
[Cancer Research 66, 7111-7118, July 15, 2006]
© 2006 American Association for Cancer Research
Cell, Tumor, and Stem Cell Biology |
RRIG1 Mediates Effects of Retinoic Acid Receptor ß2 on Tumor Cell Growth and Gene Expression through Binding to and Inhibition of RhoA
Zheng D. Liang1,
Scott M. Lippman1,
Tsung-Teh Wu2,
Reuben Lotan3 and
Xiao-Chun Xu1
Departments of 1 Clinical Cancer Prevention, 2 Pathology, and 3 Thoracic/Head and Neck Medical Oncology, The University of Texas M.D. Anderson Cancer Center, Houston, Texas
Requests for reprints: Xiao-Chun Xu, Department of Clinical Cancer Prevention, Unit 1360, The University of Texas M.D. Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, TX 77030. Phone: 713-745-2940; Fax: 713-563-5747; E-mail: xxu{at}mdanderson.org.
 |
Abstract
|
|---|
The expression of retinoic acid receptor ß2 (RAR-ß2) is frequently lost in various cancers and their premalignant lesions. However, the restoration of RAR-ß2 expression inhibits tumor cell growth and suppresses cancer development. To understand the molecular mechanisms responsible for this RAR-ß2-mediated antitumor activity, we did restriction fragment differential display-PCR and cloned a novel retinoid receptorinduced gene 1 (RRIG1), which is differentially expressed in RAR-ß2-positive and RAR-ß2-negative tumor cells. RRIG1 cDNA contains 2,851 bp and encodes a protein with 276 amino acids; the gene is localized at chromosome 9q34. Expressed in a broad range of normal tissues, RRIG1 is also lost in various cancer specimens. RRIG1 mediates the effect of RAR-ß2 on cell growth and gene expression (e.g., extracellular signalregulated kinase 1/2 and cyclooxygenase-2). The RRIG1 protein is expressed in the cell membrane and binds to and inhibits the activity of a small GTPase RhoA. Whereas induction of RRIG1 expression inhibits RhoA activation and f-actin formation and consequently reduces colony formation, invasion, and proliferation of esophageal cancer cells, antisense RRIG1 increases RhoA activity and f-actin formation and thus induces the colony formation, invasion, and proliferation of these cells. Our findings therefore show a novel molecular pathway involving RAR-ß2 regulation of RRIG1 expression and RRIG1-RhoA interaction. An understanding of this pathway may translate into better control of human cancer. (Cancer Res 2006; 66(14): 7111-8)
 |
Introduction
|
|---|
The altered expression of nuclear retinoid receptors has been shown to correlate with malignant transformation of human cells. In particular, the loss of retinoic acid receptor ß2 (RAR-ß2) expression has been shown to be the most common event in different human cancers (1, 2). We and others have previously shown that the presence of suppressed RAR-ß2 expression in the early stages of carcinogenesis and the modulation of RAR-ß2 in vivo by retinoids can be used as biomarkers (13). Notably, however, RAR-ß2 was not inducible by a pharmacologic level of RA in many lung, breast, and esophageal cancer cell lines, and these cells were also resistant to RA-induced growth inhibition (46). Furthermore, lung carcinoma cells expressing transfected RAR-ß2 exhibited decreased tumorigenicity in nude mice (7) and transgenic mice expressing antisense RAR-ß2 developed lung cancer (8). RAR-ß2 was also suppressed in breast cancer metastases in a mouse xenograft model (9). Knocking out RAR-ß2 by homologous recombination in F9 cells resulted in the loss of RA-associated growth arrest and an altered cell morphology and differentiation potential (10). The induction of RAR-ß2 expression inhibited the growth of various cancers, induced tumor cells to undergo apoptosis, and suppressed cancer development in vitro and in vivo (1, 2). In particular, the expression of RAR-ß2 in esophageal cancer cells suppressed tumor cell growth and colony formation and induced apoptosis (11), which correlated with the suppression of the epidermal growth factor (EGF) receptor (EGFR), of the phosphorylation of extracellular signalregulated kinases 1 and 2 (Erk1/2), and of the expression of activating protein 1 and cyclooxygenase-2 (COX-2; ref. 12). Furthermore, benzo[a]pyrene diol epoxide, a carcinogen present in tobacco smoke and environmental pollution, suppressed RAR-ß2 expression in a premalignant and different malignant esophageal cell lines (12, 13). Molecularly, RAR-ß2 inhibited the EGFR/mitogen-activated protein kinase molecular pathway and COX-2 expression (11, 12).
Together, these studies show that RAR-ß2 plays an important role in the suppression of cancer development, suggesting that it is a tumor suppressor gene and that loss of RAR-ß2 expression alters the downstream signaling pathway of the gene. Although the precise molecular mechanisms responsible for RAR-ß2-mediated effects on antitumor activities are not well understood, several studies have investigated the possible role of RAR-ß2-targeting genes (1416). We have identified, through restriction fragment differential display-PCR, several cDNA fragments of which the levels were different between RAR-ß2-positive or RAR-ß2-negative esophageal cancer cells. One fragment was matched to DNA sequences at chromosome 9q34, which has shown frequent loss of heterozygosity in human cancers (1719). Using cDNA from this fragment as a probe for in situ hybridization, we established that normal esophageal mucosa expressed the mRNA of this fragment but that esophageal cancer tissues lost such expression. We therefore cloned the full-length cDNA and named it retinoid receptorinduced gene 1 (RRIG1). In the current study, we further characterize the RRIG1 gene and describe a novel pathway involving RRIG1-RhoA interaction.
 |
Materials and Methods
|
|---|
Cell lines and culture. The esophageal squamous cancer cell lines TE-3, TE-7, and TE-8; their sublines TE3-A3, TE3-A5, TE8-S20, and TE8-S22; and esophageal adenocarcinoma cell line SKGT-4 were available from our previous studies (1113). The breast cancer cell lines MCF-7, MDA453, and SK-BR3 were obtained from American Type Culture Collection (Manassas, VA). The lung cancer cell line Calu-1, colon cancer cell line DLD-1, and prostate cancer cell line PC3 were from the laboratory of one of the authors (R.L.). The normal esophageal cell line EEC, which was a generous gift from Dr. Yutaka Shimada (Department of Surgery and Surgical Basic Science, Graduate School of Medicine, Kyoto University, Kyoto, Japan), was available from our previous study (20).
