| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Cell, Tumor, and Stem Cell Biology |
1 Divisions of Cancer Biology and 2 Molecular Oncology, Department of Medicine, Evanston Northwestern Healthcare Research Institute and Feinberg School of Medicine, and 3 Robert H. Lurie Comprehensive Cancer Center, and 4 Department of Biochemistry, Molecular Biology and Cell Biology, Northwestern University, Evanston, Illinois; and 5 Massachusetts General Hospital, Cutaneous Biology Research Center, Charlestown, Massachusetts
Requests for reprints: Vimla Band, Division of Cancer Biology, Evanston Northwestern Healthcare Research Institute, 1001 University Place, Evanston, IL 60201. Phone: 224-364-7501; Fax: 224-364-7402; E-mail: v-band{at}northwestern.edu.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
In recent years, it has become clear that p53 plays an essential role in cellular response to DNA damage and other cellular stresses and prevents the emergence of cells with mutated genomes by inducing cell cycle arrest while facilitating DNA repair or facilitating apoptosis or senescence of cells if DNA damage is extensive. It has been shown the ability of p53 to transcriptionally activate genes that directly control the various cellular fates (5, 7, 8). Thus, elucidation of the components of the biochemical machinery that control p53 level and function is of substantial biological significance and these components may be involved in oncogenesis. For example, the ubiquitin ligase murine double minute-2 (Mdm2) controls p53 levels by targeting it for ubiquitin-dependent degradation and increased Mdm2 levels are associated with high risk of cancers.
In this study, we report the identification of the human orthologue of Drosophila melanogaster ecdysoneless (hEcd; ref. 9) as a novel p53-interacting protein. Importantly, we show an interaction of hEcd with p53 and Mdm2, a physiologic role for hEcd in the stability and function of p53. The "ecdysoneless" (ecd) mutations in D. melanogaster have been used in numerous genetic analyses as the insect steroid hormone ecdysone is responsible for coordination of embryogenesis, larval molting, and metamorphosis (10). However, the ecd gene product was not known until recently. Gaziova et al. (9) have recently cloned ecd and found it to be expressed in both steroidogenic and nonsteroidogenic tissues and showed that the Ecd protein also plays a cell-autonomous role in development and oogenesis. However, the mechanistic basis of Ecd function remains unknown. Our study is the first report of a mechanistic basis for hEcd protein function with potential implications on the roles of this evolutionarily conserved protein family. Identification of hEcd as a novel p53 binding partner implicates hEcd as a novel participant in human cancer.
The human orthologue of Ecd was initially cloned in a screen of human genes that can rescue the growth defect in Saccharomyces cerevisiae mutants with a deletion of the growth control regulatory gene 2 (GCR2) gene, a transcriptional activator of the glycolytic gene expression, and was therefore designated as human suppressor of GCR2 (hSGT1; ref. 11), its current database name [National Center for Biotechnology Information (NCBI) accession no. NM_007265; Unigene cluster Hs.446373 Homo sapiens]. However, hSGT1 has no structural relationship with yeast GCR2 nor does a clear mammalian orthologue of GCR2 (12) exist. Furthermore, an orthologue of hSGT1 (Ecd) is not discernible in the S. cerevisiae genome but highly conserved orthologues are found throughout higher eukaryotic organisms, including the fission yeast Schizosaccharomyces pombe.6 Given these findings and the fact that an unrelated and evolutionarily conserved group of SGT1 proteins (for suppressor of G2 allele of skp1; also known as SUGT1) already exists (13), we have adopted the nomenclature suggested by Gaziova et al. (9) and will refer to hSGT1 as human ecdysoneless (hEcd) to avoid any confusion that the continued use of the acronym hSGT1 is likely to create.
| Materials and Methods |
|---|
|
|
|---|
Cell lines and culture conditions. 293T, H1299, WI-38, and mouse embryonic fibroblast (MEF) cell lines were grown in DMEM. U2OS, MCF-7, and Saos-2 cell lines were grown in
-MEM (Life Technologies, Rockville, MD). Both DMEM and
-MEM were supplemented with 10% FCS (HyClone, Logan, UT). The p53-negative breast cancer cell line 21PT was grown in DMEM supplemented with hydrocortisone and epithelial growth factor as previously described (15).
