| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Cell, Tumor, and Stem Cell Biology |
Divisions of 1 Experimental Pathology and 2 Anatomic Pathology Division, Institute of Pathology, University of Lausanne, Lausanne, Switzerland; and 3 Department of Genetics, Biology and Biochemistry, University of Turin, Turin, Italy
Requests for reprints: Ivan Stamenkovic, Division of Experimental Pathology, Institute of Pathology, University of Lausanne, CH-1011 Lausanne, Switzerland. Phone: 41-21-314-7136; Fax: 41-21-314-7110; E-mail: Ivan.Stamenkovic{at}chuv.hospvd.ch.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Sarcomas can be subdivided into two subclasses according to the genetic events that underlie or accompany their development. One subclass is associated with multiple complex chromosomal deletions, translocations, and duplications (13), whereas the other typically carries specific "signature" mutations. The majority of these are chromosomal translocations that lead to the generation of fusion proteins, most of which behave as aberrant transcription factors (13). Although expression of these fusion proteins is believed to underlie the pathogenesis of the bone and soft tissue tumors with which they are associated, the mechanism whereby they transform cells are still poorly understood. Equally incomplete is the understanding of the type of cellular environment that allows the fusion proteins to display their potential oncogenic properties. A major challenge to elucidating the pathogenesis of sarcomas, therefore, is the identification of the fusion protein/primary cell combination that underlies their development (2, 3).
Recently, we found that the EWS-FLI-1 fusion protein, which is associated with 85% of Ewing's sarcomas (also known as Ewing's family tumors or EFT) can transform primary wild-type bone marrowderived mesenchymal progenitor cells (MPCs) to form Ewing's sarcomalike tumors in mice (4). Moreover, EWS-FLI-1 expression in the absence of other pro-oncogenic events was sufficient to induce MPC transformation, suggesting that, in the appropriate cellular microenvironment, it may constitute the initiating event in EFT pathogenesis (4). Mesenchymal progenitor cells display a high degree of plasticity and can differentiate into osteocytes, adipocytes, neurons, and chondrocytes (5). Despite their bone marrow origin, MPCs can migrate to a broad range of tissues, including soft tissue compartments where most sarcomas develop (6). Based on these observations and the notion that sarcomas arise in pluripotent mesenchymal cells, we addressed the possibility that MPCs might provide the origin of other sarcomas associated with specific chromosomal translocations.
The EWS gene is the most frequent participant in chromosomal translocations that are specifically associated with sarcomas. Its fusion partners include FLI-1, ERG, ETV1, ETV4, and FEV (Ewing's sarcoma); ATF1 (clear cell sarcoma); WT1 (desmoplastic small round cell tumor); NR4A3 (myxoid chondrosarcoma); and CHOP/DDIT3 (myxoid liposarcoma; ref. 7). Interestingly, EWS shares functional properties with FUS/TLS (fused in sarcoma/translocated in sarcoma) that is also associated with sarcomas (8). Although less versatile than EWS, FUS can form fusion proteins with several partners, including ATF1 (angiomatoid fibrous histiocytoma), ERG (Ewing's sarcoma and acute myeloid leukemia), BBF2H7 (low-grade fibromyxoid sarcoma), and CHOP, t(12;16)(q13;p11) (myxoid liposarcoma; ref. 9). EWS and FUS/TLS contain structural features that are consistent with their implication in RNA processing (1013). The NH2-terminal domain of FUS/TLS binds to RNA polymerase II, whereas its COOH-terminal domain interacts with the transcription and translation factor Y-box binding protein -1. Within the FUS-CHOP fusion protein, the RNA-binding sequences of FUS are replaced by DNA-binding sequences and the basic leucine zipper domain of CHOP (11, 14). Similar to EWS, the NH2-terminal portion of FUS that forms the fusion proteins contains potent transactivation domains (10, 15). Thus, as in EWS fusion proteins, transcription is mediated by FUS sequences, whereas the DNA-binding motifs are provided by the fusion partner (10, 15).
