Cancer Research Meeting Calendar  Jordan
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, Y.
Right arrow Articles by McKinnon, P. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, Y.
Right arrow Articles by McKinnon, P. J.
[Cancer Research 66, 6964-6971, July 15, 2006]
© 2006 American Association for Cancer Research


Molecular Biology, Pathobiology, and Genetics

Patched2 Modulates Tumorigenesis in Patched1 Heterozygous Mice

Youngsoo Lee1, Heather L. Miller1, Helen R. Russell1, Kelli Boyd3, Tom Curran2 and Peter J. McKinnon1

Departments of 1 Genetics and Tumor Cell Biology and 2 Developmental Neurobiology and 3 Animal Resource Center, St Jude Children's Research Hospital, Memphis, Tennessee

Requests for reprints: Peter J. McKinnon, Department of Genetics, St Jude Children's Hospital, 332 North Lauderdale, Memphis, TN 38105. Phone: 901-495-2700; Fax: 901-526-2907; E-mail: peter.mckinnon{at}stjude.org.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The sonic hedgehog (SHH) receptor Patched 1 (Ptch1) is critical for embryonic development, and its loss is linked to tumorigenesis. Germ line inactivation of one copy of Ptch1 predisposes to basal cell carcinoma and medulloblastoma in mouse and man. In many cases, medulloblastoma arising from perturbations of Ptch1 function leads to a concomitant up-regulation of a highly similar gene, Patched2 (Ptch2). As increased expression of Ptch2 is associated with medulloblastoma and other tumors, we investigated the role of Ptch2 in tumor suppression by generating Ptch2-deficient mice. In striking contrast to Ptch1–/– mice, Ptch2–/– animals were born alive and showed no obvious defects and were not cancer prone. However, loss of Ptch2 markedly affected tumor formation in combination with Ptch1 haploinsufficiency. Ptch1+/–Ptch2–/– and Ptch1+/–Ptch2+/– animals showed a higher incidence of tumors and a broader spectrum of tumor types compared with Ptch1+/– animals. Therefore, Ptch2 modulates tumorigenesis associated with Ptch1 haploinsufficiency. (Cancer Res 2006; 66(14): 6964-71)


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Signaling pathways that regulate development, such as the SHH pathway, have been linked to tumorigenesis (13). SHH is a secreted molecule required for cell growth, patterning, and fate determination in many tissues (47). Germ line mutation of PATCHED1 (PTCH1), a receptor for SHH, is responsible for the Gorlin syndrome, a familial cancer predisposition syndrome with a high incidence of medulloblastoma and basal cell carcinoma (BCC; refs. 8, 9). Mutation of PTC1 also occurs in sporadic tumors, and germ line and somatic mutations of SUFU (suppressor of fused), a downstream negative regulator of the SHH pathway, were recently linked to medulloblastoma (10). Similar to Gorlin syndrome, engineered mutations in Ptch1 in the mouse can lead to medulloblastoma, highlighting the direct relationship between SHH/PTC1 signaling and medulloblastoma (1114).

Our previous studies examining the genesis of medulloblastoma identified a common cohort of gene expression changes that occurred in genetically distinct mouse models of medulloblastoma (15, 16). In these mouse models, tumors occurred because of defects in either DNA repair, SHH signaling, or cell cycle regulation. One gene that was highly expressed in all mouse medulloblastomas studied was Ptch2. Furthermore, >30% of human medulloblastomas showed increased expression of PATCHED2 (PTC2); this group of human patients was associated with poor prognosis (15). Many features of PTCH2 make this a gene of interest and potentially relevant to tumorigenesis. These include the high similarity to PTCH1, the sites of expression, and the link to other tumor types (1722).

PTC2 is located on chromosome 1p33-34, comprises 22 exons, and shares about 73% amino acid similarity to PTC1 although with significant sequence differences in the transmembrane domains 6 and 7. Several alternatively spliced transcripts of the PTC2 gene have been identified in various human tissues, although the physiologic roles of PTC2 spliced forms remains to be determined (18, 22). Notably, PTC2 has been linked to familial/sporadic BCC and medulloblastoma (19, 22), tumors that are also associated with PTC1 mutation (8, 14). PTC2 was also suggested as a putative tumor suppressor candidate whose loss was observed frequently in meningioma (20, 21), and decreased PTC2 expression was associated with malignant peripheral nerve sheath tumors (17).

Like PTCH1, PTCH2 is also a SHH target, although as the expression pattern of PTCH1 and PTCH2 do not fully overlap, it is likely there are also separate functions for each (2326). PTCH2 can bind HH proteins and can form a complex with SMOOTHENED (26). Although the physiologic function of PTC2 is still unclear, based on sequence and biochemical similarity to PTC1 and aberrant expression in several tumors, it is possible that PTC2 is also important in the SHH signaling pathway and can modulate development and tumor formation. Therefore, to test if PTCH2 has functional overlap with PTCH1, including a role during tumorigenesis, we generated Ptch2-deficient mice. In contrast to Ptch1–/– mice, which showed early embryonic lethality, Ptch2–/– animals did not show any discernable abnormalities during development or a propensity for tumorigenesis. However, when combined with Ptch1 mutations, Ptch2 mutations promoted a dramatic increase in the incidence of tumorigenesis, suggesting a cooperative role of Ptch2 with the tumor suppressor function of Ptch1. Thus, to our knowledge, these data are the first demonstration that whereas Ptch2 is dispensable for development, it can influence the effect of Ptch1 attenuation during tumorigenesis.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Generation of Ptch2-deficient mice. A Mouse BAC genomic DNA Library (Invitrogen, Carlsbad, CA) was screened to identify clones containing the Ptch2 gene. To inactivate Ptch2, we deleted exons 5 to 17 from the full-length 20 exon–containing murine Ptch2 gene. To do this, a BclI and HindIII 12-kb genomic fragment was inserted into HindIII and BamHI sites of pBluscript II (Stratagene, La Jolla, CA), in which the SacII restriction site was inactivated. An oligomer containing a LoxP site was inserted in a PacI site present between a BclI site and exon 5 of the Ptch2 gene. Then a Neo-tk cassette flanked by LoxP sites was inserted into a SacII site between Ptch2 exons 17 and 18. Finally, W9.5 embryonic stem cells were electroporated with a NotI-linearized targeting construct. Embryonic stem cells were selected by G418, and targeted integrations were identified using Southern blot analysis (data not shown). pMC-Cre was then used to excise the floxed Neo-tk, and the embryonic stem cells were grown in gancyclovir to ensure cre-mediated removal of the Neo-tk cassette. Targeted embryonic stem cells were microinjected into C57BL/6 blastocysts and implanted in pseudopregnant F1 B/CBA foster mothers and allowed to develop to term. Germ line transmission was confirmed by Southern blot and PCR analysis. All Ptch2 animals were maintained in a mixed genetic background of 129SvX1/SVJ and C57BL/6. The PCR condition for the genotyping was 30 cycles of 95°C for 1 minute, 63°C for 1 minute, and 72°C for 1 minute with primers Ptch2-1 (5' ACCGGCACAGCAGGCAGG), Ptch2-2 (5' GTGAGCTCAGTGCCGTCTACACAGC), and Ptch2-3 (5' AGAGATGTGTCTGGCCACACAGAGC). These conditions gave a 755-bp PCR product for a wild-type allele and a 663-bp product for the mutant allele.