Antibodies. Anti-hEcd rabbit polyclonal antiserum was generated using purified GST-hEcd (amino acids 291-644) as an antigen by Animal Pharma (Healdburg, CA). Other antibodies used were purchased commercially:
-tubulin, ß-actin (Abcam); poly(ADP-ribose) polymerase (F-2), p53 (DO-1), p53 (Pab1801), p53 (Pab 240), p53 (FL-393), p21 (F-5), Bax (B-9) (Santa Cruz Biotechnology, Inc., Santa Cruz, CA); p53 (PAb 421), Mdm2 (Ab-1) (Calbiochem, San Diego, CA); p53 (Pab122; NeoMarkers, Fremont, CA); and FLAG M2 antibody and FLAG M2 horseradish peroxidaseconjugated antibody (Sigma, St. Louis, MO).
Immunoblotting. Cells were washed with PBS, lysed in 1x sample buffer [50 mmol/L Tris (pH 6.8); 2% SDS; 10% glycerol] lacking ß-mercaptoethanol, and protein concentration was determined using BCA Protein Assay Kit (Pierce, Rockford, IL). Lysates were analyzed immediately or frozen at 80°C. Before analysis, ß-mercaptoethanol was added and samples were heated at 95°C for 5 minutes. Proteins were separated in denaturing polyacrylamide gels and transferred to polyvinylidene difluoride membranes, and the membranes were blocked with 1% bovine serum albumin in TBS/0.1% Tween 20, incubated with primary and secondary antibodies, and washed in TBS/0.1% Tween 20. Enhanced chemiluminescence signals were recorded using a light-sensitive film (NEN Life Science Products, Boston, MA).
Localization of hEcd by biochemical fractionation. To assess hEcd localization in subcellular fractions, U2OS cells were treated with 10 ng/mL of leptomycin B (Sigma) or 70% methanol (as control) and cells were harvested in 1x sample buffer. Nuclear and cytoplasmic fractions were prepared as described (16) and equal amounts of protein extracts were analyzed for hEcd levels by immunoblotting.
Plasmids, plasmid constructions, and hEcd RNAi oligonucleotides. GST-hEcd (amino acids 291-644) was constructed by subcloning the corresponding sequence derived from the yeast two-hybrid vector pGAD10 into pGEX-4T2 (Amersham-Pharmacia Biotech, Piscataway, NJ). Full-length hEcd was amplified from normal mammary gland cDNA (Clontech, Mountain View, CA) by using the Advantage cDNA amplification kit (Promega, Madison, WI) and the following primers: hEcd sense, GATGCGGCCGCCATGGACTACAAGGACGACGATGACAAGGAAGAAACCATGAAGCTTGC; hEcd antisense GCGGCGGCCGCAGAAGCTAAATGTGCAGGTTAAT. The resultant PCR product with an NH2-terminal FLAG tag was cloned into pcDNA3.1 mammalian expression vector (Invitrogen, Carlsbad, CA). Truncated versions of hEcd (amino acids 1-291, 292-492, Madison, WI and 493-644) were all FLAG tagged and constructed in pcDNA3.1 by PCR using full-length hEcd as template. Full-length hEcd protein fused to glutathione S-transferase (GST) was derived by subcloning hEcd cDNA from the pcDNA3.1-FLAG-hEcd construct into pGEX 4T-2 vector. Histidine-tagged hEcd was constructed by cloning the PCR-derived cDNA fragments into pEF6/His vector. Construction of GST-p53, pCR3.1-FLAG-p53, and pCMVp53 has previously been described (17). The luciferase reporters of Bax, cyclin G, Mdm2, and insulin-like growth factor binding protein 3 were provided by Dr. Carole Prives (Columbia University, New York, NY) and pG13 reporter was provided by Dr. Wafik El-Diery (University of Pennsylvania, Philadelphia, PA; originally obtained from Dr. Bert Vogelstein, Johns Hopkins School of Medicine, Baltimore, MD). The RNA oligonucleotides used to generate 21-nucleotide small interfering RNA (siRNA) duplexes were synthesized by Dharmacon (Lafayette, CO) corresponding to the following human hEcd sequences: siRNA 1 (nucleotides 1,703-1,723), 5'-AAGGCCTAATGAGTCAGATTCdTdT-3; siRNA 2 (nucleotides 1,902-1,922), 5'-AAGAACCAAGUGGAACCUGUAdTdT-3'; and control siRNA, 5'-AACGCGAGUCUAUCCCUAUAUdTdT-3'. pCMV-Mdm2 was constructed by cloning the PCR-derived cDNA fragments from pCMV-HA-Mdm2 provided by Dr. Hua Lu (Oregon Health & Science University, Portland, OR).