In light of the transforming potential displayed by EWS-FLI-1 and the structural and functional similarities between EWS and FUS, we addressed the effect of the myxoid liposarcomaassociated FUS-CHOP and clear cell sarcomaassociated EWS-ATF1 fusion proteins on MPC transformation and tumor development. Myxoid liposarcoma accounts for more than a third of liposarcomas, which amounts to about 10% of all adult soft tissue sarcomas (1). Recent studies suggest that myxoid liposarcoma express genes implicated in neural and osteocytic differentiation, supporting the notion that these tumors may be derived from mesenchymal progenitor cells (16, 17). The synovial sarcomaassociated fusion protein SYT-SSX1, which failed to display oncogenic properties in MPCs in previous experiments (4), was used as a negative control for FUS-CHOP and EWS-ATF1.
Expression of FUS/TLS-CHOP in MPCs resulted in their transformation with development of myxoid liposarcomalike tumors. In contrast, MPCs expressing the EWS-ATF1 fusion protein failed to form tumors in vivo, as did SYT-SSX1 expressing cells. Our observations suggest that primary mesenchymal progenitor cells display selective permissiveness for sarcoma-associated fusion proteinmediated transformation, and that similar to EWS-FLI-1, FUS-CHOP expression can provide the single genetic event that is necessary and sufficient for the development of a defined soft tissue tumor from MPCs. Comparison of MPCEWS-FLI-1 and MPCFUS-CHOP tumors revealed distinct transcription profiles, consistent with different target gene repertoires of the fusion proteins and a common gene expression signature that may be linked to primary mesenchymal cell transformation.
| Materials and Methods |
|---|
|
|
|---|
Cloning and reverse transcription-PCR. The cDNA clones encoding the human FUS-CHOP and EWS-ATF1 fusion genes were amplified from frozen human specimens of myxoid liposarcoma and clear cell sarcoma, respectively, by reverse transcription-PCR (RT-PCR). Amplification was done using Super Script one-step RT-PCR with the platinum Taq kit (Invitrogen, Carlsbad, CA) under the following cycling conditions: one cycle at 50°C for 30 minutes and 94°C for 2 minutes followed by 35 cycles of 94°C for 45 seconds, 55°C for 45 seconds, 72°C for 2 minutes, and a final extension of 72°C for 10 minutes. The sequences of primers used for amplification were as follows: hFUS forward BglII, AGATCTCCACCATGGCCTCAAACGATTATACC; hCHOP reverse XhoI (including a stop codon), CTCGAGTCATGCTTGGTGCAGATTCAC; hEWS forward BglII, GGAAGATCTCCACCATGGCGTCCACGGATTACAG; hATF1 reverse EcoRV (including a stop codon), ATATCTCAAACACTTTTATTGGAATAAAG.
The amplified fragments were digested with BglII and XhoI or BglII and EcoRV and inserted into the pMSCV Puro retroviral expression vector (BD Biosciences Clontech, Palo Alto, CA). The V5 epitope tag was added at the 3' end of the FUS-CHOP sequence by PCR using the following primers: hFUS forward BglII, AGATCTCCACCATGGCCTCAAACGATTATACC; hCHOP V5 reverse (without a stop codon), AGGGTTAGGGATAGGCTTACCTTCGAACCGCGGGCCTGCTTGGTGCAGATT; V5 reverse HpaI (including a stop codon), GTTAACTCACGTAGAATCGAGACCGAGGAGAGGGTTAGGGATAGGCTTACC.
The amplified fragment was digested with XhoI and HpaI and inserted into the pMSCV Puro retroviral expression vector.
Plasmids were sequenced to verify cDNA integrity.