To examine the targeted Ptch2 allele, total RNA was extracted from P5 wild-type (WT) and Ptch2–/– brains using Trizol (Invitrogen), and RNA was separated on a 1% agarose gel in a MOPS/formaldehyde–containing buffer. cDNA probes for either Ptch1 or Ptch2 were radiolabeled using a random primed labeling system (Roche, Indianapolis, IN).

Mice. Ptch1 and Ptch2 double mutant animals were obtained by intercrossing of Ptch1+/–Ptch2–/– or Ptch1+/–Ptch2+/–. The details of Ptch1 animal model were described before (13, 14). Ptch2–/–p53–/– mutant animals were generated by intercrossing of either Ptch2+/–p53+/– or Ptch2–/–p53+/– mice. All Ptch1-Ptch2 mice used in these studies were F2 or later-generation littermates on a 129Svj x C57BL/6 genetic background. The presence of a vaginal plug was designated as embryonic day 0.5 (E0.5), and the day of birth as postnatal day 0 (P0). Animals were acclimated to controlled temperature and constant light/dark schedule with food and water ad libitum. Full necropsy was done by the diagnostic Pathology laboratory at St. Jude Children's Research Hospital. All animals were housed in an Association for Assessment and Accreditation of Laboratory Animal Care–accredited facility and were maintained in accordance with the NIH Guide for the Care and Use of Laboratory Animals. The Institutional Animal Care and Use Committee at St. Jude Children's Research Hospital approved all procedures for animal use.

Histology, immunohistochemistry, and in situ hybridization. For tissue fixation, embryos at E13.5 were submersed directly in buffered 4% paraformaldehyde, and brains from P5 and 3-week-old animals were removed after trans-cardial perfusion with 4% buffered paraformaldehyde. Fixed tissues were then cryoprotected in 25% sucrose in PBS and subjected to immunohistochemistry. Tumors were extracted from euthanized animals and fixed immediately in 10% neutral buffered formalin. The following antibodies were used for immunohistochemistry: anti-Ki67 (1:1,000; Novocastra Laboratory, Newcastle upon Tyne, United Kingdom), anti-ß-tubulin II (Tuj1; 1:1,000; BabCo, Richmond, CA), glial fibrillary acidic protein (GFAP; 1:400; Sigma, St. Louis, MO), p27 (1:2,000; Santa Cruz Biotechnology, Santa Cruz, CA), and synaptophysin (1:200; Chemicon International, Temecula, CA). Antigen retrieval was used for all immunohistochemistry. Cryosections (10-µm thick) or paraffin sections (7-µm thick) were incubated with antibodies overnight at room temperature after quenching endogenous peroxidase. Immunoreactivity was visualized with the vasoactive intestinal peptide substrate kit (Vector Laboratories, Burlingame, CA) according the manufacturer's guide, or indocarbocyanine (Cy-3) conjugated secondary antibodies (Jackson ImmunoResearch Lab, West Grove, PA). For colorimetric detection, counterstaining with methyl green was done followed by mounting slides with DPX (BDH Laboratory, Poole, United Kingdom), and Gel/Mount (Biomedia Corp., Foster City, CA) was used for fluorescence analysis. H&E staining was done by routine methods. Terminal deoxynucleotidyl transferase–mediated nick-end labeling assays were done using ApopTag (Fluorescein In situ Apoptosis Detection kit, Chemicon International) to detect neuronal apoptosis in the developing brain 6 hours after irradiation (18 Gy at 403 rad/min from a cesium irradiator). In situ hybridization was applied to detect Ptch1 and Ptch2 mRNA signals via exposure of emulsion-dipped slides in wild-type E16.5 and P7 brains and Ptch2, Gli1, Gli2, and secreted frizzled related protein 1 (Sfrp1) mRNA signals in Ptch1 and Ptch2 mutant medulloblastomas as described before (15) with support from GENSAT at St. Jude Children's Research Hospital (in situ methodology: http://www.stjudebgem.org/web/html/methods.php). Sense and antisense in situ hybridization probes were generated from a Ptch2 IMAGE clone (clone 3972649, nucleotides 1891-3568, and 3' untranslated region), a Gli1 clone in pSPORT1 (nucleotides 701-1251, Genbank accession no. AB025922), a Gli2 clone in pSPORT1 (nucleotides 1055-1835, Genbank accession no. X136212), and an Sfrp1 clone in pSPORT1 (nucleotides 247-1375, Genbank accession no. U88566).