All cancer cell lines were plated in tissue-culture dishes and grown in DMEM with 10% FCS at 37°C in a humidified atmosphere of 95% air and 5% CO2. The normal cells were grown in keratinocyte serum-free medium containing 2.5 µg/mL EGF and 25 µg/mL bovine pituitary extract at 37°C in a humidified atmosphere of 95% air and 5% CO2. For restriction fragment differential display-PCR, TE-8 cells were transiently transfected with a RAR-ß2 expression vector, followed by cell sorting to retain RAR-ß2-positive cells. The pMark7/RAR-ß2 vector, which was previously described (21), was used for transfection, and an anti-CD7 antibody and MagnaBind goat anti-mouse immunoglobulin G beads (both from Pierce Chemical Company, Rockford, IL) were used for sorting. mRNAs from TE-8, TE8-S20 (a stable RAR-ß2-transfected TE-8 subline), and TE-8/RAR-ß2 (TE-8 cells with transient RAR-ß2 transfection) cells were then subjected to restriction fragment differential display-PCR assay.
Tissue specimens. Paraffin-embedded blocks of lung, breast, prostate, and pancreatic cancer tissues were obtained from the Pathology Department of The University of Texas M.D. Anderson Cancer Center. Eighty-four esophageal cancer specimens were available from our previous study (22). These specimens included 66 distant normal squamous mucosae. All samples were routinely fixed in 10% buffered formalin, embedded in paraffin, and cut into 4-µm sections. One each of the four sections was stained with H&E for classification.
Restriction fragment differential display-PCR. RNA from TE-8, TE-8S20, and TE-8/RAR-ß2 cells was isolated with TRI-reagent (Molecular Research Center, Cincinnati, OH). mRNA was further purified from the total RNA with the NucleoTrap mRNA kit (BD Clontech, Palo Alto, CA) according to the instructions of the manufacturer. Restriction fragment differential display-PCR was done with a display profile kit (BD Clontech) according to the kit instructions. To recover the differential display cDNA fragments, we cut PCR bands from the gel and placed them into microtubes containing 50 µL of Tris-EDTA buffer. After heating the tubes at 95°C for 15 minutes, cDNA from the PCR bands was reamplified with PCR and cloned into a pGEM5Zf(+) vector (Promega, Madison, WI).
In situ hybridization. A previously described method of nonradioactive in situ hybridization was used (5, 22). The plasmid pGEM5Zf(+) containing the RRIG1 cDNA fragment was linearized with the SacI restriction enzyme, which generated a 1.3-kb fragment for labeling the riboprobes with digoxigenin-UTP using T7 polymerase. We verified the binding quality and specificity of the digoxigenin-labeled antisense RNA probe using negative control sections.
Immunohistochemical analysis. The immunohistochemical localization of the RRIG1 and f-actin was done using a modified avidin-biotin complex technique previously described (23), with a polyclonal anti-RRIG1 antibody at a dilution of 1:800 and phalloidin-TRITC (Sigma Chemical Co., St. Louis, MO) at a concentration of 50 µg/mL (24).
Review and scoring of sections. The stained sections were reviewed and scored under an Olympus microscope. The sections were scored for positive or negative staining only; positive staining meant that
10% epithelial cells were stained (22, 23). Statistical analyses were done with the McNemar's test to determine the association between normal tissues and tumors and the Kendall test for the correlation of RAR-ß2 and RRIG1 expression. P values were generated using Statistica 4.01 software (StatSoft, Tulsa, OK).
Northern blotting. mRNA (2 µg per lane) was fractionated on a 0.66 mol/L formaldehyde and 1.2% agarose gel and then transferred overnight to a Hybond-N+ nylon membrane (GE-Amersham, Piscataway, NJ). RNA was fixed to the membrane by UV cross-linking. In addition, a nylon membrane, containing 1 µg of mRNA each from different normal human tissues, was obtained from BD Clontech. RRIG1 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNAs were labeled with [32P]dCTP (ICN Biomedicals, Costa Mesa, CA) to a specific activity of
1 x 109 dpm/µg with a random primer labeling kit (Prime It II, Stratagene, La Jolla, CA), and the membranes were hybridized with RRIG1 or a GAPDH probe, as in our previous publications (5, 1113).
Transcription-translation assay and antibody generation. In vitro transcription-translation that used the open reading frame of RRIG1 cDNA was carried out with the TNT T7 coupled reticulocyte lysate system (Promega) labeled with [35S]cysteine and the products were separated by 12% SDS-PAGE. The dried gels were subsequently analyzed with autoradiography. We then chose the CAADGLRKPQVHSARAL peptide as an antigen to generate a polyclonal rabbit anti-RRIG1 antibody (Lampire Biological Laboratories, Pipersville, PA).
Protein extraction and Western blotting. Total cellular or nuclear protein from the cell lines was isolated as previously described (1113). First, 50 µg of protein were subjected to electrophoresis in 12% SDS-PAGE. The proteins were then transferred electrophoretically to a Hybond-C nitrocellulose membrane (GE-Amersham) at 300 mA for 2 hours at 4°C and subjected to Western blotting with either an anti-RRIG1 antibody at a dilution of 1:2,000 or an anti-ß-actin antibody (Sigma) following a standard procedure.
Transient gene transfection. Esophageal cancer cell lines were subcultured overnight and transiently transfected with 2 µg of a pcDNA3.1/RRIG1 sense or antisense expression vector and Cos-1 cells with pUSEamp containing activated, dominant-negative, or wild-type RhoA (Upstate, Lake Placid, NY) for 24 hours. The cells were then treated with 200 µg/mL G418 and/or hygromycin B (Roche, Indianapolis, IN) for 5 days to eliminate nontransfected cells. Thereafter, mRNA and protein were extracted from these cells and subjected to Northern and Western blotting analyses, respectively.
RhoA activation assay. TE-8 and SKGT-4 cells were transfected with pcDNA3.1 (control) or a pcDNA3.1/RRIG1 sense or antisense construct and then were treated with the antibiotic G418 for 5 days. After that, the cells were detached with 0.05% trypsin, counted, reseeded, and cultured in new culture dishes in DMEM with 10% FCS for 16 hours and then in DMEM without FCS for an additional 12 hours. To activate the RhoA, we cultured the cells in DMEM with 10% FCS for 3 hours; after which, the total cellular protein was extracted in an ice-cold lysis buffer containing 20 mmol/L Tris-HCl (pH 7.5), 10 mmol/L MgCl2, 150 mmol/L NaCl, 1 mmol/L Na2 EDTA, 1 mmol/L EGTA, 1% Triton X-100, 2.5 mmol/L sodium pyrophosphate, 1 mmol/L ß-glycerophosphate, 1 mmol/L Na3VO4, and 1 µg/mL leupeptin. The activated GTP-bound Rho protein in the cell lysates was pulled down using a recombinant glutathione S-transferase (GST)tagged rhotekin-Rho binding domain (Upstate) and analyzed with Western blotting using an anti-RhoA antibody (Santa Cruz Biotechnology, Santa Cruz, CA). Levels of the activated RhoA protein were normalized with total RhoA from cell lysates not subjected to the pulldown assay.
Chemoinvasion assay. The same transfected cells (5 x 104) as for the RhoA activation assay were then resuspended in medium and put into Matrigel-coated Boyden chambers (BD Biosciences, Bedford, MA) in triplicate. The lower chamber was filled with 10% FCS as the chemoattractant and incubated for 22 hours. The cells on the upper surface were then removed by wiping the surface with a cotton swab; the cells that had invaded the Matrigel and attached to the lower surface of the filter were fixed and stained with H&E. The Matrigel membranes were then gently removed from the chamber, mounted onto glass slides, and photographed for four microscopic fields (x100 magnification) per chamber. The cells on the photomicrographs were counted and the results were summarized as mean ± SD and presented as the percentage of controls.
Colony formation assay. TE-8 and SKGT-4 cells were transfected with a pcDNA3.1 (control) or with a pcDNA3.1/RRIG1 sense or antisense construct and then treated with G418 antibiotic for 5 days. The cells were detached with 0.05% trypsin and counted; 2,000 of the cells were resuspended in the medium with 0.35% agarose and were then placed into 6-well cell culture plates with 0.5% agarose. The medium was refreshed every 3 days with G418 and the surviving cell colonies were counted 21 days later (5).
5-Bromo-2'-deoxyuridine incorporation assay. TE-8, TE8-V1, and TE8-S20 cells were grown in monolayers for 24 hours and transiently transfected with either the pCMS/EGFP-RRIG1 expression vector or the pCMS/EGFP empty vector (BD Clontech) as a control for 36 hours; 10 µmol/L 5-bromo-2'-deoxyuridine (BrdUrd) was then added to the growth medium and the cells were cultured for an additional 4 to 8 hours. The cells were fixed with 4% paraformaldehyde at room temperature for 10 minutes to preserve the green fluorescent protein (GFP) and were permeabilized in 1% Triton X-100 for 20 minutes at room temperature. The cells were then subjected to BrdUrd immunostaining as previously described (23). After that,
200 cells were counted for positive staining of GFP and for positive or negative BrdUrd staining. The percentage of inhibition of BrdUrd incorporation was calculated using the following equation: % of inhibition = 1 (Nb / Ng) x 100, where Nb is the number of BrdUrd-positive cells of the GFP-positive cells from RRIG1 transfected cultures and Ng is the number from control cultures.
 |
Results
|
|---|
Detection of RRIG1 expression and its correlation with RAR-ß2 in tissue samples. To explore the underlying molecular mechanisms for RAR-ß2 antitumor activities, we did restriction fragment differential display-PCR experiments on TE-8V1 (a vector-onlytransfected TE-8 subline), TE-8S20 (a stable RAR-ß2-transfected TE-8 subline), and TE-8/RAR-ß2 (a transient RAR-ß2-transfected TE-8 cell line) cells. We identified several cDNA fragments of which the levels were differentially expressed between RAR-ß2-positive and RAR-ß2-negative esophageal cancer cells. One of the fragments matched DNA sequences at chromosome 9, which shows frequent loss of heterozygosity in human cancers (1719). We therefore used cDNA from this fragment as a probe for in situ hybridization to analyze RRIG1 mRNA expression in formalin-fixed, paraffin-embedded tissues from different cancers. RRIG1 mRNA was detected in 1 of 5 lung cancers, 2 of 5 prostate cancers, 2 of 5 breast cancers, 1 of 5 pancreatic cancers, and 43 of 84 (51.2%) esophageal cancers (data not shown). However, 61 of 66 (92.4%) normal esophageal mucosae from the sectioned margin of the esophageal cancer specimens expressed RRIG1 mRNA. This difference between normal and cancerous esophageal specimens was statistically significant (P < 0.00001, McNemar's test). Furthermore, RRIG1 mRNA expression closely correlated with RAR-ß2 mRNA expression in RAR-ß2-stained sections from our previous study (ref. 22;
= 0.45; SE, 0.07; P < 0.00005, Kendall's test).
Cloning and characterization of RRIG1. RRIG1 was cloned using a 3'/5' rapid amplification of cDNA ends and confirmed by the primer extension assay (data not shown), of which the full-length cDNA included 1,947 bp in the 5'-end untranslated region, 831 bp in the coding sequence, and 15 bp in the 3'-end untranslated region; the corresponding RRIG1 protein had a predicted molecular mass of 28.67 kDa (Fig. 1
). Northern blot analysis with RRIG1 cDNA used as a probe revealed that RRIG1 mRNA was expressed in normal human tissues, with the highest expression levels in the brain, heart, muscle, and placenta and the lowest levels in the liver, spleen, lung, and leukocytes (Fig. 2A
). However, RRIG1 mRNA and protein expression was lost in some tumor cells (Fig. 2B). All-trans RA, which can induce RAR-ß2 expression in the TE-3 and TE-7 esophageal cancer cell lines (5), slightly increased RRIG1 mRNA expression, whereas benzo[a]pyrene diol epoxide, which can reduce RAR-ß2 expression (12, 13), inhibited RRIG1 mRNA expression (Fig. 2C). However, all-trans RA could not induce RRIG1 expression in RAR-ß2-negative TE-8 cells or stable RAR-ß2-transfected TE-8S20 or TE-8S22 cells (Fig. 2D).

View larger version (64K):
[in this window]
[in a new window]
|
Figure 1. Sequence of RRIG1 cDNA. The underlined amino acid sequence was used to generate a rabbit anti-RRIG1 polyclonal antibody. Sequence analysis (PHD_htm program; European Molecular Biology Laboratory, Heidelberg, Germany) predicted the RRIG1 protein to have a transmembrane helix. Specifically, amino acid residues 1 to 179 faced the outside of the cell membrane, residues 180 to 197 lay within the membrane, and residues 198 to 276 faced the cytoplasm.
|
|

View larger version (25K):
[in this window]
[in a new window]
|
Figure 2. Expression and modulation of RRIG1. A, tissue distribution of RRIG1 mRNA. A nylon membrane containing 1 µg of mRNA from each different normal human tissue was subjected to Northern blotting according to the instructions of the manufacturer. B, expression of RRIG1 in human cancer cell lines of the esophagus (TE-8, TE-8S22, TE-7, and TE-1), lung (Calu-1), breast (MDA453), colon (DLD-1), and prostate (PC3) and in normal human esophageal epithelial cells (EEC). mRNA from these cells was extracted and subjected to Northern blot analysis with RRIG1 cDNA used as a probe. GAPDH was used as a loading control. In an analysis of the RRIG1 protein distribution, total protein from these same cell lines was extracted and subjected to Western blotting with the anti-RRIG1 antibody. NS, nonspecific band. C, esophageal cancer TE-3 and TE-7 cells were treated with 1 µmol/L all-trans RA or 1 µmol/L benzo[a]pyrene diol epoxide (BPDE) for 16 hours, and mRNA from these cells was then isolated and subjected to Northern blotting. C, control. D, stable RAR-ß2-transfected esophageal cancer cell sublines TE-8S20 and TE-8S22 and vector-only subline TE-8V1 were treated with or without 1 µmol/L all-trans RA for 24 hours; after which, the total cellular protein from these cells was extracted and subjected to Western blotting.
|
|
To further characterize RRIG1, we did in vitro transcription-translation experiments (data not shown) and generated a polyclonal rabbit anti-RRIG1 antibody. Western blotting using this antibody showed that expression of RRIG1 protein correlated well with RRIG1 mRNA, as shown by Northern blotting (Fig. 2B). Furthermore, our findings from immunohistochemical analysis and in situ hybridization also showed a good correlation between RRIG1 mRNA and protein (Fig. 3A
). Therefore, we assessed RRIG1 expression by doing an immunohistochemical analysis with this antibody in breast cancer tissue specimens and found that RRIG1 protein expression was significantly higher in normal mammary glands (10 of 10 cases) than in invasive breast cancer tissue [14 of 30 (46.7%); P = 0.0023, Fisher's exact test; data not shown].

View larger version (68K):
[in this window]
[in a new window]
|
Figure 3. Expression of RRIG1 mRNA and protein. A, paraffin-embedded sections of adjacent normal and cancerous esophageal specimens were subjected to in situ hybridization and immunohistochemical analysis with a digoxigenin-labeled RRIG1 cRNA probe or a polyclonal anti-RRIG1 antibody, respectively. The purple-blue and brown colors show positive staining for mRNA and protein, respectively. SCC, squamous cell carcinoma. B, immunofluorescent staining of intact and living cells using the anti-RRIG1 antibody in negative (TE-8) and positive (TE-7) esophageal cancer cell lines. C, immunoprecipitation assay of biotinylated cell-surface proteins in negative (TE-8) and positive (TE-7) esophageal cancer cell lines. The cells were grown in monolayer for 5 days and then labeled with sulfo-NHS-LC-Biotin for cell-surface protein. The total cell lysate was then subjected to an immunoprecipitation assay with anti-RRIG1 antibody and to detection with a biotin-avidin complex and chemiluminescence solution.
|
|
A GenBank search for the RRIG1 protein did not reveal homology to any existing proteins but instead predicted that RRIG1 is a transmembrane protein with the NH2 terminus facing outward and the COOH terminus facing inward in the cells. Additionally, the NH2 terminus of the RRIG1 protein contains two putative Src homology 3 (SH3) domain-binding motifs (i.e., 63-PRAPHPP-69 and 152-LPVLSSPPTP-161), both of which contain PXXP (25). Immunohistochemical analysis using the anti-RRIG1 antibody showed that the RRIG1 protein is localized in the cell membrane (Fig. 3A). Furthermore, after we stained intact and living esophageal cancer cells with the anti-RRIG1 antibody, our data showed that the RRIG1 protein was localized on the cell surface (Fig. 3B). Further support for the cell-surface localization of RRIG1 was obtained by labeling cell-surface proteins on intact cells with sulfo-NHS-LC-biotin, followed by immunoprecipitation with an anti-RRIG1 antibody after cell membrane solubilization and analysis of immunoprecipitates on a SDS-PAGE. An avidin-biotin complex kit was then used to identify cell-surface biotinylated proteins. The positive band revealed that the native size of the RRIG1 protein was
28.7 kDa (Fig. 3C).
By comparing the RRIG1 cDNA with DNA sequences of chromosome 9 available in GenBank, we identified the intron-exon boundaries of the RRIG1 gene (Table 1
) and found a direct repeat of 18 putative retinoic acid response element sites (AGGTCAAAGTGGTTGGATCACCTGAGGTCA) 5,160 bp upstream of the RRIG1 cDNA. Further study is needed to determine whether this direct repeat site is a functional retinoic acid response element site.
RRIG1, a downstream gene of RAR-ß2. Because our data clearly indicated that RRIG1 expression was closely associated with RAR-ß2 expression, we next determined whether the RRIG1 gene mediates RAR-ß2 effects on tumor cell growth and gene expression. In analyzing RRIG1 expression in stable RAR-ß2-transfected esophageal cancer cell lines (11), we found that RAR-ß2 induced RRIG1 expression and reduced Erk1/2 phosphorylation and COX-2 expression, whereas antisense RAR-ß2 reduced RRIG1 expression and increased Erk1/2 phosphorylation and COX-2 expression in monolayer cultures subjected to a physiologic level of RA (Fig. 4A
) and in organotypic cultures and nude mice xenografts (data not shown). We further transiently transfected the sense or antisense RRIG1 expression vector into these stable RAR-ß2-transfected cancer cell lines. Our findings showed that the antisense RAR-ß2-transfected TE-3 cell lines TE3-A3 and TE3-A5 down-regulated RRIG1 expression and up-regulated Erk1/2 phosphorylation and COX-2 expression, whereas transient transfection of the RRIG1 expression vector into these cell lines restored RRIG1 expression and suppressed Erk1/2 phosphorylation and COX-2 protein expression in monolayer cultures subjected to a physiologic level of RA (Fig. 4B and C). In contrast, stable RAR-ß2-transfected TE-8 cells (i.e., TE8-S20 and TE8-S22 cells) induced RRIG1 expression but suppressed Erk1/2 phosphorylation and COX-2 expression, but antisense-RRIG1 transfection not only suppressed RRIG1 protein levels but also induced Erk1/2 phosphorylation and COX-2 expression (Fig. 4B and C). In addition, transient RRIG1 antisense transfection into TE8-V1 and TE-8S22 cells showed that expression of RAR-ß2 reduced cell proliferation by 29% in a 40-hour culture between pCMS/EGFP vector-onlytransfected TE8-V1 and TE-8S22 cells but antisense RRIG1 transfection increased cell proliferation by 25% between TE8-V1 and TE-8S22 cells, as shown by the percentage of BrdUrd-positive cells among the vector-only and antisense RRIG1transfected cells. Taken together, these data clearly show that RRIG1 mediates the effects of RAR-ß2 on tumor cell growth and gene expressions, at least in esophageal cancer cells.

View larger version (25K):
[in this window]
[in a new window]
|
Figure 4. RRIG1 modulation of RAR-ß2 effects on gene expression. A, stable RAR-ß2-transfected TE-8 sublines TE-8S20 and TE-8S22, stable antisense RAR-ß2-transfected TE-3 sublines TE-3A3 and TE-3A5, and vector-control sublines TE-8V1 and TE-3V1 were grown in monolayer for 5 days in DMEM containing 10% FCS and 200 µg/mL G418. Total cellular and nuclear proteins were then extracted and subjected to Western blot analysis for RAR-ß2 and Erk1/2 or RRIG1 and COX-2 expression, respectively. B, stable RAR-ß2-transfected TE-8 sublines TE-8S20 and TE-8S22 and the vector-control TE-8V1 subline were transiently transfected with vector only or antisense RRIG1 expression vector pcDNA3.1-RRIG1AS/hygromycin. The stable antisense RAR-ß2-transfected TE-3 sublines TE-3A3 and TE-3A5 and the vector-control subline TE-3V1 were transiently transfected with vector only or the RRIG1 expression vector pcDNA3.1-RRIG1/hygromycin. These cells were then grown in DMEM containing 10% FCS and 200 µg/mL G418 and hygromycin for 5 days; after which, total cellular protein was extracted and subjected to Western blot analysis. S, sense vector; AS, antisense vector. C, quantitation of the Western blots shown in (B) using NIH ImageJ 1.34s software. Expression levels of each gene were quantified and summarized as percentage of control (ß-actin). The data were then plotted as vector-only and RRIG1 transfection and labeled for easy comparison.
|
|
RRIG1 binds to RhoA-GTP and suppresses its activity. To identify RRIG1 protein binding partners, we expressed the GST-RRIG1 fusion protein in vitro and then did a GST pulldown assay. Several possible RRIG1-binding partners were identified, which had molecular masses ranging from 20 to 100 kDa (data not shown). We surmised that some of these proteins should be membrane associated. Indeed, one of them was similar in size with the small GTPase proteins. Western blotting of the GST pulldown protein with anti-RhoA antibody showed that this protein was RhoA bound to RRIG1 (Fig. 5A
). For further confirmation, we did an immunoprecipitation assay with an anti-RRIG1 antibody and then Western blotting with an anti-RhoA antibody in total cell lysates of RRIG1-positive and RAR-ß2-negative breast cancer cells. The data obtained also showed that RRIG1 bound to RhoA (Fig. 5B).

View larger version (20K):
[in this window]
[in a new window]
|
Figure 5. RRIG1 binding to RhoA and suppression of RhoA activation. A, GST-RRIG1 fusion protein pulldown and Western blot assays. After GST-RRIG1 pulldown with a TE-7 cell lysate, results of Western blotting with an anti-RhoA antibody showed RRIG1 binding to RhoA whereas GST alone did not. B, immunoprecipitation-Western blotting assay. Total cellular protein lysates were immunoprecipitated with anti-RRIG1 antibody and then subjected to Western blot analysis with anti-RhoA antibody. The negative (NC) and positive (PC) controls were from the GST and the GST-RRIG1 fusion protein pulldown assays, respectively. C, RhoA activation assay. The active, dominant-negative, and wild-type forms of RhoA plasmids were first transiently transfected into Cos-1 cells, and the cell cultures were treated with G418 for 5 days. Thereafter, total cellular protein was extracted and 200 µg of each protein were subjected to a GST-RRIG1 pulldown assay and Western blotting with an anti-RhoA antibody. D, RhoA activation assay. TE-8 and SKGT-4 were transiently transfected with vector only (control) or with an RRIG1 sense or antisense expression vector and treated with G418 for 5 days. The total cell lysates were then subjected to RhoA protein activation and a pulldown assay (see Materials and Methods).
|
|
Because the RhoA protein is a molecular switch and its active form (i.e., RhoA-GTP) is required for control of various cell functions (2631), we next determined whether RRIG1 binds to the GTP or GDP forms of RhoA protein and whether the binding of RRIG1 and RhoA changes RhoA activity. We first expressed the activated, dominant-negative, and wild-type forms of the RhoA protein in Cos-1 cells using the transient gene transfection assay. The Cos-1 cell lysates were pulled down with the GST-RRIG1 fusion protein and then subjected to Western blotting with anti-RhoA antibody. Our findings showed that RRIG1 binds to the active form of the RhoA protein (i.e., to RhoA-GTP; Fig. 5C). We then investigated whether RRIG1 suppresses RhoA activity. RRIG1 sense or antisense cDNA was transfected into the TE-8 and SKGT-4 esophageal cancer cell lines, respectively, and RhoA protein activity was measured using the rhotekin-Rho binding domain and an anti-RhoA antibody. The induction of RRIG1 expression suppressed the active RhoA protein level in TE-8 cells, and antisense RRIG1 reduced its level in SKGT-4 cells (Fig. 5D), which correlated with inhibited or increased stress fiber (f-actin) levels, respectively (data not shown).
RRIG1 suppresses tumor cell proliferation, invasion, and colony formation. To examine the consequences of the interaction between RRIG1 and RhoA, we subjected TE-8 cells transfected with RRIG1 sense cDNA and SKGT-4 cells transfected with antisense cDNA to chemoinvasion and colony formation assays. The restoration of RRIG1 expression reduced the number of colonies resistant to the G418 antibiotic in TE-8 cell by 32%; in contrast, the antisense RRIG1 construct increased the number of resistant colonies by 62% in SKGT-4 cells (Fig. 6A
). Moreover, restoration of RRIG1 expression suppressed TE-8 cell invasion by 95% compared with control (vector-onlytransfected) cells, whereas the RRIG1 antisense construct increased SKGT-4 cell invasion by 176% (Fig. 6B), which correlated with suppression or induction of RhoA activation, respectively (Fig. 5D).

View larger version (12K):
[in this window]
[in a new window]
|
Figure 6. RRIG1 suppression of colony formation and invasiveness of esophageal cancer cells. A, colony formation assay. The same transfected cells in Fig. 5D were also subjected to a colony formation assay. The antibiotic G418-resistant colonies were counted and averaged; columns, mean percentage of the control (vector-only) cells; bars, SD. B, chemoinvasion assay. The same transfected cells were subjected to a chemoinvasion assay. The invading cells were counted and averaged; columns, mean percentage of the control (vector-only) cells; bars, SD.
|
|
For additional evidence of the ability of RRIG1 to suppress tumor cell growth, we transiently transfected the pCMS/EGFP-RRIG1 or the pCMS/EGFP expression vector (a control) into TE-8 cells and then treated them with BrdUrd, which was incorporated into the DNA of proliferating cells. After immunostaining for BrdUrd, we counted
200 GFP-positive cells among these transfected cells. More than half (163 of 307; 53.1%) of the control cells but only 31.0% (52 of 168) of the RRIG1-transfected cells stained positively for BrdUrd, indicating that the transient expression of RRIG1 significantly reduced BrdUrd incorporation by 41.6% in these esophageal cancer cells (P = 0.00001,
2 test).
 |
Discussion
|
|---|
In this study, we have cloned and characterized a novel RAR-ß2-induced gene, RRIG1, which is differentially expressed in RAR-ß2-positive and RAR-ß2-negative esophageal cancer cells. RRIG1 is expressed in a broad range of normal tissues, but this expression is diminished in various cancer specimens. RRIG1 binds to a small GTPase RhoA, inhibits its activity, and, consequently, reduces the colony formation, invasiveness, and proliferation of esophageal cancer cells. Our results also provide evidence that RRIG1 is able to mediate the effects of RAR-ß2 on tumor cell growth and gene expressions, supporting the notion that RRIG1 is a downstream gene of RAR-ß2. This study has described a novel molecular pathway involving RAR-ß2 regulation of RRIG1 expression and RRIG1-RhoA interaction. We believe that further study of this pathway may translate into better control of human cancer.
RRIG1 cDNA contains 2,851 bp and encodes a protein with 276 amino acids; the gene is localized at chromosome 9q34. A search of GenBank showed that RRIG1 cDNA sequences partially share with SH3GLB2 cDNA, an SH3 domain GRB2-like endophilin B2 protein (ref. 32; i.e., exons 2-4 of the RRIG1 gene share with exons 7-9 of the SH3GLB2 gene). Further analyses showed that the open reading frames and sizes of these two genes are quite different; e.g., the RRIG1 gene covers only 4.181 kb of the DNA sequences in chromosome 9q34 with 5 exons and codes a protein that is localized in the cell membrane, whereas the SH3GLB2 gene covers 20.226 kb of the DNA sequences with 10 exons and codes a protein with 395 amino acids that is localized in the cytoplasm. In addition, the transcription start site of SH3GLB2 is 16.284 kb ahead of RRIG1 start site, indicating that RRIG1 and SH3GLB2 are two different genes.
RRIG1 protein contains two putative SH3 domain-binding motifs (i.e., PRAPHPP and LPVLSSPPTP). Accumulated data have shown that SH3 domains play an inhibitory role in cancer development because their mutation or deletion activates the transforming potential of c-Src and c-Abl proto-oncoproteins (3335). Specifically, the mutations of an SH3 domain converted a nontransforming c-Src into a highly oncogenic v-Src (36). Recent studies have further shown that the SH3 domain of the Crk-associated substrate blocked v-Src-stimulated anchorage-independent cell growth, Matrigel invasion, and tumor growth in nude mice (37). However, the SH3 domain in different genes may have different functions in cell signaling and cancer development (38, 39). Therefore, further studies are needed to determine whether these putative SH3 domain binding motifs in the RRIG1 protein are functional and whether they play a role in suppressing tumor cell growth and invasion in tumor cells.
Our study has also shown that RRIG1 interacts with RhoA to execute its biological function. Evidence has shown that Rho proteins are members of the Ras gene superfamily of small GTPases; their biological function is controlled by the cycling between active GTP-bound and inactive GDP-bound states (24, 26, 30). Early evidence showed that Rho proteins can regulate cell morphology and the formation of the actin cytoskeleton, and later studies have clearly shown that Rho proteins can also affect gene expression, cell proliferation and migration, and angiogenesis (24, 26, 29, 40, 41). For example, RhoA, Rac1, and cdc42 must be present for cells to progress through the G1 phase of the cell cycle (29). The aberrant activation of RhoA proteins has similarly been found to cause cell growth, transformation, invasion, and metastasis in experimental models of carcinogenesis (26, 4143), and inhibition of RhoA suppressed cell proliferation, invasion, and angiogenesis in vitro and in vivo (2631, 44). Furthermore, many growth factors (e.g., EGF, lysophosphatidic acid, and platelet-derived growth factor) can activate the RhoA protein (26, 30). The RhoA expression level has been shown to correlate with tumor progression (45) and the growth and invasiveness of breast cancer cells (46). Our study has shown that the protein encoded by RRIG1 binds to RhoA, suppresses RhoA activation, and inhibits Erk1/2 phosphorylation and COX-2 expression, which in turn suppresses tumor cell growth, colony formation, and invasion. Although it is known that RRIG1 expression is lost in different cancer tissues, further study is needed to determine how the RRIG1 protein fully interacts with RhoA and suppresses RhoA protein activity to control cancer cell growth and invasion and cancer development.
All-trans RA, which induces RAR-ß2 expression, increased RRIG1 mRNA levels, but not in RAR-ß2-negative or stable RAR-ß2-transfected cancer cells. The reason for this lack of effectiveness is that RA cannot induce RAR-ß2 expression in TE-8, TE-8S20, and TE-8S22 cells; the expression of RAR-ß2 in TE-8S20 and TE-8S22 cells is driven by plasmids with a cytomegalovirus promoter. Furthermore, although RRIG1 is a novel retinoid receptorinduced gene, it is different from other RA-induced genes in that RA-induced RRIG1 expression occurs through RAR-ß2 (Fig. 2D). In this study, we used only a physiologic level of RA (in 10% FCS) in all our experiments to avoid the possibility of RA-induced activity. The physiologic level of RA was sufficient to retain RAR-ß2 expression in RAR-ß2-positive cells (e.g., TE-3 cells) and to have RAR-ß2 activity remain in control of gene expression. We have shown that RRIG1 mediated the effects of RAR-ß2 in regulating tumor cell growth and gene expression. Specifically, stable RAR-ß2 transfection suppressed growth and colony formation of esophageal cancer cells and inhibited the expression of EGFR, c-Jun, and COX-2 and the phosphorylation of Erk1/2 (11, 12). These effects correlated with induction of RRIG1 expression. However, the suppression of RRIG1 expression with RRIG1 antisense cDNA abolished the effects of RAR-ß2 on the inhibition of gene expression and tumor cell growth. These findings indicate that RRIG1 is indeed a downstream gene of RAR-ß2. A previous study showed that RhoA induces COX-2 expression through ROCK and nuclear factor-
B activation (47). Our current study further confirmed effect of RhoA on COX-2 expression and revealed a possible mechanism by which RAR-ß2 and RRIG1 suppress COX-2 expression.
RRIG1 was expressed in normal esophageal and breast tissues, but this expression was lost in cancer tissues. This finding raises the possibility that the decrease in RRIG1 expression is associated with the malignant transformation of some epithelial tissues, at least in the esophagus and mammary glands. RRIG1 expression can suppress tumor cell growth, invasion, and colony formation. Therefore, further studies are needed to verify whether RRIG1 can be a biomarker for early detection or progression of esophageal and breast cancers in the clinic.
 |
Acknowledgments
|
|---|
Grant support: National Cancer Institute grant R29 CA-74835 and the Jerry and Maury Rubenstein Foundation (X-C. Xu).
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Hong Wu for performing the in situ hybridization and immunohistochemical analyses and the Department of Scientific Publication at M.D. Anderson Cancer Center for editing the manuscript.
 |
Footnotes
|
|---|
Note: The nucleotide sequences reported in this article have been submitted to the GenBank/European Molecular Biology Laboratory Data Bank with accession no. AY096240.
Received 3/ 3/06.
Revised 5/ 3/06.
Accepted 5/19/06.
 |
References
|
|---|
- Xu XC, Lotan R. Aberrant expression and function of retinoid receptors in cancer. In: Nau H, Blaner WS, editors. Handbook of experimental pharmacology. New York: Springer; 1999. p.32343.
- Soprano DR, Qin P, Soprano KJ. Retinoic acid receptors and cancers. Annu Rev Nutr 2004;24:20121.[CrossRef][Medline]
- Lotan R, Xu XC, Lippman SM, et al. Suppression of retinoic acid receptor-ß in premalignant oral lesions and its up-regulation by isotretinoin. N Engl J Med 1995;332:140510.[Abstract/Free Full Text]
- Geradts J, Chen J-Y, Russell EK, Yankaskas JR, Nieves L, Minna JD. Human lung cancer cell lines exhibit resistance to retinoic acid treatment. Cell Growth Differ 1993;4:799809.[Abstract]
- Xu XC, Liu X, Tahara E, Lippman SM, Lotan R. Expression and up-regulation of retinoic acid receptor-ß is associated with retinoid sensitivity and colony formation in esophageal cancer cell lines. Cancer Res 1999;59:247783.[Abstract/Free Full Text]
- Sirchia SM, Ren M, Pili R, et al. Endogenous reactivation of the RAR-ß2 tumor suppressor gene epigenetically silenced in breast cancer. Cancer Res 2002;62:245561.[Abstract/Free Full Text]
- Houle B, Rochette-Egly C, Bradley WE. Tumor-suppressive effect of the retinoic acid receptor ß in human epidermoid lung cancer cells. Proc Natl Acad Sci U S A 1993;90:9859.[Abstract/Free Full Text]
- Berard J, Laboune F, Mukuna M, Masse S, Kothary R, Bradley WEC. Lung tumors in mice expressing an antisense RAR-ß2 transgene. FASEB J 1996;10:10917.[Abstract]
- Treutin PM, Chen LI, Buetow BS, et al. Retinoic acid receptor-ß2 inhibition of metastasis in mouse mammary gland xenografts. Breast Cancer Res Treat 2002;72:7988.[CrossRef][Medline]
- Faria TN, Mendelsohn C, Chambon P, Gudas LJ. The targeted disruption of both alleles of RARß2 in F9 cells results in the loss of retinoic acid-associated growth arrest. J Biol Chem 1999;274:267838.[Abstract/Free Full Text]
- Li M, Song S, Lippman SM, et al. Induction of retinoic acid receptor-ß suppresses cyclooxygenase-2 expression in esophageal cancer cells. Oncogene 2002;21:4118.[CrossRef][Medline]
- Song S, Lippman SM, Zou Y, Ye X, Xu X-C. Induction of cyclooxygenase-2 by benzo[a]pyrene diol epoxide through inhibition of retinoic acid receptor-ß2 expression. Oncogene 2005;24:826876.[CrossRef][Medline]
- Song S, Xu XC. Effect of benzo[a]pyrene diol epoxide on expression of retinoic acid receptor-ß in immortalized esophageal epithelial cells and esophageal cancer cells. Biochem Biophys Res Commun 2001;281:8727.[CrossRef][Medline]
- Toulouse A, Loubeau M, Morin J, Pappas JJ, Wu J, Bradley WE. RARß involvement in enhancement of lung tumor cell immunogenicity revealed by array analysis. FASEB J 2000;14:122432.[Abstract/Free Full Text]
- Zhuang Y, Faria TN, Chambon P, Gudas LJ. Identification and characterization of retinoic acid receptor ß2 target genes in F9 teratocarcinoma cells. Mol Cancer Res 2003;1:61930.[Abstract/Free Full Text]
- Xu XC, Zhang W, Song S, Lotan R, Lippman SM. Identification of RAR-ß-regulated genes using cDNA microarray. Cancer Epidemiol Biomarkers Prev 2002;11:A120.
- Aoki T, Mori T, Du X, Nisihira T, Matsubara T, Nakamura Y. Allelotype study of esophageal carcinoma. Genes Chromosomes Cancer 1994;10:17782.[Medline]
- Devlin J, Elder PA, Gabra H, Steel CM, Knowles MA. High frequency of chromosome 9 deletion in ovarian cancer: evidence for three tumour-suppressor loci. Br J Cancer 1996;73:4203.[Medline]
- Simoneau M, LaRue H, Aboulkassim TO, Meyer F, Moore L, Fradet Y. Chromosome 9 deletions and recurrence of superficial bladder cancer: identification of four regions of prognostic interest. Oncogene 2000;19:631723.[CrossRef][Medline]
- Liang Z, Lippman SM, Kawabe A, Shimada Y, Xu XC. Identification of benzo(a)pyrene diol epoxide-binding DNA fragments using DNA immunoprecipitation technique. Cancer Res 2003;63:14704.[Abstract/Free Full Text]
- Wan H, Oridate N, Lotan D, Hong WK, Lotan R. Overexpression of retinoic acid receptor-ß in head and neck squamous cell carcinoma cells increases their sensitivity to retinoid-induced suppression of squamous differentiation by retinoids. Cancer Res 1999;59:351826.[Abstract/Free Full Text]
- Qiu H, Zhang W, El-Naggar AK, et al. Loss of retinoic acid receptor-ß expression is an early event during esophageal carcinogenesis. Am J Pathol 1999;155:151923.[Abstract/Free Full Text]
- Xu XC, Shappell SB, Liang Z, et al. Reduced 15S-lipoxygenase-2 expression in esophageal cancer specimens and cells and up-regulation in vitro by the cyclooxygenase-2 inhibitor, NS398. Neoplasia 2003;5:1217.[Medline]
- Ridley AJ, Hall A. The small GTP-binding protein rho regulates the assembly of focal adhesions and actin stress fibers in response to growth factors. Cell 1992;70:38999.[CrossRef][Medline]
- Alexandropoulos K, Cheng G, Baltimore D. Proline-rich sequences that bind to Src homology 3 domains with individual specificities. Proc Natl Acad Sci U S A 1995;92:31104.[Abstract/Free Full Text]
- Burridge K, Wennerberg K. Rho and Rac take center stage. Cell 2004;116:16779.[CrossRef][Medline]
- Etienne-Manneville S, Hall A. Rho GTPases in cell biology. Nature 2002;420:62935.[CrossRef][Medline]
- Hoang MV, Whelan MC, Senger DR. Rho activity critically and selectively regulates endothelial cell organization during angiogenesis. Proc Natl Acad Sci U S A 2004;101:18749.[Abstract/Free Full Text]
- Olson MF, Ashworth A, Hall A. An essential role for Rho, Rac, and Cdc42 GTPases in cell cycle progression through G1. Science 1995;269:12702.[Abstract/Free Full Text]
- Sahai E, Marshall CJ. RHO-GTPases and cancer. Nat Rev Cancer 2002;2:13342.[CrossRef][Medline]
- Vial E, Sahai E, Marshall CJ. ERK-MAPK signaling coordinately regulates activity of Rac1 and RhoA for tumor cell motility. Cancer Cell 2003;4:6779.[CrossRef][Medline]
- Pierrat B, Simonen M, Cueto M, Mestan J, Ferrigno P, Heim J. SH3GLB, a new endophilin-related protein family featuring an SH3 domain. Genomics 2001;71:22234.[CrossRef][Medline]
- Jackson P, Baltimore D. N-terminal mutations activate the leukemogenic potential of the myristoylated form of c-abl. EMBO J 1989;8:44956.[Medline]
- Seidel-Dugan C, Meyer BE, Thomas SM, Brugge JS. Effects of SH2 and SH3 deletions on the functional activities of wild-type and transforming variants of c-Src. Mol Cell Biol 1992;12:183545.[Abstract/Free Full Text]
- Hirai H, Varmus HE. Mutations in src homology regions 2 and 3 of activated chicken c-src that result in preferential transformation of mouse or chicken cells. Proc Natl Acad Sci U S A 1990;87:85926.[Abstract/Free Full Text]
- Miyazaki K, Senga T, Matsuda S, et al. Critical amino acid substitutions in the Src SH3 domain that convert c-Src to be oncogenic. Biochem Biophys Res Commun 1999;263:75964.[CrossRef][Medline]
- Cheng CH, Yu KC, Chen HL, et al. Blockade of v-Src-stimulated tumor formation by the Src homology 3 domain of Crk-associated substrate (Cas). FEBS Lett 2004;557:2217.[Medline]
- Groysman M, Nagano M, Shaanan B, Katzav S. Mutagenic analysis of Vav reveals that an intact SH3 domain is required for transformation. Oncogene 1998;17:1597606.[CrossRef][Medline]
- Avizienyte E, Fincham VJ, Brunton VG, Frame MC. Src SH3/2 domain-mediated peripheral accumulation of Src and phospho-myosin is linked to deregulation of E-cadherin and the epithelial-mesenchymal transition. Mol Biol Cell 2004;15:2794803.[Abstract/Free Full Text]
- Benitah SA, Valeron PF, van Aelst L, Marshall CJ, Lacal JC. Rho GTPases in human cancer: an unresolved link to upstream and downstream transcriptional regulation. Biochim Biophys Acta 2004;1705:12132.[Medline]
- Gomez del Pulgar T, Benitah SA, Valeron PF, Espina C, Lacal JC. Rho GTPase expression in tumourigenesis: evidence for a significant link. Bioessays 2005;27:60213.[CrossRef][Medline]
- Sahai E, Marshall CJ. Differing modes of tumour cell invasion have distinct requirements for Rho/ROCK signaling and extracellular proteolysis. Nat Cell Biol 2003;5:7119.[CrossRef][Medline]
- Qiu RG, Chen J, McCormick F, Symons M. A role for Rho in Ras transformation. Proc Natl Acad Sci U S A 1995;92:117815.[Abstract/Free Full Text]
- Yoshioka K, Nakamori S, Itoh K. Overexpression of small GTP-binding protein RhoA promotes invasion of tumor cells. Cancer Res 1999;59:200410.[Abstract/Free Full Text]
- Fritz G, Just I, Kaina B. Rho GTPases are over-expressed in human tumors. Int J Cancer 1999;81:6827.[CrossRef][Medline]
- Pille JY, Denoyelle C, Varet J, et al. Anti-RhoA and anti-RhoC siRNAs inhibit the proliferation and invasiveness of MDA-MB-231 breast cancer cells in vitro and in vivo. Mol Ther 2005;11:26774.[Medline]
- Benitah SA, Valeron PF, Lacal JC. ROCK and nuclear factor-
B-dependent activation of cyclooxygenase-2 by Rho GTPases: effects on tumor growth and therapeutic consequences. Mol Biol Cell 2003;14:304154.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
S. Song, B. Guan, T. Men, A. Hoque, R. Lotan, and X.-C. Xu
Antitumor Effect of Retinoic Acid Receptor-{beta}2 Associated with Suppression of Cyclooxygenase-2
Cancer Prevention Research,
March 1, 2009;
2(3):
274 - 280.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Hoque, H. Chen, and X.-c. Xu
Statin Induces Apoptosis and Cell Growth Arrest in Prostate Cancer Cells
Cancer Epidemiol. Biomarkers Prev.,
January 1, 2008;
17(1):
88 - 94.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Huang, Z. D. Liang, T.-T. Wu, A. Hoque, H. Chen, Y. Jiang, H. Zhang, and X.-c. Xu
Tumor-Suppressive Effect of Retinoid Receptor-Induced Gene-1 (RRIG1) in Esophageal Cancer
Cancer Res.,
February 15, 2007;
67(4):
1589 - 1593.
[Abstract]
[Full Text]
[PDF]
|
 |
|