Retrovirus generation and infection. Expression of hFUS-CHOPV5 and hEWS-ATF1 in MPCs was achieved using a retroviral gene delivery method. Briefly, ecotropic packaging 293 cells were transfected either with fusion genes containing pMSCV Puro or an empty pMSCV Puro vector, using Superfect transfection reagent (Qiagen, Valencia, CA). Supernatants were collected after 72 hours, diluted 1:1 with MPCs medium containing 16 µg/mL of polybreen (Sigma), and added to six-well tissue culture plates containing 50% confluent MPCs. The plates were then centrifuged for 20 minutes at 1,800 rpm. RNA and proteins from infected cells were extracted at 24, 72 hours, and 10 days after infection. Expression of the fusion genes was tested at each time point by RT-PCR and Western blot (using the mouse anti-V5 or the rabbit anti-EWS antibody). The infected cells were selected as a bulk culture with 1.5 µg/mL puromycin for a minimum of 5 days and a maximum of 10 days.
cDNA array hybridization. Total RNA was extracted from each cell line using RNeasy Mini kit (Qiagen) according to the manufacturer's recommendations. The quality and the integrity of total RNA were verified by an Agilent RNA 600 nanoassay and by measuring the 260/280 absorbance ratio. Quality-tested total RNA was then amplified using the RiboAmp RNA Amplification kit (Arcturus, Mountain View, CA). After assessing the amplification by ethidium bromide agarose gel electrophoresis, the amplified RNA was processed using a reverse transcriptionbased method of label incorporation to yield labeled cDNA. For each sample, 5 µg of amplified RNA were used in the cDNA probe synthesis with Cy5-dCTP or Cy3-dCTP (Amersham Biosciences, Amersham, United Kingdom) and random primers. Probes were purified using a Mini Elute PCR purification kit (Qiagen) and concentrated using Centricon YM-30 filters (Amicon, Millipore, Billerica, MA). Expression analysis was done using the NIA 17k clone set (18), Quantifoil support array.4 Hybridization was done in hybridization chambers (Corning Costar, Cambridge, MA) in a 64°C water bath for 16 hours.
cDNA array analysis. Following hybridization and washing, microarrays were imaged using a ScanArray 4000 scanner (Perkin-Elmer, Foster City, CA), and scanned slide images were converted to a tagged image file format. Fluorescence ratios for array elements were extracted by using ScanAlyze software,5 and further primary data analysis was done using com.braju.sma routines in R statistical package.6,7 Cy5 (red) and Cy3 (green) signal intensities were used to calculate M and A for every spot on each array. M is a measure of differential gene expression and is calculated as the log 2 of the red and green intensity ratio (i.e., log 2 Cy5/Cy3). A is a measure of the signal strength that was calculated as the mean of the log 2 red and green intensity: (log 2 Cy5 + log 2 Cy3) / 2. M values were normalized using the library sma in the statistical software package R7 by the within-print-tip group Lowess normalization procedure (19). Quality control of slide hybridization was done using variables described on the corresponding web site.8
Statistical analysis of the expression data. For each time point and cell line, five m17k microarrays (among which two were dye swaps) were done comparing hFUS-CHOPV5 expressing with empty vector control cells. Expression data for each time point and cell line were analyzed with standard one-sample, two-sided t tests applied to the logarithm of the ratio of the expression levels of the hFUS-CHOPV5 and the control sample. The null hypothesis is that the mean of such a logarithm is 0, and the alternate hypothesis is that the mean is not equal to 0.
The use of a standard statistical test (as opposed to methods based on cutoff on fold-change) allowed us to estimate the false discovery rate (FDR) of the lists of induced and repressed genes. This was done using the Benjamini-Hochberg method (20), in which the clones are sorted by increasing t test P, and the list thus obtained is truncated in correspondence of the last gene for which the FDR estimator is lower than a preset value. The FDR estimator is given by (N x C) / n, where N is the total number of clones analyzed, C is the t test P of the gene, and n is its position in the list sorted by increasing P.
Western blot analysis. Cells were lysed for 20 minutes on ice in a nuclear lysis buffer containing 50 mmol/L Tris (pH 7.5), 0.5 mol/L NaCl, 1% NP40, 1% sodium deoxycholate, 0.1% SDS, 2 mmol/L EDTA, and complete protease inhibitors (Roche, Basel, Switzerland), and the lysates were then sonicated on ice thrice for 30 seconds. Samples were subjected to SDS-PAGE, and proteins were blotted onto polyvinylidene difluoride membranes (Millipore). Immunostaining was done after blocking with 5% nonfat dry milk, and bands were detected using a chemiluminescent substrate kit (Amersham Biosciences) according to the manufacturer's recommendations. Primary monoclonal mouse anti-V5 epitope (Invitrogen) or polyclonal rabbit anti-EWS (Bethyl Laboratories, Montgomery, TX) antibodies and secondary horseradish peroxidaseconjugated goat anti-mouse or anti-rabbit (Bio-Rad, Hercules, CA) antibodies were used.
Real-time quantitative RT-PCR. cDNA was obtained using an M-MLV reverse transcriptase and RNase H minus (Promega, Madison, WI). Typically, 500 ng of template total RNA and 250 ng of random hexamers were used per reaction. Real-time PCR amplification was done using a Taqman Universal PCR mastermix and Assays-On-Demand gene expression products in an ABI Prism 7700 instrument (Applied Biosystems, Foster City, CA). Relative quantitation of target, normalized with an endogenous control (cyclophyllin A), was done using a comparative Ct or a standard curve method (Applied Biosystems).
In vitro NVP-AEW541 sensitivity assays. For the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay, MPCs cells were cultured in 24-well plates and treated with normal medium, 0.5 µmol/L NVP-AEW541, or solvent (DMSO) for 10 days. Cell sensitivity for the drug was tested with CellTiter AQueous Non-Radioactive Cell Proliferation Assay (Promega) according to the manufacturer's recommendations.
Tumorigenicity assays. Five-week-old BALB/cJHanHsd-SCID mice were obtained from Harlan (Indianapolis, IN). For each MPC cell population, 12 mice were injected s.c. with 1.5 x 106 cells stably expressing either hFUS-CHOPV5, hEWS-ATF1, hSYT-SSX1, or empty vector. Tumor growth was monitored weekly, and tumor-bearing mice were euthanized 6 weeks after injection. Six mice were injected s.c. with 1.5 x 106 cells from each independent MPCs FUS-CHOP tumor-derived cell population and sacrificed 2 weeks after injection. All tumors were resected at autopsy and sectioned for histologic analysis. All experimental protocols involving mice were approved by the Etat de Vaud, Service Vétérinaire, authorization no. VD1477.0.
Tumor explants. Tumor-bearing mice were euthanized, and the tumors were excised, disaggregated in 4 mL of PBS supplemented with 10 % fetal bovine serum + Ca2+ and Mg2+, and resuspended for 40 minutes at 37°C in 15 mL of an enzymatic cocktail containing 2 mg collagenase VIII + 30 mg trypsin in 30 mL of PBS. The supernatants were then filtered and centrifuged for 6 minutes at 400 x g, and the resulting cellular pellets were plated in MPC medium without LIF, containing 1.5 µg/mL puromycin for tumor cell selection.
Immunohistochemistry. Paraffin-embedded sections of MPCsFUS-CHOP- and MPCsEWS-FLI-1-derived tumors were stained with mouse anti-human CD99 (1:40 dilution; Signet Laboratories, Dedham MA) and neural-specific enolase (NSE; 1:100 dilution; DAKO, Glostrup, Denmark) monoclonal antibody, or goat anti-human PDGF-A (1:100 dilution; R&D Systems). The latter antibody was also used to stain the human sarcoma paraffin sections. Horseradish peroxidase staining was done using biotin-conjugated horse anti-mouse or rabbit anti-goat immunoglobulin (DAKO) and revealed with a DAKO 3,3'-Diaminobenzidine kit (DAKO).
| Results |
|---|
|
|
|---|
Bulk cultures of retrovirally infected MPC were selected for further experiments. Expression of each fusion protein was verified by Western blot analysis of lysates of the corresponding MPCs using anti-v5 or anti-EWS antibodies. All three fusion proteins were observed to be stably expressed (Fig. 1 ), and no major morphologic changes were noted in any of the retrovirally infected cells.
|
|
Transcriptome modifications induced by FUS-CHOP in MPCs and MPCFUS-CHOP tumor cells. To determine the effect of FUS-CHOP on gene expression in MPCs, we compared transcription profiles of cells infected with FUS-CHOP containing retrovirus to those of corresponding cells infected with empty virus 24 and 72 hours as well as 14 days after infection. RNA was obtained from two independently FUS-CHOPinfected and two independently empty virus-infected cell populations, and expression of 17,000 cDNA clones was compared using the NIA-17K mouse cDNA array (18). Four microarrays were used to assess expression profile changes in each cell population. Expression data for each clone present on the microarray were analyzed with standard one-sample, two-sided t tests applied to the logarithm of the ratio of the expression levels of the MPCFUS-CHOP and MPCVector sample. This approach helped identify sets of FUS-CHOPinduced and repressed genes (Supplementary Data S1), and the false discovery rate (FDR) of each gene set was estimated by the Benjamini-Hochberg method as described in Materials and Methods. At 24 hours, 652 and 483 genes were respectively induced and repressed in response to FUS-CHOP expression with an FDR of 5%, whereas 610 and 555 genes, respectively, displayed induction and repression at 72 hours but with a 10% FDR (Supplementary Data S1). At 14 days, only 15 and 25 genes displayed induction and repression, respectively, with a 20% FDR. Interestingly, whereas infection of MPCs with retrovirus containing EWS-FLI-1 resulted in robust insulin-like growth factor-1 (IGF-1) induction (4), up-regulation of PDGFA but not of IGF-1 was observed in FUS-CHOPexpressing cells (Fig. 3 ).
|
Induction of PDGFA had not been reported in myxoid liposarcomas previously, which prompted us to validate its expression by quantitative real-time PCR analysis and assess PDGF
expression in MPCFUS-CHOP tumors and human myxoid liposarcomas by immunohistochemistry. Consistent with the quantitative real-time PCR data (Fig. 3C), MPCFUS-CHOP tumors stained positively with anti-PDGF
antibody as did all 10 samples of human myxoid liposarcoma tested (Fig. 3D). By contrast, synovial sarcoma, Ewing's sarcoma, and chondrosarcoma did not display PDGF
expression as detected by immunohistochemistry, whereas alveolar rhabdomyosarcoma showed only marginal reactivity with the antibody (Fig. 4
).
|
Consistent with the observed difference in the early response of MPCs to FUS-CHOP and EWS-FLI-1, the morphology and transcription profile of MPCEWS-FLI-1 and MPCFUS-CHOP tumors were divergent. Histologically, the tumors were distinct, with the former being characterized by sheets of small round blue cells and the latter by small often vacuolated cells with a richly vascularized myxoid matrix (Fig. 5
). NSE expression, which is associated with EFTs and MPCEWS-FLI-1 tumors, was not observed in MPCFUS-CHOP tumors (Fig. 5). Conversely, MPCFUS-CHOP tumor-associated PDGF
expression was lacking in MPCEWS-FLI-1 counterparts (Fig. 5).
|
being induced in MPCFUS-CHOP tumors but repressed in MPCEWS-FLI-1 counterparts (Fig. 6B; Supplementary Data S2). Consistent with these observations, MPCFUS-CHOP tumors did not recapitulate the high sensitivity displayed by MPCEWS-FLI-1 tumors to IGF-1R blockade by the pyrrolo[2,3-d]pyrimidine derivative small molecular weight kinase inhibitor AEW541 (refs. 4, 29; Fig. 6C).