Quantitative real-time PCR. Total RNA samples were extracted from snap-frozen tumor samples and control tissues using Trizol (Invitrogen). real-time reverse transcriptase-PCR (RT-PCR) was done as described before (15). A primer/Taqman probe set for Ptch2 was forward primer Ptch2-SDS-F (5'-ATCCTAGCTGGGAGCCTGAAG), reverse primer Ptch2-SDS-R (5'-TCCCGCATCCCAGAGAGA), and Taqman probe Ptch2-SDS-FAM (5'-TCCACTCTGGCTTCGTGCTTACTTCCA), which detected a portion of a missing part in the Ptch2 mutant allele (nucleotides 2366-2447, Genbank accession no. NM_008958). Two different sets of primer/Taqman probe sets for Ptch1 were used: one set to detect mRNA from exon 21 and the other for exon 2 (the exon disrupted in the mutant allele of Ptch1; ref. 14). To detect Ptch1 exon 21, we used forward primer Ptch1-SDS-F (5'-CAAGTGTCGTCCGGTTTGC), reverse primer Ptch1-SDS-R (5'-CTGTACTCCGAGTCGGAGGAA), and Taqman probe Ptch1-SDS-FAM (5'-CCTCCTGGTCACACGAACAATGGGTC). The primer set for Ptch1 exon 2 was forward primer Ptch1ex2-SDS-F (5'-GGCTACTGGCCGGAAAGC), reverse primer Ptch1ex2-SDS-R (5'-GAATGTAACAACCCAGTTTAAATAAGAGTCT), and Taqman probe Ptch1ex2-SDS-F (5'-CCGCTGTGGCTGAGAGCGAAGTTTC). In addition, we used the following primer/probe sets for other genes: Gli1 forward (5'-GCTTGGATGAAGGACCTTGTG), reverse (5'-GCTGATCCAGCCTAAGGTTCTC), and Taqman probe (5'-CCGGACTCTCCACGCTTCGCC); Sfrp1 forward (5'-TCCTCCATGCGACAACGA), reverse (5'-TGATTTTCATCCTCAGTGCAAACT), and Taqman probe (5' TGAAGTCAGAGGCCATCATTGAACATCTCTG); Math1 forward (5'-ATGCACGGGCTGAACCA), reverse (5'-TCGTTGTTGAAGGACGGGATA), and Taqman probe (5'-CCTTCGACCAGCTGCGCAACG). The outcome of real-time PCR was analyzed with SDS ver2.0 software (ABI, Foster City, CA). 18S rRNA assay reagents (ABI) were used as an internal control.

Spectral karyotyping. Medulloblastoma primary tumors were collected 4 hours after colcemid treatment (10 µg/mL i.p. injection). A total of six medulloblastoma (three Ptch1+/–Ptch2+/–, two Ptch1+/–Ptch2–/–, and one Ptch1+/–Ptch2+/–) were subject to spectral karyotyping analysis. A single-cell suspension of medulloblastoma was subject to spectral karyotyping analysis. Spectral karyotyping procedures were done according to the SkyPaint hybridization and detection protocol (Applied Spectral Imaging, Vista, CA), and a commercially prepared spectral karyotyping probe was used to detect chromosomes. Sample pretreatment consisted of RNase A (100 µg/mL) for 1 hour at 37°C and pepsin for 2 minutes at 20°C (50 µg/mL in 10 mmol/L HCl), with counterstaining by 4',6-diamidino-2-phenylindole.

Sequence analysis of Ptch1 and Ptch2. To detect any mutations or deletion of the Ptch1 and Ptch2 genes, cDNA was synthesized from medulloblastoma and rhabdomyosarcoma RNA by an oligo-dT primed RT method using SuperScript II RNase H Reverse Transcriptase (Invitrogen). Using these cDNA samples as templates, full-length Ptch2 mRNA was amplified with the following primer sets: Ptch2, a combination of forward primer Ptch2seq1F (5'-AGCCTATGGCAGCGCTCAGATAACGCAGG) with reverse primer Ptch2seq1R (5'-CCTGCTGCCGCCCCAGCACAACCTCAGTT), or for two overlapping fragments of Ptch2, a combination of forward primer Ptch2seq1F with reverse primer Ptch2seqmt1 (5'-CAGCATCTGAATGACCTGAGCGGAGCAGG) and a combination of forward primer Ptch2seq5F (5'-ATTCCTGCGCTGCGGGCCTT) with reverse primer Ptch2seq1R. For Ptch1, two rounds of amplification were required as the level of Ptch1 expression was very low. The first round of PCR was done with forward primer Ptch1-14 (5'-ACGCGCAATGTGGCAATGGAAGGC) and reverse primer Ptch1-R1 (5'-GAAGCGGCCGCTTCAGATTTTAATTACCC) to amplify a full-length Ptch1. Subsequently, the PCR products were further amplified with following five different sets of primers whose products overlapped each other and spanned a full-length of Ptch1. Set A: forward primer Ptch1-F (5'-ATGGCCTCGGCTGGTAACG) and reverse primer Ptch1-1 (5'-AAGGCCGGTCCATGTACCCATGGC); set B: forward primer Ptch1-2 (5'-GCTTAATCATTACACCTTTGGACTGC) and reverse primer Ptch1-6 (5'-AAAGGAGCATAGTGCTTCTCTGC); set C: forward primer Ptch1-5 (5'-TTGAGCCACAGGCCTACACAGAGC) and reverse primer Ptch1-8 (5'-GTCTGAGGTGTCTCGTAGGCCG), set D; forward primer Ptch1-7 (5' TGGGAAACTGGGAGGATCATGC) and reverse primer Ptch1-10 (5' GCTCAGGCGAAGGAGTGGGCAGTCG); and set E: forward primer Ptch1-9 (5'-GTGGAGTTCACCGTCCACGTGGC) and reverse primer Ptch1-R2 (5'-GAAGCGGCCGCTCAGTTGGAGCTGCTCCCCCACGGC). The PCR products were sequenced by a routine Big Dye Terminator (v.3) Chemistry approach on Applied Biosystem 3700 DNA analyzer.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Generation of Ptch2-deficient mice. Ptch1 is critical for development and also functions to prevent tumorigenesis. Given the importance of Ptch1 and its similarity to Ptch2 (73% similarity at the amino acid level), we sought to determine the potential relationship between these genes. Comparative expression analyses of Ptch1 and Ptch2 in the developing nervous system showed low and diffuse expression of Ptch2. In contrast, Ptch1 was expressed in distinct regions, such the ventricular zone in the ganglionic eminence and spinal cord during neurogenesis (Fig. 1A ), suggesting distinct roles for these two genes during development. However, the developing cerebellum (P7) showed high expression of Ptch2 in the outer layer of the EGL, whereas Ptch1 was expressed more broadly in the EGL as well as granule cells in the internal granule layer (Fig. 1A).


Figure 1
View larger version (82K):
[in this window]
[in a new window]
 
Figure 1. Expression of Ptch1 and Ptch2 during development and the generation of Ptch2-deficient animals. A, in situ hybridization analysis of Ptch1 and Ptch2 mRNA at E16.5 (x200) and P7 (x400) in the wild-type developing brain, showing the distinct expression patterns of these two genes. B, genomic structure of the murine Ptch2 gene, which contains 20 exons. A LoxP sites flanked exons 5 and 17, which when excised by Cre recombinase deletes the majority of the transmembrane domains. C, Northern blot analysis showing the truncated Ptch2 mRNA in Ptch2–/– animals. Ptch1 levels in the Ptch2–/– samples together with a panel showing the ethidium bromide–stained RNA gel.

 
Therefore, we generated mice lacking Ptch2 in an attempt to further understand the relationship between these two proteins. To do this, we used gene targeting to remove exons 5 to 17 of the Ptch2 gene, a region that encodes the majority of transmembrane domains (Fig. 1B). Consistent with the targeting strategy, Northern blot analysis showed that Ptch2–/– animals produced a truncated Ptch2 message of 2.8 kb that lacks 2.3 kb of coding sequence (Fig. 1C). DNA sequencing of RT-PCR products of the Ptch2 message from Ptch2–/– cerebellum showed the only Ptch2 transcript was missing all sequences encoded by exons 5 to 17. Ptch2–/– animals were fertile and born at Mendelian frequency, and they aged without any discernible defects. Furthermore, analysis of embryogenesis showed no gross anatomic or histologic defects in Ptch2–/– embryos (Fig. 2A ). We examined embryos at various ages and used immunohistochemical analysis to monitor cell proliferation and differentiation but found no differences between controls and Ptch2–/– animals. Additionally, the cerebellum of Ptch2–/– animals did not differ from the wild-type cerebellum during development and differentiation (Fig. 2A and B). We also found no differences in the response of Ptch2-null primary granule neurons to recombinant SHH compared with WT cells as determined by bromodeoxyuridine incorporation and Ki67 staining as both cell types were stimulated to the same degree after SHH (data not shown). We also used retroviral transduction of MEFs with a Gli1 promoter green fluorescent protein reporter construct, but whereas SHH stimulated Gli-1 reporter expression, there were no differences between Ptch2-null and WT cells (data not shown). Therefore, the Ptch2 gene is dispensable during embryogenesis, in striking contrast to the early lethality resulting from Ptch1 deficiency (14).


Figure 2
View larger version (99K):
[in this window]
[in a new window]
 
Figure 2. Normal development of Ptch2-deficient animals. A, wild-type and Ptch2–/– embryonic brains at E13.5 (retina, x200; other brain parts, x400). Tuj1 marks post-mitotic neurons and Ki67 identifies proliferating cells. Ptch2–/– embryos underwent normal embryogenesis. B, wild-type and Ptch2–/– cerebellum development (P5, x400; 3 weeks old, x200). Mitotic (Ki67) and post-mitotic (p27) populations were similar between wild-type control and Ptch2–/– brains. Immunopositive signals were visualized with peroxidase substrate kit (purple staining). Methyl green was used for counterstaining (green staining).

 
Ptch2 null animals are not tumor prone. As Ptch1 heterozygous animals are tumor prone (14), we monitored Ptch2+/– and Ptch2–/– animals for tumors. Although Ptch2–/– animals occasionally developed spontaneous tumors, it was within the reference range and similar to matched WT animals (2 of 70 Ptch2–/– animals developed tumors by 18 months of age). Loss of p53 rapidly accelerates tumorigenesis in Ptch1 heterozygous mice (27); therefore, we introduced Ptch2 mutation onto a p53–/– background. Ptch2–/–p53–/– animals showed a similar tumor profile and latency to those of p53–/– animals (11 of 20 Ptch2–/–p53–/– animals developed thymoma or/and sarcoma by ~4 months of age). Ptch1+/– animals showed a high incidence of medulloblastoma after irradiation at early postnatal times (28). Again, Ptch2–/– animals were similar to wild type, as low-dose ionizing radiation (4 Gy) at P5 did not induce medulloblastoma in Ptch2–/– mice (data not shown). These data suggested that Ptch2 deficiency alone or in combination with p53 loss or ionizing radiation is insufficient to induce tumorigenesis. Finally, whereas Ptch1+/– P5 cerebella are radiosensitive and show increased ionizing radiation–induced cell death (15), Ptc2+/– and Ptc2–/– cerebellum was similar to controls at 6 hours after 18 Gy of ionizing radiation (results not shown).

Ptch1 and Ptch2 compound mutants have increased tumor susceptibility. To further assess Ptch2 function, we examined potential genetic interactions between Ptch1 and Ptch2 during development and tumorigenesis. We intercrossed Ptch1+/–Ptch2+/– mice to generate Ptch1+/–Ptch2–/– and appropriate control animals. Although mice harboring two mutant Ptch1 alleles were embryonic lethal, all other allelic combinations were obtained at expected frequencies. Ptch1+/–Ptch2–/– mice showed no overt phenotype, and anatomic analysis of embryos and adult brain showed normal histology (data not shown). However, we did find that many Ptch1+/–Ptch2+/– and Ptch1+/–Ptch2–/– mutant animals suffered from intestinal serosal angiectasis (~19% and 18%, respectively; Fig. 3A ), implying a problem with blood vessel formation compared with Ptch1+/– animals (3.7%; Table 1 ). Furthermore, we also found s.c. telangiectasia in 2 of 97 (2%) Ptch1+/–Ptch2+/– animals.


Figure 3
View larger version (75K):
[in this window]
[in a new window]
 
Figure 3. Survival curve and histopathology of Ptch1 and Ptch2 combined mutations in tumorigenesis. A, two representative examples of intestinal serosal angiectasis (in one case, a rhabdomyosarcoma is also present). B, Kaplan-Meier survival analysis of animals. C, glossal rhabdomyosarcoma. Top, a Ptch1+/–Ptch2–/– animal with tongue rhabdomyosarcoma. Bottom, H&E staining of a glossal rhabdomyosarcoma. D, histopathologic examination of rhabdomyosarcoma from the limbs and medulloblastoma. There were no apparent difference between Ptch1+/–Ptch2+/– and Ptch1+/–Ptch2–/– tumors. GFAP, glial fibrillary acidic protein.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Tumor incidence in compound mutant mice

 
However, tumorigenesis in Ptch1+/– animals was markedly affected by Ptch2 status. Ptch2–/– or Ptch2+/– in combination with Ptch1+/– haploinsufficiency significantly reduced tumor latency associated with Ptch1 loss (P = 0.006, log-rank test; Table 1; Fig. 3B). By 8 months of age, 50% of Ptch1+/–Ptch2–/– animals had developed tumors, and 50% of Ptch1+/–Ptch2+/– animals had developed by 10 months of age, whereas only ~15% Ptch1+/–Ptch2+/+ animals developed tumors by 12 months of age (Fig. 3B). However, with increasing age (>12 months), Ptc1+/– animals were less healthy and died with no obvious tumor burden at necropsy (Fig. 3B). Ptch1+/–Ptch2–/– compound mutant animals generally developed a similar spectrum of tumors to those of Ptch1+/–, such as medulloblastoma and rhabdomyosarcoma (14, 27, 29), although with a much higher frequency (Fig. 3C; P = 0.05, medulloblastoma; P = 0.03, rhabdomyosarcoma; Table 1). To exclude genetic background effects, all data were acquired from later-generation than second-generation backcrosses. Furthermore, our current cohort is at the sixth generation, and increased tumorigenesis is apparent. Medulloblastomas from Ptch1+/–Ptch2–/– (as well as Ptch1+/–+/–Ptch2+/–) animals were histopathologically similar to Ptch1+/– tumors and expressed typical neural markers, such as GFAP, Tuj1, and synaptophysin (Fig. 3D). Medulloblastoma signature genes (15), such as Gli1, Gli2, Math1, and Sfrp1, were also overexpressed in Ptch1/Ptch2 tumors as detected by in situ hybridization (Fig. 4A ), quantitative real-time PCR (Fig. 4B), and microarray analysis (data not shown). Although Ptch1+/– medulloblastoma expressed Ptch2 at high levels, the expression of Ptch2 in Ptch1+/–Ptch2+/– (or Ptch1+/–Ptch2–/–) medulloblastoma was much lower or absent (Fig. 4A and B), indicating that Ptc2 is not required per se for tumorigenesis. However, as the tumor incidence was increased similarly when either Ptch2+/– or Ptch2–/– were present in combination with Ptch1+/– (Table 1), this indicates that the relative levels of Ptch2 can influence tumorigenesis in Ptch1+/– mice. We also generated Ptch1+/–Ptch2–/– (or Ptch2+/–) mutant animals on a p53–/– background, but in this situation, Ptch2 loss did not alter tumor latency, as Ptch1+/–Ptch2–/–(Ptch2+/–)p53–/– tumor incidence was the same as Ptch1+/–p53–/– (data not shown).


Figure 4
View larger version (60K):
[in this window]
[in a new window]
 
Figure 4. Overexpression of medulloblastoma signature genes in Ptch1+/–Ptch2+/– and Ptch1+/–Ptch2–/– tumors. A, expression of Sfrp1, Gli2, Gli1, and Ptch2 were detected using in situ hybridization in medulloblastomas (x200). B, quantitative real-time RT-PCR data were used to measure mRNA levels in rhabdomyosarcomas (Sar) and medulloblastomas (Med) in comparison to wild-type P5 and adult cerebellums. The expression of Ptch2 was absent in Ptch2–/– tumors and much lower in Ptch2+/– tumors. However, Ptch1+/–Ptch2+/+ medulloblastoma showed overexpression of Ptch2.

 
Concomitant Ptch2 loss leads to an increase in rhabdomyosarcoma frequency in Ptch1+/– mutant animals (Table 1; Fig. 3C and D). This tumor type also showed more diversity in double mutant animals, as it was found in the tongue (glossylpharyngial rhabdomyosarcoma; Fig. 3C), genitourinary track, trunk, and most frequently in the limbs. The combination of Ptch2 mutation with Ptch1 haploinsufficiency also increased the frequency of multiple different tumors within individual animals mostly involving sarcomas and angiectasis, a situation that was not observed in Ptch1+/– animals. Furthermore, 1 of 62 Ptch1+/– animals (1.6 %) had BCC, and Ptch2 mutation increased the frequency of BCC to 5% (5 of 97 in Ptch1+/–Ptch2+/– and 3 of 63 in Ptch1+/–Ptch2–/–). In addition, 2 of 54 (3.7%) Ptch1+/–Ptch2+/– males developed testicular teratoma. These data suggest that Ptch2 mutations enhance tumorigenesis, resulting from defective HH signaling pathway due to Ptch1 heterozygosity, implying a cooperation of Ptch2 loss with Ptch1 mutation.

Ptch1 expression is lost in Ptch1+/–Ptc2–/– tumors. We checked if the decreased latency (Fig. 3B) observed in the Ptch1+/–Ptch2+/– tumors involved loss of the WT Ptch2 allele. We sequenced Ptch2 cDNA derived from Ptch1+/–Ptch2+/– tumor RNA samples (two sarcomas and two medulloblastomas) using high-fidelity PCR to amplify the Ptch2 open reading frame. We did not find any mutations in Ptch2 mRNA in the tumors (data not shown), suggesting that inactivation of the WT Ptch2 allele does not occur in Ptch1+/–Ptch2+/– tumors. Furthermore, we amplified Ptch1 cDNA from the tumors and as previously reported (11, 13) did not find any mutations or deletions in the Ptch1 open reading frame (data not shown). However, using quantitative real-time PCR analysis with two different probe sets that can discriminate the mutant and WT Ptch1 alleles, we found that expression of the Ptch1 WT allele was absent or barely detectable in these tumors. In contrast, the level of Ptch1 in Ptch1+/–Ptch2–/– P5 and nonneoplastic adult cerebellum was comparable with those of WT samples (Fig. 5A ) with both sets of primer/probes. This strategy distinguishes the normal Ptch1 allele from the engineered Ptch1 mutation in which a LacZ gene interrupted Ptch1 exon2 (14), and the primer set that identifies Ptc1 exon 21 quantifies Ptch1 expression from both alleles. Therefore, a lack of expression of exon 2 indicates that the wild-type allele is silenced in medulloblastoma. We also examined Ptch1+/–Ptch2+/–, Ptch1+/–Ptch2–/–, and Ptch1+/– medulloblastoma samples using spectral karyotype to identify if enhanced genomic instability may occur when Ptch2 levels are reduced but found no evidence of chromosomal rearrangements resulting from additional inactivation of Ptch2. Interestingly, one case of medulloblastoma (Ptch1+/–Ptch2–/–) showed a loss of one chromosome 13 in which the Ptch1 gene is located (Fig. 5B), supporting the notion that Ptch1 loss, either by chromosomal loss or epigenetic silencing occurs in Ptc1+/-derived medulloblastoma, consistent with previous reports in Ptc1+/– mice (30).


Figure 5
View larger version (40K):
[in this window]
[in a new window]
 
Figure 5. Spectral karyotyping analysis and Ptch1 expression in tumors. A, quantitative real-time RT-PCR for Ptch1 using primers sets that discriminate the mutant and WT Ptc1 alleles. Two different sets of primer/probe were used to detect expression of exon 21 (in both mutant and wild-type alleles) and exon 2 (absent in the mutant allele). Wild-type Ptch1 expression was negligible in all Ptch1+/– medulloblastomas examined. B, representative spectral karyotyping analysis of Ptch1+/–Ptch2+/– medulloblastoma. Spectral karyotyping images show the spectral (RGB) color image on the left and the classified (pseudocolor) image on the right. In one case, a Ptch1+/–Ptch2–/– medulloblastoma showed loss of one copy of chromosomes 13 and 14.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
During development the HH pathway plays a crucial role in regulation of morphogenesis and differentiation. SHH deficiency in the mouse results in defective patterning and multiple organ defects, including cyclopia, akin to holoprosencephaly, a human phenotype with SHH or PTCH1 mutation (3135). Similarly, mice deficient for SHH signaling, such as inactivation of Ptch1 or Sufu, a negative regulator of the SHH pathway, die in utero due to developmental defects (14, 36). In this report, we have investigated the requirement for the HH binding protein Ptch2 during development and tumorigenesis. Our motivation for doing this was the high similarity between Ptch1 and Ptch2 and the indispensability of hedgehog signaling for development and in many cases the prevention of cancer. Therefore, we generated an animal model of Ptch2 deficiency. It was somewhat surprising that Ptch2-deficient animals were normal in all aspects we examined, particularly given the early embryonic lethality of Ptch1–/– animals. The in situ hybridization analysis showed spatiotemporal differences between Ptch1 and Ptch2 expression, and so the nonoverlapping expression between these two proteins suggests that functional redundancy by Ptch1 does not account for normal development in the absence of Ptch2. Thus, Ptch1 and Ptch2 function differently during development, perhaps with Ptch2 fulfilling more subtle roles during SHH signaling, or Ptch2 participating more in other HH signaling pathways, such as Desert HH whose role in development is less critical than SHH (26, 37, 38).

It is evident that there is a direct link between medulloblastoma and genomic instability induced either endogenously or exogenously. Defects in DNA strand break repair in animals [e.g., DNA ligase IV or poly(ADP-ribose) polymerase deficiency] can lead to genomic instability and transformation of neuroprogenitor cells in the developing cerebellum, resulting in medulloblastoma (39, 40). Furthermore, irradiation of neonatal Ptch1+/– animals can also substantially increase medulloblastoma occurrence (41) and can promote BCC precursor lesions to develop into nodular and infiltrative BCC (42). Therefore, we tested if DNA damage after ionizing radiation showed any differences in Ptch2–/– compared with WT animals. However, in contrast to Ptc1+/– animals (15), {gamma}-radiation of Ptch2+/– or Ptch2–/– P5 pups did not show any differences to controls as judged by radiation-induced apoptosis or increased tumor rate compared. These observations further confirm functional differences between Ptch1 and Ptch2.

Given the relatedness between Ptch1 and Ptch2, we introduced Ptch2 mutations onto a Ptch1+/– background. In this situation, we found that Ptch2 dosage dramatically affected the occurrence of tumors in Ptch1+/– animals. This was reflected as reduced tumor latency and also as the occurrence of frequent multiple tumors in Ptch1/Ptch2 mutants compared with Ptch1+/– animals. The comparable effect of Ptch2–/– and Ptch2+/– toward tumorigenesis in the Ptch1+/– mice may reflect the fact that Ptch2 levels are substantially reduced in Ptch2+/– tissues. Similar to other murine models of medulloblastoma, we found that histopathologic analysis could not discriminate Ptch1+/–Ptch2–/– mutant tumors from Ptch1+/– tumors. Additionally, double Ptch1/Ptch2 mutations did not alter the molecular fingerprint of the medulloblastoma, as overexpression of Gli1, Gli2, Sfrp1, and Math1 still occurred. Thus, although Ptch1+/– tumor dynamics are affected in Ptch2 mutations, the tumor identity is very similar to tumors arising in Ptch1+/– animals.

Although our data describing tumorigenesis in the Ptch1+/–Ptch2–/– mice highlight the crosstalk between Ptch1 and Ptch2, other available data also support a role for PTCH2 for preventing tumorigenesis. PTCH2 is located on chromosome 1p33-34 in human, and a portion of chromosome 1 containing 1p33-44 was missing in >15% of various human tumors, including breast, colon, lung, ovarian cancer, melanoma, neuroblastoma, and testicular germ cell tumor (43). Independently, similar observations were made in neuroblastoma, testicular germ cell tumors, sporadic colorectal polyps, and meningiomas (20, 21, 4446). In contrast, it has been reported that high PTCH2 (Ptch2) expression occurs in familial and sporadic BCC (22) and in multiple models of murine medulloblastoma (15), although it is likely that in these cases, Ptch2 overexpression may reflect activated SHH signaling (47) rather than as a specific component of tumorigenesis. Therefore, the potential role of Ptch2 as a tumor suppressor in other physiologic contexts besides Ptch1 mutations is clearly an area for further investigation.

In summary, we have provided the first evidence that Ptch2 can modulate tumorigenesis in select settings. Our data likely reflect the requirement for Ptch2 for subtle aspects of HH signaling, which can enhance tumorigenesis when suboptimal levels are present, probably via collaboration with Ptch1 loss to maintain persistent SHH signaling.


    Acknowledgments
 
Grant support: NIH grants NS-37956 and CA-21765, Cancer Center Support Grant P30 CA21765, and the American Lebanese and Syrian Associated Charities of St Jude Children's Research Hospital.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank the Hartwell Center, the Cancer Center Cytogenetics Core, and the Transgenic Core facility for their help with these studies.

Received 2/ 8/06. Revised 4/18/06. Accepted 4/26/06.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Hooper JE, Scott MP. Communicating with hedgehogs. Nat Rev Mol Cell Biol 2005;6:306–17.[CrossRef][Medline]
  2. Ruiz i, Altaba A, Sanchez P, Dahmane N. Gli and hedgehog in cancer: tumours, embryos and stem cells. Nat Rev Cancer 2002;2:361–72.[CrossRef][Medline]
  3. Wechsler-Reya R, Scott MP. The developmental biology of brain tumors. Annu Rev Neurosci 2001;24:385–428.[CrossRef][Medline]
  4. Berman DM, Karhadkar SS, Maitra A, et al. Widespread requirement for hedgehog ligand stimulation in growth of digestive tract tumours. Nature 2003;425:846–51.[CrossRef][Medline]
  5. Lum L, Beachy PA. The hedgehog response network: sensors, switches, and routers. Science 2004;304:1755–9.[Abstract/Free Full Text]
  6. Ruiz i, Altaba A, Nguyen V, Palma V. The emergent design of the neural tube: prepattern, shh morphogen and gli code. Curr Opin Genet Dev 2003;13:513–21.[CrossRef][Medline]
  7. Watkins DN, Berman DM, Burkholder SG, et al. Hedgehog signalling within airway epithelial progenitors and in small-cell lung cancer. Nature 2003;422:313–7.[CrossRef][Medline]
  8. Hahn H, Wicking C, Zaphiropoulous PG, et al. Mutations of the human homolog of Drosophila patched in the nevoid basal cell carcinoma syndrome. Cell 1996;85:841–51.[CrossRef][Medline]
  9. Johnson RL, Rothman AL, Xie J, et al. Human homolog of patched, a candidate gene for the basal cell nevus syndrome. Science 1996;272:1668–71.[Abstract]
  10. Taylor MD, Liu L, Raffel C, et al. Mutations in sufu predispose to medulloblastoma. Nat Genet 2002;31:306–10.[CrossRef][Medline]
  11. Zurawel RH, Allen C, Wechsler-Reya R, Scott MP, Raffel C. Evidence that haploinsufficiency of ptch leads to medulloblastoma in mice. Genes Chromosomes Cancer 2000;28:77–81.[CrossRef][Medline]
  12. Zurawel RH, Allen C, Chiappa S, et al. Analysis of ptch/smo/shh pathway genes in medulloblastoma. Genes Chromosomes Cancer 2000;27:44–51.[CrossRef][Medline]
  13. Wetmore C, Eberhart DE, Curran T. The normal patched allele is expressed in medulloblastomas from mice with heterozygous germ-line mutation of patched. Cancer Res 2000;60:2239–46.[Abstract/Free Full Text]
  14. Goodrich LV, Milenkovic L, Higgins KM, Scott MP. Altered neural cell fates and medulloblastoma in mouse patched mutants. Science 1997;277:1109–13.[Abstract/Free Full Text]
  15. Lee Y, Miller HL, Jensen P, et al. A molecular fingerprint for medulloblastoma. Cancer Res 2003;63:5428–37.[Abstract/Free Full Text]
  16. Uziel T, Zindy F, Xie S, et al. The tumor suppressors ink4c and p53 collaborate independently with patched to suppress medulloblastoma formation. Genes Dev 2005;19:2656–67.[Abstract/Free Full Text]
  17. Levy P, Vidaud D, Leroy K, et al. Molecular profiling of malignant peripheral nerve sheath tumors associated with neurofibromatosis type 1, based on large-scale real-time RT-PCR. Mol Cancer 2004;3:20.[CrossRef][Medline]
  18. Rahnama F, Toftgard R, Zaphiropoulos PG. Distinct roles of ptch2 splice variants in hedgehog signalling. Biochem J 2004;378:325–34.[CrossRef][Medline]
  19. Smyth I, Narang MA, Evans T, et al. Isolation and characterization of human patched 2 (ptch2), a putative tumour suppressor gene in basal cell carcinoma and medulloblastoma on chromosome 1p32. Hum Mol Genet 1999;8:291–7.[Abstract/Free Full Text]
  20. Sulman EP, Dumanski JP, White PS, et al. Identification of a consistent region of allelic loss on 1p32 in meningiomas: correlation with increased morbidity. Cancer Res 1998;58:3226–30.[Abstract/Free Full Text]
  21. Sulman EP, White PS, Brodeur GM. Genomic annotation of the meningioma tumor suppressor locus on chromosome 1p34. Oncogene 2004;23:1014–20.[CrossRef][Medline]
  22. Zaphiropoulos PG, Unden AB, Rahnama F, Hollingsworth RE, Toftgard R. Ptch2, a novel human patched gene, undergoing alternative splicing and up-regulated in basal cell carcinomas. Cancer Res 1999;59:787–92.[Abstract/Free Full Text]
  23. Frohlich L, Liu Z, Beier DR, Lanske B. Genomic structure and refined chromosomal localization of the mouse ptch2 gene. Cytogenet Genome Res 2002;97:106–10.[CrossRef][Medline]
  24. Motoyama J, Heng H, Crackower MA, et al. Overlapping and non-overlapping ptch2 expression with shh during mouse embryogenesis. Mech Dev 1998;78:81–4.[CrossRef][Medline]
  25. Motoyama J, Takabatake T, Takeshima K, Hui C. Ptch2, a second mouse patched gene is co-expressed with sonic hedgehog. Nat Genet 1998;18:104–6.[CrossRef][Medline]
  26. Carpenter D, Stone DM, Brush J, et al. Characterization of two patched receptors for the vertebrate hedgehog protein family. Proc Natl Acad Sci U S A 1998;95:13630–4.[Abstract/Free Full Text]
  27. Wetmore C, Eberhart DE, Curran T. Loss of p53 but not arf accelerates medulloblastoma in mice heterozygous for patched. Cancer Res 2001;61:513–6.[Abstract/Free Full Text]
  28. Pazzaglia S. Ptc1 heterozygous knockout mice as a model of multi-organ tumorigenesis. Cancer Lett 2006;234:124–34.[CrossRef][Medline]
  29. Hahn H, Wojnowski L, Zimmer AM, et al. Rhabdomyosarcomas and radiation hypersensitivity in a mouse model of Gorlin syndrome. Nat Med 1998;4:619–22.[CrossRef][Medline]
  30. Oliver TG, Read TA, Kessler JD, et al. Loss of patched and disruption of granule cell development in a pre-neoplastic stage of medulloblastoma. Development 2005;132:2425–39.[Abstract/Free Full Text]
  31. Chiang C, Litingtung Y, Lee E, et al. Cyclopia and defective axial patterning in mice lacking sonic hedgehog gene function. Nature 1996;383:407–13.[CrossRef][Medline]
  32. Litingtung Y, Lei L, Westphal H, Chiang C. Sonic hedgehog is essential to foregut development. Nat Genet 1998;20:58–61.[CrossRef][Medline]
  33. Belloni E, Muenke M, Roessler E, et al. Identification of sonic hedgehog as a candidate gene responsible for holoprosencephaly. Nat Genet 1996;14:353–6.[CrossRef][Medline]
  34. Roessler E, Belloni E, Gaudenz K, et al. Mutations in the human sonic hedgehog gene cause holoprosencephaly. Nat Genet 1996;14:357–60.[CrossRef][Medline]
  35. Ming JE, Kaupas ME, Roessler E, et al. Mutations in patched-1, the receptor for sonic hedgehog, are associated with holoprosencephaly. Hum Genet 2002;110:297–301.[CrossRef][Medline]
  36. Cooper AF, Yu KP, Brueckner M, et al. Cardiac and cns defects in a mouse with targeted disruption of suppressor of fused. Development 2005;132:4407–17.[Abstract/Free Full Text]
  37. Bitgood MJ, Shen L, McMahon AP. Sertoli cell signaling by desert hedgehog regulates the male germline. Curr Biol 1996;6:298–304.[CrossRef][Medline]
  38. Bajestan SN, Umehara F, Shirahama Y, et al. Desert hedgehog-patched 2 expression in peripheral nerves during wallerian degeneration and regeneration. J Neurobiol 2006;66:243–55.[CrossRef][Medline]
  39. Tong WM, Ohgaki H, Huang H, et al. Null mutation of DNA strand break-binding molecule poly(ADP-ribose) polymerase causes medulloblastomas in p53(–/–) mice. Am J Pathol 2003;162:343–52.[Abstract/Free Full Text]
  40. Lee Y, McKinnon PJ. DNA ligase iv suppresses medulloblastoma formation. Cancer Res 2002;62:6395–9.[Abstract/Free Full Text]
  41. Pazzaglia S, Mancuso M, Atkinson MJ, et al. High incidence of medulloblastoma following X-ray-irradiation of newborn ptc1 heterozygous mice. Oncogene 2002;21:7580–4.[CrossRef][Medline]
  42. Mancuso M, Pazzaglia S, Tanori M, et al. Basal cell carcinoma and its development: insights from radiation-induced tumors in ptch1-deficient mice. Cancer Res 2004;64:934–41.[Abstract/Free Full Text]
  43. Mertens F, Johansson B, Hoglund M, Mitelman F. Chromosomal imbalance maps of malignant solid tumors: a cytogenetic survey of 3185 neoplasms. Cancer Res 1997;57:2765–80.[Abstract/Free Full Text]
  44. Lothe RA, Andersen SN, Hofstad B, et al. Deletion of 1p loci and microsatellite instability in colorectal polyps. Genes Chromosomes Cancer 1995;14:182–8.[Medline]
  45. Ohtsu K, Hiyama E, Ichikawa T, Matsuura Y, Yokoyama T. Clinical investigation of neuroblastoma with partial deletion in the short arm of chromosome 1. Clin Cancer Res 1997;3:1221–8.[Abstract]
  46. Summersgill B, Goker H, Weber-Hall S, et al. Molecular cytogenetic analysis of adult testicular germ cell tumours and identification of regions of consensus copy number change. Br J Cancer 1998;77:305–13.[Medline]
  47. Ingram WJ, Wicking CA, Grimmond SM, Forrest AR, Wainwright BJ. Novel genes regulated by sonic hedgehog in pluripotent mesenchymal cells. Oncogene 2002;21:8196–205.[CrossRef][Medline]



This article has been cited by other articles:


Home page
aacredbookHome page
J. Xie
Activation of Hedgehog Signaling in Human Cancer: Basic Mechanisms and Clinical Implications
Am. Assoc. Cancer Res. Educ. Book, April 18, 2009; 2009(1): 25 - 41.
[Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
P.-O. Frappart, Y. Lee, H. R. Russell, N. Chalhoub, Y.-D. Wang, K. E. Orii, J. Zhao, N. Kondo, S. J. Baker, and P. J. McKinnon
Recurrent genomic alterations characterize medulloblastoma arising from DNA double-strand break repair deficiency
PNAS, February 10, 2009; 106(6): 1880 - 1885.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Kawamura, K. Hervold, F.-A. Ramirez-Weber, and T. B. Kornberg
Two Patched Protein Subtypes and a Conserved Domain of Group I Proteins That Regulates Turnover
J. Biol. Chem., November 7, 2008; 283(45): 30964 - 30969.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
M. Varjosalo and J. Taipale
Hedgehog: functions and mechanisms
Genes & Dev., September 15, 2008; 22(18): 2454 - 2472.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
Z Fan, J Li, J Du, H Zhang, Y Shen, C-Y Wang, and S Wang
A missense mutation in PTCH2 underlies dominantly inherited NBCCS in a Chinese family
J. Med. Genet., May 1, 2008; 45(5): 303 - 308.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, Y.
Right arrow Articles by McKinnon, P. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, Y.
Right arrow Articles by McKinnon, P. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online