In vitro binding. The 35S-labeled proteins were generated using wheat germ or rabbit reticulocyte lysatebased coupled in vitro transcription-translation system (Promega) and in vitro binding experiments with GST or GST fusion proteins were done as previously described (17).
Immunoprecipitation. Immunoprecipitations from cell lysates [lysis buffer contains 100 mmol/L Tris (pH 8.0), 100 mmol/L NaCl, 0.5% NP40, 1 mmol/L phenylmethylsulfonyl fluoride] were done as described (14, 17) using protein A-Sepharose 4B and protein G-Sepharose 4B beads (Amersham Biosciences, Piscataway, NJ) as immunosorbents. Cell lysates were precleared with beads for 1 hour. Antibodies were added to the precleared cell lysates and incubated for 2 hours or overnight (indicated in each experiment). Beads were added and incubated for another 1 hour, then washed six times with immunoprecipitation lysis buffer. The immunoprecipitations or cell lysates were resolved on SDS-PAGE gels and immunoblotting was done as described above.
Turnover of p53. U2OS cells were transfected with indicated siRNA oligonucleotides using Lipofectamine 2000 (Invitrogen). After 24 hours, cycloheximide (25 µg/mL) was added to cells, and lysates at different time periods were analyzed by immunoblotting. Densitometry was carried out on directly scanned images using ScionImage for Windows software (Scion Corp., Frederick, MD).
In vivo association of p53 and hEcd. 293T cells were transfected with pCR3.1-FLAG-p53 with or without pEF6/His-hEcd and cell lysates for immunoprecipitation were prepared as described above. His pulldown assay was done as previously described (17).
To assess the interaction of endogenous p53 and hEcd, U2OS cell lysates in immunoprecipitation lysis buffer were subjected to immunoprecipitation with a cocktail of anti-p53 antibodies (PAb421, PAb1801, PAb240, DO-1, and PAb122) or normal mouse immunoglobulin G (IgG; negative control), and associated hEcd was detected with anti-hEcd rabbit antibody.
Assessment of p53-dependent transactivation using luciferase reporters. 21PT cells (5 x 105 per 100-mm dish) were transfected with pCMV-p53 and pcDNA3.1-FLAG-hEcd together with the indicated luciferase reporters and SV40-Renilla luciferase reporter (pRL-SV40; transfection efficiency control). Luciferase activity was measured as previously described (17). Similar results were obtained with another cell line, Saos-2 (data not shown). For the assessment of p53-dependent luciferase reporter activity following hEcd knockdown, U2OS cells were transfected using Lipofectamine 2000 (Invitrogen) with control or hEcd siRNA or p53 RNAi (18) and Bax-luciferase reporter. Luciferase activity was measured as described above.
In vivo association of hEcd with Mdm2. H1299 cells (5 x 105 per 100-mm dish) were transfected with pcDNA 3.1-FLAG-hEcd (4 µg) and pCMV-Mdm2 (2.5 µg) using Lipofectamine 2000. Twenty hours after transfection, the cells were treated with MG132 (20 µmol/L) for 4 hours, lysed, and subjected to anti-hEcd immunoprecipitation followed by anti-Mdm2 immunoblotting.
Senescence experiments in WI-38 cells. WI-38 cells were retrovirally infected with pMSCVpuro vector or pMSCVpuro-FLAG-hEcd, selected in 1 µg/mL of puromycin for 2 days, and then 2 x 104 cells were plated in 35-mm dishes for immunoblotting, [3H]thymidine incorporation, and senescence-associated ß-gal (SA-ß-gal) assays. These assays were done as previously described (19, 20).
Cell proliferation assay on expression of hEcd siRNA in p53-positive and p53-negative cells. Cells (1 x 105; two p53-positive cell lines, U2OS and MCF-7, and two p53-negative cell lines, H1299 and 21PT) were plated in six-well plates; after 24 hours, cells were transfected with 200 pmol siRNA duplex per well using Lipofectamine 2000. Twenty-four hours after transfection, equal numbers of cells were seeded in six-well plates for growth analyses. The cells were trypsinized and counted at the indicated time points. Cell lysates were analyzed at day 1 for protein expression by immunoblotting.
| Results |
|---|
|
|
|---|
-tubulin) markers (Fig. 1B). Thus, hEcd seems to be localized in the nucleus as well as the cytoplasm.
|
|
Specific binding of p53 to hEcd was assessed by doing in vitro binding using purified GST-p53 and 35S-labeled hEcd NH2-terminal, middle, and COOH-terminal fragments (described above). This in vitro binding shows that the NH2-terminal region of hEcd interacts with p53 (Fig. 2E). These results strongly support the conclusion that hEcd and p53 associate both in vitro and in vivo in mammalian cells.
hEcd promotes the transcriptional activation function of p53. To assess if the hEcd-p53 association changes p53 function, we transfected p53-negative 21PT cells (15) with a fixed amount of p53 and increasing amounts of hEcd, together with a p53-responsive artificial luciferase reporter (pG13-luciferase; ref. 22) or luciferase linked to promoters of known p53 target genes. Transfection of p53, as expected, increased the reporter luciferase activity (Fig. 3 ). Significantly, cotransfection of hEcd dose-dependently enhanced the effect of p53 on all of the reporters tested, albeit to varying degrees (Fig. 3A-E). hEcd transfection without p53 had no effect on any of the reporters, indicating that hEcd effects were p53 dependent (Fig. 3). Furthermore, no luciferase activity was seen when MG15 luciferase (with a mutant p53-binding site; ref. 22) was cotransfected with p53 or p53 plus hEcd (data not shown). Notably, immunoblotting analysis of cell lysates used in luciferase assays showed that hEcd dose-dependently increased the levels of p53 protein (Fig. 3). Thus, hEcd-dependent increase in p53 levels promotes the function of p53 to transactivate target genes.
|
30 minutes in control siRNAtreated cells to
15 minutes in hEcd siRNAtreated cells (Fig. 3H and I). These results show that hEcd regulates the stability of p53 protein. Together, these analyses clearly show that hEcd interacts with p53 and increases p53-mediated transactivation by stabilizing the p53 protein. These results support the idea that hEcd plays a critical role in promoting the function of p53 as a transcription factor, which in turn mediates the p53-dependent functional effects of hEcd. hEcd stabilizes p53 by negating Mdm2-dependent p53 degradation. As p53 turnover is regulated by a balance between its synthesis and Mdm2-dependent proteasomal degradation (23, 24), we wished to investigate if hEcd may counter Mdm2-mediated p53 degradation. First, we examined the in vivo association between hEcd and Mdm2 in H1299, a p53-null cell line with low levels of Mdm2 and widely used for Mdm2 association experiments (25). H1299 cells were transfected with FLAG-tagged hEcd (to distinguish it from endogenous hEcd) and Mdm2 and cell lysates were prepared as such or after MG132 treatment. Anti-Mdm2 immunoblotting of anti-hEcd immunoprecipitations showed a clear association between hEcd and Mdm2 when both were cotransfected and cells were treated with MG132 (Fig. 4A, lane 8 ). No clear binding was noticed without MG132 treatment, probably due to the low levels of Mdm2 expression (data not shown). hEcd-Mdm2 association suggested that hEcd may stabilize p53 by inhibiting its Mdm2-mediated degradation. Notably, lack of stabilization of p53 was seen when hEcd was cotransfected with p53 into p53/Mdm2-null MEFs (ref. 26; Fig. 4B, lanes 1 and 2). Furthermore, cotransfection of hEcd together with p53 and Mdm2 in p53/Mdm2-null MEFs reduced the extent of Mdm2-mediated degradation of p53 (Fig. 4B, lanes 3 and 4). An equal amount of green fluorescent protein controls the transfection efficiency. These results showed that Mdm2 is required for hEcd-mediated stabilization of p53 protein.
|
|
Transient knockdown of endogenous hEcd expression increases cell proliferation in p53-positive but not in p53-negative cells. Next, we asked if hEcd knockdown can produce an opposite phenotype (i.e., enhance proliferation). Stable retrovirus-mediated knockdown of hEcd could not be used because both p53-positive and p53-null cells underwent growth inhibition and cell death, apparently due to a p53-independent role of hEcd in maintaining cell viability (data not shown). Therefore, we assessed cell proliferation after transient hEcd knockdown using double-stranded siRNA transfection in two p53-positive (U2OS and MCF-7) and two p53-negative (H1299 and 21PT) cell lines (poor transient transfection efficiency precluded the use of MEFs and WI-38). hEcd knockdown in U2OS and MCF-7 cells resulted in increased proliferation, similar to the effect of p53 knockdown (Fig. 6B and D ) when assessed within 4 days posttransfection. These effects were p53 dependent as hEcd knockdown did not change the rate of proliferation of H1299 and 21PT cells (Fig. 6F and H). Notably, hEcd knockdown led to a substantial reduction in p53 levels in U2OS and MCF-7 cells (Fig. 6A and C). Taken together, these results strongly support a role for hEcd in the induction of p53-mediated cellular senescence.
|
| Discussion |
|---|
|
|
|---|
Here, we report the identification and characterization of hEcd as a novel p53-interacting protein. Overexpression of hEcd promoted the accumulation of p53 protein. Conversely, RNAi knockdown studies showed that hEcd is a positive regulator of endogenous p53 protein levels. Furthermore, we show that hEcd interacts with p53 protein and enhances the p53-mediated transactivation and function. Altogether, these data provide strong support for the idea that hEcd is a novel regulator of p53.
During our analyses of the role of hEcd in p53-mediated transactivation, we consistently observed changes in p53 protein levels. We reasoned that the influence of hEcd on p53 levels could be indirect or a more direct action involving physical interaction with p53. A major cellular protein involved in the regulation of p53 stability is the ubiquitin ligase Mdm2. Our coimmunoprecipitation analyses established that hEcd interacts with p53 as well as Mdm2. More detailed studies to identify the structural determinants on hEcd, p53, and Mdm2 that mediate their interactions are required to definitely define the basis of these associations. Because Mdm2 and p53 are known to interact directly, hEcd, p53, and Mdm2 could form a trimeric complex, although competition of Mdm2 binding to p53 by hEcd remains an alternative similar to binding of p300 within Mdm2 binding region on p53 (29).
Physical association of hEcd with p53 and Mdm2 suggested the possibility that hEcd controls p53 levels by antagonizing Mdm2-mediated p53 degradation. Indeed, overexpression of hEcd and p53 in p53/Mdm2-null MEFs did not stabilize p53 whereas reconstitution of Mdm2 resulted in hEcd-mediated p53 stabilization. How hEcd antagonizes the function of Mdm2 towards p53 remains to be determined. Aside from the physical competition mechanism alluded to above, hEcd may mask the sites of ubiquitination on p53 and/or facilitate the recruitment of deubiquitinating enzymes (30). Whereas future studies will address these important issues, our RNAi analyses clearly indicate that hEcd is a physiologic component of the biochemical networks that control the levels of p53. Whereas we have only assessed the role of Mdm2 in hEcd-mediated p53 stabilization, it remains possible that other recently identified E3 ligases of p53, such as COP1, pirh2, and ADP ribosylation factor-BP1/Mule (3133), may also play a role in hEcd-mediated p53 stabilization.
As hEcd localizes in the nucleus as well as the cytosol, it was important to assess that hEcd-dependent stabilization of p53 correlates with an increase in the transcriptionally competent pool of p53. Indeed, our analyses of reporters incorporating consensus p53-binding sequences or natural target gene promoters directly established that hEcd regulates the levels of transcriptionally active pool of p53. As hEcd is also present in the cytoplasm, it will be of considerable future interest to determine if it might compete with PARC, a cytosolic protein that binds to and retains p53 in the cytoplasm and thereby antagonizes p53 function (16). At what step during the nuclear transport of p53 the hEcd protein associates with it and what accessory proteins and/or posttranslational modifications promote this association will be critical questions for further analyses. It is important to note that hEcd does not contain a consensus nuclear localization signal, yet our leptomycin B experiments clearly indicate that this protein shuttles into and out of the nucleus. It remains possible that hEcd is imported into the nucleus by other nuclear proteins. Given its association with p53, its shuttling into the nucleus, and its ability to modulate p53-mediated transcriptional activation, it will be of interest to determine if the nuclear hEcd functions as a p53 coactivator like p300 and ADA3, two well-known p53 interacting proteins (17, 34).
Whereas hEcd interacts with p53 and we have seen increased association of p53 when cells are exposed to genotoxic stress (which increases p53 levels), we have not observed a detectable change in the levels of hEcd or any change in its gel mobility (which could suggest posttranslational modifications) on treatment of cells with DNA damaging agents (Adriamycin, actinomycin D, UV, etc.; Fig. 3G and data not shown). However, further studies are required to comprehensively investigate the possible role of hEcd in stress-related functions of p53. Alternatively, cytosolic and/or nuclear hEcd may interact with other partners to mediate p53-independent functions.
Notably, Drosophila Ecd protein was shown to have a cell-autonomous function in cell proliferation/survival in steroidogenic as well as nonsteroidogenic tissues. Further biochemical and genetic analyses of Ecd proteins are therefore likely to elucidate novel pathway of cell proliferation/survival control. Our analyses showing the role of hEcd as a regulator of stability of a transcriptional activator provide new insights into the possible biochemical basis for the function of hEcd protein.
In conclusion, we have identified the hEcd protein as a novel regulator of p53 stability and function. Future studies will address the further mechanisms by which hEcd regulates p53 and the biological roles of this interaction.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Drs. Jianming Chen, Yongtong Zhao, Gaoyuan Meng, Laurie Delmolino, and Ajay Kumar for helpful suggestions; Dr. Hua Lu for pCMV-HA-Mdm2 construct, Dr. Stephen Jones for p53/Mdm2-null MEFs, and Drs. Carole Prives, Wafik El-Diery, and Bert Vogelstein for various p53 related constructs.
| Footnotes |
|---|
6 http://www.sanger.ac.uk//Software/Pfam/data/jtml/full/PF07093.shtml.gz. ![]()
Received 2/22/06. Revised 4/28/06. Accepted 5/12/06.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
hEcd, a p53 Regulator Cancer Res., September 15, 2006; 66(18): 9338 - 9338. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |