriptional regulation have been reported. They may exert a transcriptional function or act as comodulators for other transcription factors. However, whether the enzymatic activities of the RNA helicase (ATP hydrolysis and RNA unwinding) are required or contribute to the transcriptional modulation depends on individual case (39–43). Moreover, although several studies addressed the involvement of enzyme activity in the transcriptional regulation activities of certain RNA helicases, most of them do not distinguish precisely which activity is involved. For example, an ATPase- and/or helicase-dependent mechanism is essential for RNA helicase A–mediated transactivation function (41) and the functional interaction with nuclear factor 
B (42). This requirement also exists in functional interaction between RNA helicase DP103 and SF-1 (40). In our case, we show that the ATPase activity, but not the helicase activity, contributes to the DDX3-mediated transactivation (see Supplementary Fig. S1). Thus, a dual mechanism including the involvement of ATP hydrolysis and recruitment of other transcription factors (e.g., Sp1) would seem to occur with DDX3-mediated transcriptional regulation.
Because DDX3 harbors growth-suppressive ability and transcriptional modulation activity of the p21waf1/cip1 promoter, in this work we further examined the deregulated expression of DDX3 in tumors by a cancer profiling array and immunohistochemical staining analysis. Our results clearly indicate that the expression of DDX3 is decreased in HCC and the subcellular localization of DDX3 is altered in cutaneous SCC (see Figs. 5 and 6). Cutaneous SCC is a clinically aggressive cancer, and the inactivation of p21waf1/cip1 has been shown to play a critical role in the formation of skin tumor in knockout mice models (14, 15). Because DDX3 harbors a dominant nuclear localization in normal squamous cells and exerts a transactivation function on p21waf1/cip1 promoter, presumably the inactivation of transcriptional modulation function of DDX3 through cytoplasmic mislocalization is relevant to the deregulation of cell growth in cancerous squamous cells.
Recently, Huang et al. (44) have reported that the mRNA expression of DDX3 is up-regulated in HCC, and they considered DDX3 to be a promoter for hepatocarcinogenesis. However, according to our present study and recent report (45), both the mRNA and protein expressions of DDX3 are down-regulated in 58% to 73% of HCC specimens (see Fig. 5A). Furthermore, a tendency that DDX3 may regulate p21waf1/cip1 expression independently from p53 is also noted in HCC specimens (see Fig. 5B-D). This observation is consistent with our in vitro studies (see Figs. 2 and 3), which indicate that DDX3 up-regulates p21waf1/cip1 promoter activity in a p53-independent manner. Taking into account that it acts as a positive regulator of p21waf1/cip1 expression and has growth-suppressive ability on liver cancer cells, presumably DDX3 is a candidate tumor suppressor gene in liver. Support for this notion comes from several studies that have indicated the involvement of the p21waf1/cip1 inactivation in hepatocellular carcinogenesis (46, 47).
During the multistep process of carcinogenesis, decreased expression of tumor suppressors is often caused by epigenetic modification or abnormal degradation (48, 49). Additionally, alterations of subcellular localization through aberrant splicing or genetic mutations also provide ways to inactivate tumor suppressor genes (50). In view of these, further work to delineate the deregulation of DDX3 expression or localization will shed light on diverse mechanisms for inactivation of DDX3 in different cancers. In conclusion, our study characterizes the biological function of DDX3 as a putative candidate tumor suppressor gene, at least in HCC and cutaneous SCC. Most importantly, due to the universal tumor growth–suppressive property of this gene in various kinds of neoplasm regardless of p53 status, DDX3 is a potential therapeutic target for gene therapy.
|
Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Drs. D. Kardassis, G. Suske, B. Vogelstein, Y.M. Chen, and T.S. Su for generously providing experimental materials used in this study, and Dr. R. Kirby for critical reading and comments on this manuscript.
|
Footnotes |
|---|
Received 7/11/05. Revised 2/28/06. Accepted 4/ 3/06.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
S transition via a p53-independent pathway in human hepatoma cells. Oncogene 2000;19:3384–94.[CrossRef][Medline] interacts with ZTA and mediates ZTA-induced p21(CIP-1) accumulation and G(1) cell cycle arrest during the Epstein-Barr virus lytic cycle. J Virol 2003;77:1481–500.[Medline] promoter: an efficient and versatile mammalian cDNA expression system composed of the simian virus 40 early promoter and the R-U5 segment of human T-cell leukemia virus type 1 long terminal repeat. Mol Cell Biol 1988;8:466–72.. Mol Cell Biol 1999;19:5363–72.B p65 and functions as a transcriptional coactivator. Eur J Biochem 2004;271:3741–51.[Medline]This article has been cited by other articles:
|
|
 |
|
  S. Z. Torabian, D. de Semir, M. Nosrati, S. Bagheri, A. A. Dar, S. Fong, Y. Liu, S. Federman, J. Simko, C. Haqq, et al. Ribozyme-Mediated Targeting of I{kappa}B{gamma} Inhibits Melanoma Invasion and Metastasis Am. J. Pathol., March 1, 2009; 174(3): 1009 - 1016. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. S. Bates, D. B. Petry, J. Eudy, L. Bough, and R. K. Johnson Differential expression in lung and bronchial lymph node of pigs with high and low responses to infection with porcine reproductive and respiratory syndrome virus J Anim Sci, December 1, 2008; 86(12): 3279 - 3289. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M.-C. Lai, Y.-H. W. Lee, and W.-Y. Tarn The DEAD-Box RNA Helicase DDX3 Associates with Export Messenger Ribonucleoproteins as well asTip-associated Protein and Participates in Translational Control Mol. Biol. Cell, September 1, 2008; 19(9): 3847 - 3858. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C.-S. Lee, A. P. Dias, M. Jedrychowski, A. H. Patel, J. L. Hsu, and R. Reed Human DDX3 functions in translation and interacts with the translation initiation factor eIF3 Nucleic Acids Res., August 1, 2008; 36(14): 4708 - 4718. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B.-Y. Kang, S. Tsoi, Shan Zhu, Shenghui Su, and H. H. Kay Differential Gene Expression Profiling in HELLP Syndrome Placentas Reproductive Sciences, March 1, 2008; 15(3): 285 - 294. [Abstract] [PDF]
|
|
|
|
 |
|
 A. M. Ambrus, B. N. Nicolay, V. I. Rasheva, R. J. Suckling, and M. V. Frolov dE2F2-Independent Rescue of Proliferation in Cells Lacking an Activator dE2F1 Mol. Cell. Biol., December 15, 2007; 27(24): 8561 - 8570. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Ariumi, M. Kuroki, K.-i. Abe, H. Dansako, M. Ikeda, T. Wakita, and N. Kato DDX3 DEAD-Box RNA Helicase Is Required for Hepatitis C Virus RNA Replication J. Virol., December 15, 2007; 81(24): 13922 - 13926. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Yendamuri, F. Trapasso, M. Ferracin, R. Cesari, C. Sevignani, M. Shimizu, S. Rattan, T. Kuroki, K. R. Dumon, F. Bullrich, et al. Tumor Suppressor Functions of ARLTS1 in Lung Cancers Cancer Res., August 15, 2007; 67(16): 7738 - 7745. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Qiu, B. Tian, R. G. Resuello, F. F. Natividad, A. Peppas, Y.-T. Shen, D. E. Vatner, S. F. Vatner, and C. Depre Sex-specific regulation of gene expression in the aging monkey aorta Physiol Genomics, April 24, 2007; 29(2): 169 - 180. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