|
| Discussion |
|---|
|
|
|---|
Similar to the effect of EWS-FLI-1, expression of FUS-CHOP alone was sufficient to transform MPCs and induce them to form tumors in vivo. Although it is widely held that development of solid tumors requires an average of three genetic events (30), many of the experiments on which this view is based were done in differentiated cells with limited plasticity and potential for self-renewal. Mesenchymal progenitor and hematopoietic stem cells retain high self-renewal proclivity, survival capacity, and migratory and invasive properties (31, 32), all of which constitute features of malignant cells. Our present observations are consistent with the possibility that in such an environment a single, appropriately targeted, genetic event may suffice to induce transformation. Attempts to develop transgenic models of liposarcoma using FUS-CHOP constructs driven by adipocyte-specific promoters failed, further suggesting that FUS-CHOP may require a mesenchymal progenitor/stem cell environment to exert its oncogenic potential. Consistent with this notion, transgenic mice engineered to express FUS-CHOP under the control of the ubiquitous E1F
promoter, which we found to be functional in MPCs (data not shown), developed liposarcomas that resemble their human counterpart (33). Up-regulation of neuronal transcripts PN-1, Neuronatin, and RET in myxoid liposarcoma cells compared with normal adipocytes (16, 34) add further support to a mesenchymal protenitor/stem cell origin of myxoid liposarcoma.
Transcriptome analysis of MPCFUS-CHOP tumor cells revealed up-regulation of genes observed to be associated with myxoid liposarcoma and FUS-CHOPtransfected NIH-3T3 cells. Several of these genes, including MDM2 (26), CDK4 (35), and HGFR (c-met; ref. 27), are believed to participate in myxoid liposarcoma development. The same may hold true for PDGF
, which has a potent promigratory and growth-promoting effect on mesenchymal cells, and whose association with myxoid liposarcoma was a novel discovery in this study. Although PDGF
expression is associated with a variety of malignancies (36), its robust induction in MPCs by FUS-CHOP expression and presence in myxoid liposarcoma suggests a possible role in the pathogenesis of these tumors, much as IGF-1 seems to be implicated in the pathogenesis of Ewing's sarcoma growth, without being EFT specific.
Our present observations cannot predict which of the induced/suppressed genes are direct FUS-CHOP targets and which are indirectly affected by FUS-CHOP, possibly secondary to FUS-CHOPinduced differentiation or transformation. However, it is likely that a combination of both direct and indirect targets contributes to MPCFUS-CHOP tumor development. Moreover, induction of genes that are associated with myxoid liposarcoma and proposed to participate in its pathogenesis supports the notion that MPCFUS-CHOP tumors constitute a relevant model of myxoid liposarcoma.
Direct comparison of the effect of FUS-CHOP and EWS-FLI-1 expression in MPCs revealed major differences not only in the altered transcript repertoire but in the inverse response of >300 genes to the two fusion proteins. Comparisons of MPCFUS-CHOP to MPCEWS-FLI-1 tumors further highlighted the difference in EWS-FLI-1 and FUS-CHOPmediated events. In addition to different histologic phenotypes, the tumors displayed distinct gene expression profiles consistent with the notion that despite a shared cell of origin, different signaling pathways underlie the pathogenesis of each tumor type. Thus, MPCFUS-CHOP tumors expressed PDGF
, HGF, and GFRA1 but did not up-regulate IGF-1 and, in contrast to MPCEWS-FLI-1 tumors, displayed only moderate sensitivity to IGF-1R blockade (4). Moreover, adipose tissue differentiation genes associated with MPCFUS-CHOP tumors, including FASN, HMGCR, and RGS2, were repressed in MPCEWS-FLI-1 tumor cells consistent with the notion that EWS-FLI-1 blocks adipocyte differentiation in MPCs (37). The absence of peroxisome proliferator-activated receptor
(PPAR
) induction suggests a partial adipose lineage differentiation block in MPCFUS-CHOP tumors as well, consistent with the proposed effect of FUS-CHOP on PPAR
activity (32, 3840).
Interestingly, many of the reported EWS-FLI-1 target genes and myxoid liposarcomaassociated genes were expressed in first round tumor cells but not in MPCs bearing the fusion proteins before injection. A possible explanation may be that a combination of transformation and in vivo growth conditions enables EWS-FLI-1 and FUS-CHOP bearing MPCs to express direct and indirect target genes of their respective fusion proteins. This notion is supported by the observation that EWS-FLI-1 expression resulted in the induction of several target genes in NIH-3T3 cells (41) but not in primary fibroblasts (42, 43).
Whereas distinct transcription profiles of MPCEWS-FLI-1 and MPCFUS-CHOP tumors could be anticipated, based on different target gene specificity of the respective fusion proteins, the shared expression profile of several genes that may be relevant to oncogenesis were unexpected. Both tumor types were associated with induction of yes-associated protein (YAP) and BIRC2, which are believed to be involved in promoting cell survival. Both tumors also displayed repression of genes encoding lumican, fat-associated tumor suppressor, caldesmon, and the adhesion receptors ALCAM, Jam-2 and Jam-3, and cadherin 11. Repression of lumican, a small secreted protoglycan, has been observed to augment tumor cell proliferation (44, 45), whereas loss of adhesion receptors may facilitate cell migration and invasion. The observed induction and suppression of genes common to the two tumors may constitute a transcription profile that reflects important events in mesenchymal cell transformation. It is noteworthy that this putative expression signature was unaffected by the duration of tumor growth, being detected in MPCFUS-CHOPT1 and MPCEWS-FLI-1T1, respectively, 6 and 15 weeks following injection of the corresponding cells.
Taken together, our observations support the notion that expression of FUS-CHOP in the appropriate cellular environment may be the initiating event in myxoid liposarcoma development. Coupled to our recent report that EWS-FLI-1 expression transforms primary MPCs, the present study indicates that transformation of MPCs may be induced by single, selected genetic events, and that MPCs may provide a common origin of both EFTs and myxoid liposarcomas. MPC-derived tumor models may facilitate elucidation of the mechanisms, whereby FUS-CHOP and EWS-FLI-1 transform primary mesenchymal cells and provide new insight into the molecular pathogenesis of some of the most aggressive malignancies.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| Footnotes |
|---|
4 For accurate description, see http://intranet.isrec.isb-sib.ch/microarrays/clones.html. ![]()
5 http://rana.lbl.gov/EisenSoftware.htm. ![]()
6 http://www.maths.lth.se/help/R/. ![]()
Received 11/ 7/05. Revised 3/30/06. Accepted 4/28/06.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
F. Grosso, R. Sanfilippo, E. Virdis, C. Piovesan, P. Collini, P. Dileo, C. Morosi, J. C. Tercero, J. Jimeno, M. D'Incalci, et al. Trabectedin in myxoid liposarcomas (MLS): a long-term analysis of a single-institution series Ann. Onc., August 1, 2009; 20(8): 1439 - 1444. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Forni, M. Minuzzo, E. Virdis, E. Tamborini, M. Simone, M. Tavecchio, E. Erba, F. Grosso, A. Gronchi, P. Aman, et al. Trabectedin (ET-743) promotes differentiation in myxoid liposarcoma tumors Mol. Cancer Ther., February 1, 2009; 8(2): 449 - 457. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-X. Ren, F. G. Finckenstein, D. A. Abdueva, V. Shahbazian, B. Chung, K. I. Weinberg, T. J. Triche, H. Shimada, and M. J. Anderson Mouse Mesenchymal Stem Cells Expressing PAX-FKHR Form Alveolar Rhabdomyosarcomas by Cooperating with Secondary Mutations Cancer Res., August 15, 2008; 68(16): 6587 - 6597. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Riggi, M.-L. Suva, D. Suva, L. Cironi, P. Provero, S. Tercier, J.-M. Joseph, J.-C. Stehle, K. Baumer, V. Kindler, et al. EWS-FLI-1 Expression Triggers a Ewing's Sarcoma Initiation Program in Primary Human Mesenchymal Stem Cells Cancer Res., April 1, 2008; 68(7): 2176 - 2185. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Perez-Mancera, C. Vicente-Duenas, I. Gonzalez-Herrero, M. Sanchez-Martin, T. Flores-Corral, and I. Sanchez-Garcia Fat-specific FUS-DDIT3-transgenic mice establish PPAR{gamma} inactivation is required to liposarcoma development Carcinogenesis, October 1, 2007; 28(10): 2069 - 2073. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Merlino and C. Khanna Fishing for the origins of cancer Genes & Dev., June 1, 2007; 21(11): 1275 - 1279. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |