Cancer Research The Future of Cancer Research: Science and Patient Impact  Tumor Immunology: New Perspectives
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Choi, S. H.
Right arrow Articles by Blumberg, P. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Choi, S. H.
Right arrow Articles by Blumberg, P. M.
[Cancer Research 66, 7261-7269, July 15, 2006]
© 2006 American Association for Cancer Research


Experimental Therapeutics, Molecular Targets, and Chemical Biology

Differential Effect of Bryostatin 1 and Phorbol 12-Myristate 13-Acetate on HOP-92 Cell Proliferation Is Mediated by Down-regulation of Protein Kinase C{delta}

Sung Hee Choi, Tehila Hyman and Peter M. Blumberg

Laboratory of Cellular Carcinogenesis and Tumor Promotion, Center for Cancer Research, National Cancer Institute, Bethesda, Maryland

Requests for reprints: Peter M. Blumberg, Laboratory of Cellular Carcinogenesis and Tumor Promotion, Center for Cancer Research, National Cancer Institute, Building 37, Room 4048B, 37 Convent Drive, MSC 4255, Bethesda, MD 20892-4255. Phone: 301-496-3189; Fax: 301-496-8709; E-mail: blumberp{at}dc37a.nci.nih.gov.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Bryostatin 1 is currently in clinical trials as a cancer chemotherapeutic agent. Although bryostatin 1, like phorbol 12-myristate 13-acetate (PMA), is a potent activator of protein kinase C (PKC), it induces only a subset of those responses induced by PMA and antagonizes others. We report that, in the HOP-92 non–small cell lung cancer line, bryostatin 1 induced a biphasic proliferative response, with maximal proliferation at 1 to 10 nmol/L. This biphasic response mirrored a biphasic suppression of the level of PKC{delta} protein, with maximal suppression likewise at 1 to 10 nmol/L bryostatin 1. The typical phorbol ester PMA, in contrast to bryostatin 1, had no effect on the level of PKC{delta} and modest suppression of cell proliferation, particularly evident at later treatment times. Flow cytometric analysis revealed changes in the fraction of cells in the G0-G1 and S phases corresponding to the effects on proliferation. Cells overexpressing PKC{delta} exhibited a lower rate of cell proliferation compared with control untreated cells and showed neither a proliferative response nor a loss of PKC{delta} in response to bryostatin 1. Conversely, treatment with PKC{delta} small interfering RNA significantly increased the cellular growth compared with controls. We conclude that the differential effect on cellular proliferation induced by bryostatin 1 compared with PMA reflects the differential suppression of PKC{delta}. (Cancer Res 2006; 66(14): 7261-9)


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The protein kinase C (PKC) family of serine/threonine kinases plays a central role in mediating the action of growth factors, neurotransmitters, and hormones in cellular growth control and in carcinogenesis (1). The multiple isoforms of PKC differ in their regulation and in their biological functions. The classic PKCs ({alpha}, ßI, ßII, and {gamma}) are Ca2+ dependent and diacylglycerol (DAG) responsive; the novel PKCs ({delta}, {epsilon}, {eta}, and {theta}) are Ca2+ independent but DAG responsive (24). Different PKC isoforms have different biological functions; indeed, one isoform may antagonize the function of another. Thus, in mouse NIH3T3 cells, overexpression of PKC{delta} is antiproliferative, whereas overexpression of PKC{alpha} or PKC{epsilon} stimulates proliferation (5). The function of individual PKC isoforms is also very much context dependent. Thus, PKC{delta} is proapoptotic in C6 glioma cells in the presence of etoposide (6) but is antiapoptotic in the same cells in response to Sindbis virus infection (7) or in A172 glioma cells in response to tumor necrosis factor–related apoptosis-inducing ligand (TRAIL; ref. 8).

Phorbol esters, such as phorbol 12-myristate 13-acetate (PMA), induce the translocation of PKC from the cytosolic to the particulate fraction (9). By controlling access to potential substrates, differential translocation of PKC isoforms can further contribute to differential activity (10). Using green fluorescent protein (GFP), the translocation of PKC on different stimuli can be monitored in living cells and in real time. Several reports have shown that translocation of PKC is isoform, cell type, and activator specific and is tightly regulated by various cofactors (11, 12).

Chronic treatment of PKC with phorbol esters or other activators may lead to the time-dependent decrease in the level of PKC, termed down-regulation. Down-regulation provides a mechanism by which an activator of PKC can, at least for longer-term responses, inhibit PKC function. It is clear that down-regulation is a complicated process that can reflect contributions of the calpain, caspase, and proteasome pathways (6, 13, 14). The extent of down-regulation depends on the PKC isoform, on the specific PKC ligand, and on the cellular context for PKC, among other variables (1517).

Bryostatin 1 is currently undergoing several clinical studies against malignancies, including advanced melanoma, relapsed multiple myeloma, metastatic renal cell carcinoma, and refractory B-cell chronic lymphocytic leukemia (1820). The bryostatins are macrocyclic lactones isolated from the marine organism Bugula neritina. Together with the phorbol esters, the indole alkaloids, the polyacetates, and the iridals, they represent potent ligands and activators of PKC (21). Uniquely, however, the bryostatins induce only a subset of the responses induced by the phorbol esters and functionally antagonize those responses that they themselves do not induce. Thus, bryostatin 1 blocks the induction by phorbol ester of differentiation in primary mouse keratinocytes 1 (22), HL-60 cells (23), and Friend erythroleukemia cells (24).

The mechanism(s) accounting for the functional antagonism of phorbol ester responses by bryostatin 1 remains largely unresolved, although a variety of mechanistic differences between the action of the phorbol esters and bryostatin 1 have been described. Bryostatin 1 causes a different pattern of translocation of PKC{delta} than do the typical phorbol esters (11). This differential localization, by providing differential access to substrates, could drive different biology. Bryostatin 1 has also been shown to produce more rapid down-regulation of PKC{alpha} in LL-MK2 epithelial cells (25) and of PKC{alpha} and PKCß in human T cells (26) than do the phorbol esters. In addition, bryostatin 1 induced a unique biphasic pattern of down-regulation of PKC{delta}, with high nanomolar concentrations of bryostatin 1 failing to induce down-regulation of PKC{delta} in NIH3T3 cells (27), in primary mouse keratinocytes (22), in B16/F10 melanocytes (28), and in HeLa cells (29). In the NIH3T3 cells (27) and primary mouse keratinocytes (22), moreover, bryostatin 1 was shown to protect PKC{delta} from down-regulation by phorbol esters. The protection of PKC{delta} from down-regulation seems to involve multiple structural elements within PKC, including the catalytic domain (30) and the C1a domain (31).

Understanding of the mechanisms underlying the unique behavior of bryostatin 1 should help to identify the systems in which it has a rational therapeutic application. In the present study, we have tested the effect of the typical phorbol ester, PMA, and of bryostatin 1 on HOP-92 cellular growth and have been able to relate the differential effect of bryostatin 1 to its down-regulation of PKC{delta}.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials. Bryostatin 1 was from the Drug Chemistry and Synthesis Branch, National Cancer Institute (NCI). PMA was purchased from LC Laboratories (Woburn, MA) and dissolved in DMSO. Affinity-purified polyclonal antibodies directed against the various PKC isoforms were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). The PKC inhibitor Gö-698, the calpain inhibitor calpeptin, the calpain inhibitor E64d, the proteasome inhibitor lactacystin, and the caspase inhibitors caspase inhibitor 1 and caspase-3 inhibitor 1 were obtained from Calbiochem (La Jolla, CA). Protease inhibitor cocktail tablets were purchased from Roche Molecular Biochemicals (Indianapolis, IN). Glutamine, RPMI 1640, fetal bovine serum (FBS), and LipofectAMINE Plus reagent were obtained from Invitrogen (Gaithersburg, MD). Enhanced chemiluminescence (ECL) reagents were from Amersham Life Sciences (Arlington Heights, IL). SDS-PAGE precast gels and horseradish peroxidase (HRP)–conjugated anti-rabbit IgG were obtained from Bio-Rad (Hercules, CA).

Construction of GFP-PKC{delta} fusion protein. A plasmid containing the GFP cDNA (pEGFP-N1) was purchased from Clontech Laboratories, Inc. (Palo Alto, CA). A MluI restriction site was generated by inserting a MluI linker into the plasmid digested with SmaI. A mouse PKC{delta} cDNA fragment with XhoI and MluI sites was subcloned into the expression vector pEGFP-N1 with the GFP attached to the 3' end of PKC{delta}. The junction of PKC{delta} and GFP in the constructed plasmid was verified by sequencing, which was done by the DNA Minicore, Division of Basic Sciences, NCI, NIH. Plasmid DNA was prepared using the Endo-Free Qiagen kit (Qiagen GmbH, Hilden, Germany) to remove the bacterial endotoxins.

Expression of GFP-PKC{delta} in HOP-92 cells. HOP-92 cells were seeded onto 40-mm round glass coverslips. Twenty-four hours later, the cells were transfected with the GFP-PKC{delta} construct using LipofectAMINE Plus reagent according to the manufacturer's instruction. Forty-eight hours later, the translocation of GFP-PKC{delta} was evaluated using confocal microscopy.

Confocal fluorescent images were collected with a Bio-Rad MRC 1024 confocal scan head mounted on a Nikon Optishot microscope (Melville, NY) with a x60 planapochromat lens. Excitation at 488 nm was provided with a 522/32 emission filter for green fluorescence. For live cell imaging, a Bioptechs Focht Chamber System (Bioptechs, Butler, PA) was inverted and attached to the microscope stage with a custom stage adapter.

Cell cultures. The HOP-92 (human lung carcinoma) cell line was obtained from the Biological Testing Branch, NCI, NIH (Frederick, MD). The cells were cultured in RPMI 1640 supplemented with 10% FBS and glutamine (2 mg/mL) at 37°C in a humidified atmosphere containing 5% CO2.

RNA isolation. Cells were seeded in six-well plates at a 2 x 105 per well. After treatment, medium was removed and the wells were washed twice with PBS. Trizol reagent (1 mL; Molecular Research Center, Cincinnati, OH) was added to each well. After 5 minutes at room temperature, the supernatants were transferred to Eppendorf tubes and 0.2 mL chloroform/mL was added. Following centrifugation at 10,000 rpm for 10 minutes, the colorless upper aqueous phase was transferred to a fresh tube. RNA was precipitated by mixing with 0.5 mL isopropanol. After centrifugation, the RNA was dissolved in DEPC-treated water. To assure the same concentration of RNA in each sample, the absorbance of the RNA was measured at 260 nm, and the samples were diluted with DEPC-treated water to a final concentration of 1 µg/µL.

Reverse transcription-PCR analysis. PKC{delta} and ß-actin mRNA transcripts were detected by reverse transcription-PCR (RT-PCR). Two kinds of duplex RT-PCR were carried out using the selective primers for PKC{delta} and ß-actin. RT-PCR was carried out using the Takara RNA-PCR kit (Takara Mirus Bio, Madison, WI). For the first-strand cDNA synthesis, 1 µg total RNA was incubated at 42°C for 30 minutes in reverse transcriptase buffer. The Takara PCR kit containing PCR buffer, 0.2 mmol/L deoxynucleotide triphosphate mixture, 0.2 µmol/L of each primer, and 2.5 units Taq polymerase was employed and the reaction was carried out under the following conditions in a MJ Research thermal cycler (MJ Research, Waltham, MA): denaturation (95°C for 30 seconds), annealing (56°C for 30 seconds), and extension (68°C for 1 minute) for 20 or 30 cycles. PCR products were analyzed by agarose gel electrophoresis in the presence of ethidium bromide. The products of amplification were visualized with a UV transilluminator.

Western blotting. Levels of cell cycle regulatory proteins and PKC isozymes from bryostatin 1– or PMA-treated HOP-92 cells were determined by Western blot analysis. Confluent cultures of HOP-92 cells on 60-mm tissue culture plates were treated with bryostatin 1 or PMA (0.1, 1, 10, 100, and 1,000 nmol/L) for 24 hours at 37°C. After treatment, cells were harvested and lysed by incubation in lysis buffer [150 mmol/L NaCl, 20 mmol/L Tris-HCl (pH 7.5), 1 mmol/L phenylmethylsulfonyl fluoride, 1 mmol/L Na3VO4, 25 mmol/L NaF, 1% aprotinin, 10 µg/mL leupeptin] on ice for 30 minutes followed by sonication. Protein concentrations of supernatants were determined by the Bio-Rad DC Microprotein Assay using bovine serum albumin as a protein standard. Aliquots (10 µg) of proteins were fractionated by SDS-PAGE on 10% polyacrylamide gels and then transferred to nitrocellulose membranes. Nonspecific binding of antibody was prevented by incubating the membranes for 1 hour in blocking buffer (PBS, 5% nonfat milk) followed by incubation with buffer containing the ß-actin or anti-PKC isozyme antibodies [PKC{alpha} (C-20), PKCß1 (C-16), PKC{delta} (C-20), PKC{varepsilon} (C-15), and PKCµ (C-20); 1:1,000 dilution]. The membranes were washed 3 x 5 minutes in PBS-Tween 20 (0.05% Tween 20 in PBS)] and incubated for 1 hour at room temperature with the HRP-conjugated secondary antibodies. After washing the membranes for 3 x 5 minutes in PBS-Tween 20 (0.05%), the immunostaining was visualized by ECL. Films were scanned and quantitation was done using Image J software (developed at the National Institute of Mental Health, NIH).

Cellular growth assay. HOP-92 cells were seeded in six-well plates at a density of 0.9 x 104 per well. Twenty-four hours later, the cells were treated with bryostatin 1 (1, 10, 100, and 1,000 nmol/L) or PMA (1, 10, 100, and 1,000 nmol/L) for 1, 2, 4, and 6 days. The number of the cells was determined with a Coulter counter (Beckman Coulter, Fullerton, CA). Growth assays were done at least four times. In other experiments, as indicated in the figure legends, cell proliferation was quantitated using the CyQuant cell proliferation assay (Invitrogen, Carlsbad, CA).

Fluorescence-activated cell sorting analysis. HOP-92 cells were treated with various doses of bryostatin 1 (1-1,000 nmol/L) and PMA (1-1,000 nmol/L), collected 24 hours after treatment, washed with PBS, and fixed in 70% ethanol overnight at 4°C. The fixed cells were pelleted and washed in PBS; 100 µL RNase was then added and the cells were incubated at 37°C for 30 minutes. Propidium iodide (20 µg/mL) in Dulbecco's PBS was added and incubated for 30 minutes at 4°C in the dark. The DNA content in stained nuclei was measured with a flow cytometer (FACSCalibur, BD Biosciences, San Jose, CA) and the data were analyzed with CellQuest software (Becton Dickinson, Mountain View, CA).

Small interfering RNA transfection. RNAs (21-nucleotide) were synthesized and purified by high-performance liquid chromatography (Qiagen). For design of appropriate small interfering RNA (siRNA) sequences targeting PKC{delta}, DNA sequences of the type AA (N19) were selected. The siRNA sequences of siRNA-1, siRNA-2, and siRNA-3 corresponded to the coding regions 202 to 220, 355 to 373, and 186 to 204 nucleotides, respectively, from the first nucleotide of the start codon (siRNA-1: AAGCCGACCATGTATCCTGAG, siRNA-2: AATGGCAAGGCTGAGTTCTGG, and siRNA-3: AACACTGGTGCAGAAGAAGCC). The sequences were subjected to a BLAST search against the human genome to ensure that the sequences were not present in any other known mRNA. For annealing of the siRNAs, complementary single-stranded RNAs were incubated in annealing buffer [20 mmol/L Tris-HCl (pH 7.5), 10 mmol/L MgCl2, 50 mmol/L NaCl] for 1 minute at 90°C followed by 1 hour at 37°C. Transfection of duplex siRNA was done using LipofectAMINE 2000. After transfection for 1, 2, and 3 days, the efficacy of the siRNA treatment for suppressing PKC{delta} expression was assessed by Western blotting.

2,3-Bis[2-methoxy-4-nitro-5-sulfophenyl]-2H-tetrazolium-5-carboxanilide inner salt cell proliferation assay. Cells grown on 96-well plates for 24 hours were transfected with siRNA, the control pCMV vector, and pCMV-PKC{delta}. Cell proliferation at 1, 2, and 3 days after transfection was assessed using the 2,3-bis[2-methoxy-4-nitro-5-sulfophenyl]-2H-tetrazolium-5-carboxanilide inner salt (XTT) assay according to the manufacturer's protocol (Roche Molecular Biochemicals).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Bryostatin 1 and PMA differentially regulate proliferation of HOP-92 cells. We investigated the effect of various doses of bryostatin 1 or PMA on proliferation of HOP-92 cells, a non–small cell lung cancer (NSCLC) cell line (Fig. 1A ). The HOP-92 cells were treated with bryostatin 1 (1-1,000 nmol/L) or PMA (1-1,000 nmol/L) for 24 hours and cellular growth was determined. Bryostatin 1 yielded a biphasic dose-response curve for stimulation of cell growth. Low doses of bryostatin 1 (1 and 10 nmol/L) caused an increase in the number of cells (P < 0.05), whereas high doses of bryostatin 1 (1,000 nmol/L) had no measurable effect. In contrast to treatment with bryostatin 1, treatment with PMA failed to stimulate at 24 hours at any dose.


Figure 1
View larger version (16K):
[in this window]
[in a new window]
 
Figure 1. Effects of bryostatin 1 and PMA on the HOP-92 cellular growth. A, dose-dependent effect of bryostatin 1 and PMA. HOP-92 cells were treated for 24 hours with various doses of bryostatin 1 (1-1,000 nmol/L) or PMA (1-1,000 nmol/L), and cell number was measured in a Coulter counter. Columns, mean of three independent experiments; bars, SE. B, time-dependent effects of bryostatin 1 (10 nmol/L) or PMA (10 nmol/L). HOP-92 cells were treated with bryostatin 1 (10 nmol/L) or PMA (10 nmol/L) for 1, 2, 4, and 6 days and cell number was determined by Coulter counting (cells grown in 6-well plates) or by the CyQuant proliferation assay (cells grown in 96-well plates; separate experiments). Points, mean of four experiments; bars, SE. Cell numbers in the CyQuant proliferation assay were calculated from the values for CyQuant fluorescence as described by the manufacturer. C, flow cytometry analysis of bryostatin 1– or PMA-treated HOP-92 cells. HOP-92 cells were treated with various doses of bryostatin 1 (1-1,000 nmol/L) or PMA (1-1,000 nmol/L) for 24, 48, or 96 hours and then stained with propidium iodide to measure DNA content. The proportion of cells in the various phases of the cell cycle was then determined. Points, mean of six experiments (24 hours) or four experiments (48 and 96 hours); bars, SE.

 
The effect of bryostatin 1 treatment on growth of HOP-92 cells as a function of time was determined for bryostatin 1 at 10 nmol/L, the dose that gave the maximum proliferative response at 24 hours, and for 10 nmol/L PMA (Fig. 1B). After bryostatin 1 treatment, proliferation was significantly increased compared with control as determined by counting in a Coulter counter (P < 0.001, day 1; P < 0.001, day 2; P < 0.05, day 4; P < 0.01, day 6). Conversely, the modest suppression of cellular growth by PMA at 24 hours was much more evident at 2 to 6 days (P < 0.005, day 2; P < 0.04, day 4; P < 0.0001, day 6). Qualitatively similar results were observed when proliferation was measured using the CyQuant proliferation assay (for stimulation of growth by bryostatin 1: P < 0.05, day 1; P < 0.0001, day 2; P < 0.001, day 4; P < 0.0001, day 6).

The inhibition of cell growth by PMA is reminiscent of the effect of PMA on other human NSCLC cell lines, where it is associated with induction of differentiation (32). Furthermore, the known sensitivity of HOP-92 cells to growth inhibition by phorbol esters and related compounds (33) provided an initial motivation for the present study of this cell line.

The effect of bryostatin 1 and PMA treatment on cell cycle variables was determined by flow cytometry. HOP-92 cells were treated with bryostatin 1 (1-1,000 nmol/L) or PMA (1-1,000 nmol/L), and cell cycle variables were determined after 24, 48, and 96 hours of treatment (Fig. 1C). Bryostatin 1 caused a biphasic reduction in the proportion of cells in G0-G1 phase and an increase in the proportion of cells in S phase. The maximal decrease in G0-G1 phase and increase in S phase measured at 24 hours was achieved at 10 nmol/L bryostatin 1, with G0-G1 decreasing from 48.7% to 28.8% (P < 0.01) and S phase increasing from 37.5% to 57.8% (P < 0.05) compared with untreated cells. Conversely, PMA treatment for 24 hours decreased the S phase and increased the G0-G1 phase in a dose-dependent manner. At 48 and 96 hours, the relative proliferative effect of bryostatin 1 was somewhat diminished, as also seen in the growth curves, and the inhibitory effect of PMA remained evident.

Differential down-regulation of PKC isozymes by bryostatin 1 and PMA. We compared the dose-response curves for down-regulation by bryostatin 1 and PMA of the PKC isoforms present in HOP-92 to determine if any of these isoforms showed differential response to these two ligands. Confluent cultures of HOP-92 cells were treated for 24 hours with increasing concentrations of bryostatin 1 (0.1-1,000 nmol/L) or PMA (0.1-1,000 nmol/L) and the levels of the various PKC isoforms ({alpha}, ß1, {epsilon}, µ, and {delta}) were determined by Western blotting (Fig. 2A ). PMA and bryostatin 1 both down-regulated the classic PKCs (PKC{alpha} and PKCß1), with bryostatin 1 being ~10-fold more potent than PMA in each case. PKC{epsilon} was down-regulated only partially by both ligands. Again, bryostatin 1 was somewhat more potent. PKCµ showed little change.


Figure 2
View larger version (25K):
[in this window]
[in a new window]
 
Figure 2. Down-regulation of PKC isozymes induced by bryostatin 1 and PMA. A, HOP-92 cells were treated with various doses of PMA and bryostatin 1 (0.1-1,000 nmol/L) for 24 hours and analyzed by Western blotting. Anti-actin immunostaining was used as a control for protein loading. Representative of three independent experiments. B, HOP-92 cells were treated for 24 hours with the indicated concentrations of bryostatin 1, PMA, or the combination of PMA (100 nmol/L) and bryostatin, after which the relative PKC{delta} protein levels were assessed by scanning densitometry of immunoblots. Points, mean of three to six independent sets of experiments; bars, SE. C, time-dependent down-regulation of PKC{delta} protein. HOP-92 cells were treated with 10 nmol/L bryostatin 1 or 10 nmol/L PMA for 0, 4, 8, 16, and 24 hours. Total cell lysates were prepared and the level of PKC{delta} protein was analyzed by Western blotting. Representative of three experiments. D, RT-PCR analysis of PKC{delta} mRNA after treating HOP-92 cells with bryostatin 1 (10 nmol/L) or PMA (10 nmol/L) for various times (0, 4, 8, 16, and 24 hours). mRNAs were extracted and mRNA expression levels were determined by RT-PCR. Representative of three independent experiments. E, cells were incubated for 1, 2, or 3 days in the presence of bryostatin 1 (10 nmol/L), PMA (100 nmol/L), or the combination of bryostatin 1 (10 nmol/L) and PMA (100 nmol/L). The cellular growth was measured by the CyQuant assay. Columns, mean of four independent experiments; bars, SE.

 
Unlike the other PKC isoforms, PKC{delta} showed a very marked difference in response to bryostatin 1 and to PMA. Whereas PMA at any concentration (0.1-1,000 nmol/L) had little effect on PKC{delta}, bryostatin 1 potently caused down-regulation of PKC{delta} and did so in a biphasic fashion. Low doses (0.1-10 nmol/L) of bryostatin 1 caused marked loss of PKC{delta}, whereas the extent of down-regulation was reduced at higher concentrations of bryostatin 1 (>100 nmol/L). Because this pattern of response of PKC{delta} to bryostatin 1 treatment mirrored that for induction of proliferation of the HOP-92 cells by bryostatin 1, assuming that PKC{delta} inhibited proliferation, we investigated the effect of bryostatin 1 on PKC{delta} in further detail.

Dose- and time-dependent effects of bryostatin 1 and PMA on PKC{delta} expression. The biphasic pattern of down-regulation of PKC{delta} by bryostatin 1 was confirmed in additional experiments and quantitated by densitometry (Fig. 2B). Maximal down-regulation was achieved at 1 to 10 nmol/L bryostatin 1. No effect was observed at 1 to 10 pmol/L bryostatin 1. Likewise, at 1,000 nmol/L bryostatin 1, little down-regulation was seen. When different concentrations of bryostatin 1 (0.001 nmol/L-1 µmol/L) were coapplied with 100 nmol/L PMA, the suppression of PKC{delta} by lower bryostatin 1 concentrations (0.1-10 nmol/L) was blocked. Higher concentrations of bryostatin 1 (10-100 nmol/L) still caused some PKC{delta} suppression, although not to the level observed in the absence of PMA.

We determined the time course for the down-regulation of PKC{delta} in response to 10 nmol/L bryostatin 1 or 10 nmol/L PMA in the HOP-92 cells (Fig. 2C). The level of PKC{delta} had decreased by 8 hours of treatment with 10 nmol/L bryostatin 1 and was markedly reduced by 16 and 24 hours. PMA had little effect on PKC{delta} at any time point tested. To determine whether the reduction in the level of PKC{delta} protein was a direct effect of the bryostatin 1 treatment or whether it was a consequence of an effect of bryostatin 1 on PKC{delta} mRNA expression, the HOP-92 cells were treated with bryostatin 1 (10 nmol/L) or PMA (10 nmol/L), total RNA was extracted, and the PKC{delta} mRNA expression was analyzed by RT-PCR analysis with PKC{delta}-specific primers. The level of expression of the PKC{delta} mRNA was not changed by either treatment (Fig. 2D, suggesting that the reduction in PKC{delta} protein reflected events at the post-transcriptional level.

If the enhanced proliferation of the HOP-92 cells on treatment with 10 nmol/L bryostatin 1 reflected the down-regulation of PKC{delta}, then the ability of 100 nmol/L PMA to largely block this down-regulation of PKC{delta} should be reflected in suppression of the bryostatin 1–induced proliferation. This was indeed the case (Fig. 2E).

Bryostatin 1 and PMA induced translocation of PKC{delta}. Translocation of PKC in response to ligand binding provides another measure of ligand response. We therefore examined the ability of bryostatin 1 (10 nmol/L) and PMA (10 nmol/L) to induce translocation of PKC{delta} in the HOP-92 cells. Treatment with 10 nmol/L bryostatin 1 caused a rapid shift of PKC{delta} from the soluble fraction to the Triton X-100 soluble particulate fraction. Most of the PKC{delta} was lost from the soluble fraction within 10 minutes of treatment and the translocation was complete by 4 hours after treatment (Fig. 3A ). Although 10 nmol/L PMA did not induce the down-regulation of PKC{delta}, PKC{delta} rapidly translocated from the soluble fraction to the Triton X-100 soluble particulate fraction in response to PMA. Partial translocation was evident at 10 minutes, but some of the PKC{delta} remained in the soluble fraction over the duration of the experiment.


Figure 3
View larger version (29K):
[in this window]
[in a new window]
 
Figure 3. Translocation of PKC{delta} by bryostatin 1 and PMA in HOP-92 cells. A, subcellular localization of PKC{delta} on bryostatin 1 and PMA treatment. HOP-92 cells were treated with bryostatin 1 (10 nmol/L) or PMA (10 nmol/L) for 10 minutes, 4 hours, 8 hours, 16 hours, and 24 hours. Cell lysates were prepared and fractionated into soluble fraction and particulate (Triton X-100 soluble fraction). Equal amounts of these fractions and of the total lysates were resolved by SDS-PAGE and Western blotting was done using anti-PKC{delta} antibody. Representative of two independent experiments. B, translocation of PKC{delta} in response to bryostatin 1 and PMA in living HOP-92 cells. Cells were transfected with GFP-PKC{delta}. After 48 hours, cells were treated with either PMA (10 nmol/L) or bryostatin 1 (10 nmol/L) and sequential confocal images were taken every 30 seconds for a period of 20 minutes. Images taken at 0, 5, and 20 minutes after treatment. Four independent experiments yielded similar results.

 
To explore the possibility that a different pattern of translocation of the PKC{delta} by PMA and bryostatin 1 might determine the difference in down-regulation, GFP-tagged PKC{delta} was transiently transfected into HOP-92 cells, and its translocation was monitored in real-time using confocal microscopy (Fig. 3B). In the absence of stimuli, the GFP-PKC{delta} was present in the cytoplasm. When 10 nmol/L PMA was added, GFP-PKC{delta} slowly translocated to the plasma and nuclear membrane. With 10 nmol/L bryostatin 1 treatment, GFP-PKC{delta} also translocated to the cytoplasm and nuclear membrane by 20 minutes.

Overexpression of PKC{delta}-induced inhibition of cellular proliferation. To explore a possible mechanistic link between the effects of bryostatin 1 on PKC{delta} and on cellular proliferation in the HOP-92 cells, we examined the effect of overexpression of PKC{delta}. Cells were transfected with control pCMV vector or with pCMV-PKC{delta} for 48 hours, and cell lysates were then analyzed by Western blotting for the level of PKC{delta} expression (Fig. 4A ). A ~5-fold increase in PKC{delta} expression was detected in the PKC{delta}-transfected cells, whereas the vector alone had no effect. To determine the involvement of PKC{delta} in the regulation of cell proliferation in the HOP-92 cells, the cells were transfected with increasing amounts of pCMV-PKC{delta} or of the control vector and the effects on the cellular proliferation were determined by the XTT assay. Cells overexpressing PKC{delta} exhibited in a dose-dependent manner a lower rate of cell proliferation compared with control cells (Fig. 4B), whereas the cells transfected with the control vector showed no significant change compared with the control. We next examined the effect of bryostatin 1 treatment (Fig. 4C). In untransfected cells or in cells transfected with the empty vector, cellular growth was increased by bryostatin 1 (10 nmol/L) treatment as expected (P < 0.001 and 0.001, respectively). The minor apparent decrease in proliferation in the empty vector transfected cells compared with the controls was not statistically significant (P = 0.27). Overexpression of PKC{delta} decreased proliferation (P < 0.001) as likewise expected. In the PKC{delta} overexpressing cells, however, bryostatin 1 was unable to stimulate proliferation (P = 0.45; Fig. 4C). Consistent with the lack of effect of the bryostatin 1 treatment on proliferation of the HOP-92 cells overexpressing PKC{delta}, bryostatin 1 was likewise unable to induce down-regulation of PKC{delta} in the overexpressing cells (Fig. 4D). This result argues that the degradation pathway for PKC{delta} in response to bryostatin 1 in the HOP-92 cells is of low capacity and subject to saturation. Similar behavior in which overexpression of a PKC isoform renders it insensitive to down-regulation by bryostatin 1 was described for PKC{alpha} in LNCaP cells (34).


Figure 4
View larger version (16K):
[in this window]
[in a new window]
 
Figure 4. Overexpression of PKC{delta} inhibited the cellular growth induced by bryostatin 1. A, overexpression of PKC{delta} in HOP-92 cells. HOP-92 cells were grown in 60-mm plates, transfected with pCMV or pCMV-PKC{delta} (3 µg), and grown for 48 hours, and the expression of PKC{delta} was analyzed by Western blotting with PKC{delta}-specific antibody. B, overexpressed PKC{delta} induced inhibition of cellular growth in HOP-92 cells. Different doses of pCMV (0.01, 0.03, and 0.1 µg) or pCMV-PKC{delta} (0.01, 0.03, and 0.1 µg) were transfected into the HOP-92 cells grown in 96-well plates. Forty-eight hours later, the cellular growth was measured by the XTT assay. Columns, mean of six independent experiments; bars, SE. *, P < 0.05; **, P < 0.01, compared with control, untreated cells. C, overexpressed PKC{delta} inhibited the induction of cellular growth by bryostatin 1. HOP-92 cells were transfected with pCMV-PKC{delta} (0.1 µg); 24 hours later, bryostatin 1 (10 nmol/L) was added. Cells were harvested 48 hours after pCMV-PKC{delta} transfection. Columns, mean of six independent experiments; bars, SE. Statistical comparisons were by the t test. D, effect of bryostatin 1 treatment on the level of PKC{delta} in cells overexpressing PKC{delta}. pCMV-PKC{delta} was transfected into the HOP-92 cells. Twenty-four hours later, cells were treated with bryostatin 1 (10 nmol/L), incubated for 24 hours, and analyzed by Western blotting. Representative of three independent experiments.

 
PKC{delta} knockdown stimulates cellular proliferation. The inhibitory role of PKC{delta} in cell proliferation of the HOP-92 cells was further addressed using a PKC{delta} siRNA strategy to reduce the expression of the endogenous PKC{delta} in the HOP-92 cells. Three different sites of PKC{delta} were selected for design of siRNA constructs and transfected into the HOP-92 cells. Forty-eight hours after transfection, cell lysates were prepared and the expression of PKC{delta} was determined by Western blot analysis using anti-PKC{delta} antibody. Among the three siRNA constructs, siRNA-3 produced strong suppression of PKC{delta} expression (Fig. 5A ). We therefore selected siRNA-3 for further analysis. HOP-92 cells were seeded onto 60-mm plates. Twenty-four hours later, the cells were transfected with PKC{delta} siRNA-3 at three different doses (1, 2, and 4 µg) and the expression of PKC{delta} was determined by Western blotting 1, 2, and 4 days after transfection. Control siRNA (1, 2, and 4 µg) had no effect on PKC{delta} expression (Fig. 5B). Partial suppression of PKC{delta} by the siRNA was apparent by 1 day and almost complete suppression was observed with 4 µg siRNA at 3 days (Fig. 5B). To check the selectivity of the PKC{delta} siRNA, Western blotting was done with anti-PKC{alpha} antibody. The level of PKC{alpha} was not changed. To determine the effect of suppression of PKC{delta} expression by siRNA on HOP-92 cell proliferation, the cells were treated with either the PKC{delta} siRNA or the control siRNA and cellular growth was measured 1 and 3 days later by the XTT assay. Control siRNA did not affect cellular proliferation. PKC{delta} siRNA significantly increased the cellular growth compared with the control (P < 0.01, at both 1 and 3 days; Fig. 5C), and the magnitude of the stimulation was similar to that observed on treatment with 10 nmol/L bryostatin. Although slightly less stimulation was seen at 3 days of treatment with the PKC{delta} siRNA than with 1 day of treatment, this difference was not statistically significant (P = 0.4). Because the extent of knockdown of the PKC{delta} by the siRNA treatment was more pronounced at 3 days than at 1 day, a greater effect at this later time might have been expected.


Figure 5
View larger version (23K):
[in this window]
[in a new window]
 
Figure 5. Effect of suppression of PKC{delta} expression in HOP-92 cells by siRNA. A, choice of siRNA sequences for silencing of PKC{delta}. siRNA-1, siRNA-2, and siRNA-3 targeting human PKC{delta} were transfected into HOP-92 cells. Two days after transfection, the expression of endogenous PKC{delta} in the HOP-92 cells was assessed by Western blotting. Each experiment was repeated at least two additional times with similar results. B, time course of the suppression of endogenous PKC{delta} expression by PKC{delta} siRNA3. HOP-92 cells were grown in 60-mm dishes and transfected with LipofectAMINE alone, PKC{delta} siRNA-3 (1, 2, and 4 µg), or control siRNA (1, 2, and 4 µg). Cells were harvested 1, 2, or 3 days after transfection and the expression of PKC{delta} was assessed by Western blotting. Representative of three independent experiments. C, effects of PKC{delta} siRNA3 on the HOP-92 cell growth. HOP-92 cells were transfected with PKC{delta} siRNA-3 or control siRNA. After 1 and 3 days, cellular growth was measured by the XTT assay. Columns, mean of six independent experiments; bars, SE. **, P < 0.01, compared with control, untreated cells.

 
We conducted limited experiments to determine the proteolytic pathway responsible for the loss of PKC{delta} in response to treatment with 10 nmol/L bryostatin. Inhibition of the calpain pathway either with the calcium chelator BAPTA (Fig. 6A ) or with the calpain inhibitors calpeptin (Fig. 6B) or E64d (Fig. 6C) caused substantial protection of PKC{delta}, with less effect on PKC{alpha}. The proteasome inhibitor lactacystin, conversely, protected PKC{alpha} but not PKC{delta} (Fig. 6D), although some other proteasome inhibitors gave variable protection of PKC{delta} (data not shown). The caspase-1 and caspase-3 inhibitors under these conditions protected neither PKC{delta} nor PKC{alpha} (Fig. 6E). The ability of treatment with calpeptin or BAPTA to inhibit PKC{delta} down-regulation by bryostatin 1 predicted that these treatments would prevent the enhanced proliferation induced by bryostatin 1 treatment. This prediction was confirmed, although these inhibitors by themselves did not inhibit proliferation of the control cells (Fig. 6F).


Figure 6
View larger version (22K):
[in this window]
[in a new window]
 
Figure 6. Effect of inhibitors of protease pathways of the down-regulation of PKC{delta} and PKC{alpha} in response to bryostatin 1 treatment. Cells were incubated for 1 hour with (A) the calcium chelator BAPTA (1-30 µmol/L), (B) the calpain inhibitor calpeptin (10-100 µmol/L), (C) the calpain inhibitor E64d (10-100 µmol/L), (D) the proteasome inhibitor lactacystin (3-10 µmol/L), or (E) the caspase inhibitors caspase inhibitor 1 (10-100 µmol/L) and caspase-3 inhibitor 1 (1-10 µmol/L) before the treatment of bryostatin 1 (10 nmol/L). After 24 hours, whole-cell lysates were analyzed by Western blotting using anti-PKC{alpha} and PKC{delta} antibodies. Representative of three independent experiments (A-E). F, cells were incubated for 1 hour with calpeptin (100 µmol/L) or BAPTA (30 µmol/L). Bryostatin 1 (10 nmol/L) was then added as indicated and incubation continued for 1 or 2 days, after which cellular growth was measured by the CyQuant assay. Columns, mean of seven experiments; bars, SE.

 
We conclude that bryostatin 1 differentially affects cell proliferation of HOP-92 cells compared with the typical phorbol ester PMA. Our results indicate that the selective loss of PKC{delta} induced by bryostatin 1 treatment is sufficient to explain this differential behavior. The calpain degradation pathway is implicated in this differential loss of PKC{delta}.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Bryostatin 1 has attracted considerable attention as a potential therapeutic agent for cancer. Its high potency for PKC and the other signaling proteins containing a phorbol ester/DAG–responsive C1 domain identifies its general site of action (35). Extensive studies have documented the critical role of PKC in cellular signaling by growth factors and other receptors (36, 37) and the rationale for PKC as a therapeutic target in cancer (38, 39). Among high-affinity ligands for PKC, bryostatin 1 is unique in its ability to functionally antagonize many typical phorbol ester responses while activating PKC (21, 24). Critical among the differences in biological response induced by bryostatin 1 and the phorbol esters, such as PMA, is that PMA is a potent tumor promoter in the mouse skin system, whereas bryostatin 1 is not (40).

We were interested in the response of HOP-92 cells because these are one of the more responsive cell lines to PKC activators in the NCI-60 cell line compound screen as indicated by COMPARE (41). Previously, we and others have described that bryostatin 1 can give a biphasic pattern of down-regulation of PKC{delta}, with reduced down-regulation at higher bryostatin 1 concentrations, whereas PMA causes monophasic down-regulation. This pattern of behavior has been seen in NIH3T3 cells (27), primary mouse keratinocytes (22), B16/F10 melanocytes (28), HeLa cells (29), etc. The HOP-92 cell line characterized here revealed a different and previously undescribed pattern of behavior. In this system, whereas bryostatin 1 caused a biphasic pattern of down-regulation of PKC{delta}, PMA treatment failed to cause down-regulation at any concentration.

We were able to link this unique pattern of PKC{delta} down-regulation by bryostatin 1 in the HOP-92 cells to the effect on cell growth of bryostatin 1 in this system. The down-regulation of PKC{delta} was associated with enhanced proliferation/resistance to inhibition of proliferation in these cells. The biphasic dose-response curve for down-regulation was mirrored in the dose-response curve for proliferation. Overexpression of PKC{delta} reduced the proliferation in untreated HOP-92 cells. The overexpression further prevented the down-regulation of PKC{delta} by bryostatin 1 and blocked the enhanced proliferation in response to bryostatin 1. Likewise, the calpain inhibitors calpeptin and BAPTA blocked the PKC{delta} down-regulation by bryostatin 1 and blocked its induction of proliferation. Finally, reduction in the level of PKC{delta} through treatment with siRNA enhanced the proliferation of the HOP-92 cells.

Inhibition of proliferation by PKC{delta} is a generally typical response and has been described on PKC{delta} overexpression in Chinese hamster ovary cells (42), NIH3T3 cells, vascular smooth muscle cells, human glioma cells, and capillary endothelial cells (5, 4345). In vascular smooth muscle, PKC{delta} inhibited cell proliferation by suppressing G1 cyclin expression (43); in capillary endothelial cells, PKC{delta} inhibited the S-phase transition (46). PKC{delta} has likewise been found to be proapoptotic in many systems (47). On the other hand, it is also clear that PKC{delta} can be proliferative in some cell types (4850) and is antiapoptotic in some systems [e.g., A172 glioma cells treated with TRAIL (8), C6 glioma cells infected with Sindbis virus (7), or non–small lung cancer lines A549, H1703, H157, H1355, and H1155 (51)].

Given the diversity of roles of PKC isoforms, an issue for the clinical application of bryostatin 1 has been to find those settings for which there is a solid rationale. Its ability to down-regulate PKC{delta} and to affect cell response in a fashion consistent with this down-regulation of PKC{delta} predicts that it might be useful in those systems in which PKC{delta} plays an antiapoptotic role. The factors determining whether PKC{delta} is proapoptotic or antiapoptotic are not understood, but it is clear that phosphorylation of PKC{delta} on specific tyrosine residues plays a critical role in its functioning (47, 5254).

As yet, relatively few isoform selective ligands for PKC isoforms are available. LY333531 is in clinical trials as a selective enzymatic inhibitor of PKCß (39). ISIS3521 is an antisense oligonucleotide in clinical trials for suppressing the expression of PKC{alpha} (55). We have recently reported the identification of a lead structure with selectivity for the Ras-GRP family of related receptors (56). Our results here fit with the concept that one action of bryostatin 1, at least in appropriate cell types, may be as a functional PKC{delta} selective inhibitor, working through enhanced PKC{delta} degradation. Of course, bryostatin 1 simultaneously will be having effects on other PKC isoforms, the significance of which will depend on the cell type, but systems in which PKC{delta} plays a role are candidates for the therapeutic application of bryostatin 1.


    Acknowledgments
 
Grant support: Intramural Research Program of the Center for Cancer Research, NIH, NCI.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    Footnotes
 
Note: S.H. Choi and T. Hyman contributed equally to the work.

Received 11/22/05. Revised 4/20/06. Accepted 5/17/06.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Dekker LV, Parker PJ. Protein kinase C—a question of specificity. Trends Biochem Sci 1994;19:73–7.[CrossRef][Medline]
  2. Toker A. Signaling through protein kinase C. Front Biosci 1998;3:D1134–47.[Medline]
  3. Parker PJ, Kour G, Marais RM, et al. Protein kinase C—a family affair. Mol Cell Endocrinol 1989;65:1–11.[CrossRef][Medline]
  4. Hurley JH, Newton AC, Parker PJ, Blumberg PM, Nishizuka Y. Taxonomy and function of C1 protein kinase C homology domains. Protein Sci 1998;6:477–80.
  5. Mischak H, Goodnight JA, Kolch W, et al. Overexpression of protein kinase C-{delta} and -{epsilon} in NIH 3T3 cells induces opposite effects on growth, morphology, anchorage dependence, and tumorigenicity. J Biol Chem 1993;268:6090–6.[Abstract/Free Full Text]
  6. Blass M, Kronfeld I, Kazimirsky G, Blumberg PM, Brodie C. Tyrosine phosphorylation of protein kinase C{delta} is essential for its apoptotic effect in response to etoposide. Mol Cell Biol 2002;22:182–95.[Abstract/Free Full Text]
  7. Zrachia A, Dobroslav M, Blass M, et al. Infection of glioma cells with Sindbis virus induces selective activation and tyrosine phosphorylation of protein kinase C{delta}. Implications for Sindbis virus-induced apoptosis. J Biol Chem 2002;277:23693–701.[Abstract/Free Full Text]
  8. Okhrimenko H, Lu W, Xiang C, et al. Roles of tyrosine phosphorylation and cleavage of protein kinase C{delta} in its protective effect against tumor necrosis factor-related apoptosis inducing ligand-induced apoptosis. J Biol Chem 2005;280:23643–52.[Abstract/Free Full Text]
  9. Blumberg PM. Complexities of the protein kinase C pathway. Mol Carcinog 1991;4:339–44.[Medline]
  10. Mochly-Rosen D, Gordon AS. Anchoring proteins for protein kinase C: a means for isozyme selectivity. FASEB J 1998;12:35–42.[Abstract/Free Full Text]
  11. Wang QJ, Bhattacharyya D, Garfield S, Nacro K, Marquez VE, Blumberg PM. Differential localization of protein kinase C{delta} by phorbol esters and related compounds using a fusion protein with green fluorescent protein. J Biol Chem 1999;274:37233–9.[Abstract/Free Full Text]
  12. Sakai N, Sasaki K, Ikegaki N, Shirai Y, Ono Y, Saito N. Direct visualization of the translocation of the {gamma}-subspecies of protein kinase C in living cells using fusion proteins with green fluorescent protein. J Cell Biol 1997;139:1465–76.[Abstract/Free Full Text]
  13. Harada K, Maekawa T, Abu Shama KM, Yamashima T, Yoshida K. Translocation and down-regulation of protein kinase C-{alpha}, -ß, and -{gamma} isoforms during ischemia-reperfusion in rat brain. J Neurochem 1999;72:2556–64.[CrossRef][Medline]
  14. Lu Z, Liu D, Hornia A, Devonish W, Pagano M, Foster DA. Activation of protein kinase C triggers its ubiquitination and degradation. Mol Cell Biol 1998;18:839–45.[Abstract/Free Full Text]
  15. Kishimoto A, Mikawa K, Hashimoto K, et al. Limited proteolysis of protein kinase C subspecies by calcium-dependent neutral protease (calpain). J Biol Chem 1989;264:4088–92.[Abstract/Free Full Text]
  16. Jalava A, Lintunen M, Heikkila J. Protein kinase C-{alpha} but not protein kinase C-{epsilon} is differentially down-regulated by bryostatin 1 and tetradecanoyl phorbol 13-acetate in SH-SY5Y human neuroblastoma cells. Biochem Biophys Res Commun 1993;191:472–8.[CrossRef][Medline]
  17. MacKenzie S, Fleming I, Houslay MD, Anderson NG, Kilgour E. Growth hormone and phorbol esters require specific protein kinase C isoforms to activate mitogen-activated protein kinases in 3T3-442A cells. Biochem J 1997;324:159–65.
  18. Zonder JA, Shields AF, Zalupski M, et al. A phase II trial of bryostatin 1 in the treatment of metastatic colorectal cancer. Clin Cancer Res 2001;7:38–42.[Abstract/Free Full Text]
  19. Pagliaro L, Daliani D, Amato R, et al. A Phase II trial of bryostatin-1 for patients with metastatic renal cell carcinoma. Cancer 2000;89:615–8.[CrossRef][Medline]
  20. Dowlati A, Lazarus HM, Hartman P, et al. Phase I and correlative study of combination bryostatin 1 and vincristine in relapsed B-cell malignancies. Clin Cancer Res 2003;9:5929–35.[Abstract/Free Full Text]
  21. Kraft AS, Smith JB, Berkow RL. Bryostatin, an activator of the calcium phospholipid-dependent protein kinase, blocks phorbol ester-induced differentiation of human promyelocytic leukemia cells HL-60. Proc Natl Acad Sci U S A 1986;83:1334–8.[Abstract/Free Full Text]
  22. Szallasi Z, Denning MF, Smith CB, et al. Bryostatin 1 protects protein kinase C-{delta} from down-regulation in mouse keratinocytes in parallel with its inhibition of phorbol ester-induced differentiation. Mol Pharmacol 1994;46:840–50.[Abstract]
  23. Stone RM, Sariban E, Pettit GR, Kufe DW. Bryostatin 1 activates protein kinase C and induces monocytic differentiation of HL-60 cells. Blood 1988;72:208–13.[Abstract/Free Full Text]
  24. Dell'Aquila ML, Nguyen HT, Herald CL, Pettit GR, Blumberg PM. Inhibition by bryostatin 1 of the phorbol ester-induced blockage of differentiation in hexamethylene bisacetamide-treated Friend erythroleukemia cells. Cancer Res 1987;47:6006–9.[Abstract/Free Full Text]
  25. Lee HW, Smith L, Pettit GR, Bingham Smith J. Dephosphorylation of activated protein kinase C contributes to downregulation by bryostatin. Am J Physiol 1996;271:C304–11.
  26. Isakov N, Galron D, Mustelin T, Pettit GR, Altman A. Inhibition of phorbol ester-induced T cell proliferation by bryostatin is associated with rapid degradation of protein kinase C. J Immunol 1993;150:1195–204.[Abstract]
  27. Szallasi Z, Smith CB, Pettit GR, Blumberg PM. Differential regulation of protein kinase C isozymes by bryostatin 1 and phorbol 12-myristate 13-acetate in NIH 3T3 fibroblasts. J Biol Chem 1994;269:2118–24.[Abstract/Free Full Text]
  28. Szallasi Z, Du L, Levine R, et al. The bryostatins inhibit growth of B16/F10 melanoma cells in vitro through a protein kinase C-independent mechanism: dissociation of activities using 26-epi-bryostatin 1. Cancer Res 1996;56:2105–11.[Abstract/Free Full Text]
  29. Basu A, Akkaraju GR. Regulation of caspase activation and cis-diamminedichloroplatinum(II)-induced cell death by protein kinase C. Biochemistry 1999;38:4245–51.[CrossRef][Medline]
  30. Lorenzo PS, Bogi K, Acs P, Pettit GR, Blumberg PM. The catalytic domain of protein kinase C{delta} confers protection from down-regulation induced by bryostatin 1. J Biol Chem 1997;272:33338–43.[Abstract/Free Full Text]
  31. Lorenzo PS, Bogi K, Hughes KM, et al. Differential roles of the tandem C1 domains of protein kinase C{delta} in the biphasic down-regulation induced by bryostatin 1. Cancer Res 1999;59:6137–44.[Abstract/Free Full Text]
  32. Salge U, Kilian P, Neumann K, Elsasser HP, Havemann K, Heidtmann HH. Differentiation capacity of human non-small-cell lung cancer cell lines after exposure to phorbol ester. Int J Cancer 1990;45:1143–50.[Medline]
  33. Shao L, Lewin NE, Lorenzo PS, et al. Iridals are a novel class of ligands for phorbol ester receptors with modest selectivity for the RasGRP receptor subfamily. J Med Chem 2001;44:3872–80.[CrossRef][Medline]
  34. Gschwend JE, Fair WR, Powell CT. Bryostatin 1 induces prolonged activation of extracellular regulated protein kinases in and apoptosis of LNCaP human prostate cancer cells overexpressing protein kinase C{alpha}. Mol Pharmacol 2000;57:1224–34.[Abstract/Free Full Text]
  35. Newton AC. Regulation of protein kinase C. Curr Opin Cell Biol 1997;9:161–7.[CrossRef][Medline]
  36. Axmann A, Seidel D, Reimann T, Hempel U, Wenzel KW. Transforming growth factor-ß1-induced activation of the Raf-MEK-MAPK signaling pathway in rat lung fibroblasts via a PKC-dependent mechanism. Biochem Biophys Res Commun 1998;249:456–60.[CrossRef][Medline]
  37. Gliki G, Abu-Ghazaleh R, Jezequel S, Wheeler-Jones C, Zachary I. Vascular endothelial growth factor-induced prostacyclin production is mediated by a protein kinase C (PKC)-dependent activation of extracellular signal-regulated protein kinases 1 and 2 involving PKC-{delta} and by mobilization of intracellular Ca2+. Biochem J 2001;353:503–12.[CrossRef][Medline]
  38. Hofmann J. Protein kinase C isozymes as potential targets for anticancer therapy. Curr Cancer Drug Targets 2004;4:125–46.[CrossRef][Medline]
  39. Fields AP, Gustafson WC. Protein kinase C in disease: cancer. Methods Mol Biol 2003;233:519–37.[Medline]
  40. Szallasi Z, Krsmanovic L, Blumberg PM. Nonpromoting 12-deoxyphorbol 13-esters inhibit phorbol 12-myristate 13-acetate induced tumor promotion in CD-1 mouse skin. Cancer Res 1993;53:2507–12.[Abstract/Free Full Text]
  41. Paull KD, Shoemaker RH, Hodes L, et al. Display and analysis of patterns of differential activity of drugs against human tumor cell lines: development of mean graph and COMPARE algorithm. J Natl Cancer Inst 1989;81:1088–92.[Abstract/Free Full Text]
  42. Watanabe T, Ono Y, Taniyama Y, et al. Cell division arrest induced by phorbol ester in CHO cells overexpressing protein kinase C-{delta} subspecies. Proc Natl Acad Sci U S A 1992;89:10159–63.[Abstract/Free Full Text]
  43. Fukumoto S, Nishizawa Y, Hosoi M, et al. Protein kinase C{delta} inhibits the proliferation of vascular smooth muscle cells by suppressing G1 cyclin expression. J Biol Chem 1997;272:13816–22.[Abstract/Free Full Text]
  44. Mishima K, Ohno S, Shitara N, Yamaoka K, Suzuki K. Opposite effects of the overexpression of protein kinase C {gamma} and {delta} on the growth properties of human glioma cell line U251 MG. Biochem Biophys Res Commun 1994;201:363–72.[CrossRef][Medline]
  45. Harrington EO, Loffler J, Nelson PR, Kent KC, Simons M, Ware JA. Enhancement of migration by protein kinase C{alpha} and inhibition of proliferation and cell cycle progression by protein kinase C{delta} in capillary endothelial cells. J Biol Chem 1997;272:7390–7.[Abstract/Free Full Text]
  46. Ashton AW, Watanabe G, Albanese C, Harrington EO, Ware JA, Pestell RG. Protein kinase C{delta} inhibition of S-phase transition in capillary endothelial cells involves the cyclin-dependent kinase inhibitor p27(Kip1). J Biol Chem 1999;274:20805–11.[Abstract/Free Full Text]
  47. Brodie C, Blumberg PM. Regulation of cell apoptosis by protein kinase C{delta}. Apoptosis 2003;8:19–27.[CrossRef][Medline]
  48. Skaletz-Rorowski A, Eschert H, Leng J, et al. PKC{delta}-induced activation of MAPK pathway is required for bFGF-stimulated proliferation of coronary smooth muscle cells. Cardiovasc Res 2005;67:142–50.[Abstract/Free Full Text]
  49. Xu J, Rockow S, Kim S, Xiong W, Li W. Interferons block protein kinase C-dependent but not-independent activation of Raf-1 and mitogen-activated protein kinases and mitogenesis in NIH 3T3 cells. Mol Cell Biol 1994;14:8018–27.[Abstract/Free Full Text]
  50. Kitamura K, Mizuno K, Etoh A, et al. The second phase activation of protein kinase C{delta} at late G1 is required for DNA synthesis in serum-induced cell cycle progression. Genes Cells 2003;8:311–24.[Abstract]
  51. Clark AS, West KA, Blumberg PM, Dennis PA. Altered protein kinase C (PKC) isoforms in non-small cell lung cancer cells: PKC{delta} promotes cellular survival and chemotherapeutic resistance. Cancer Res 2003;63:780–6.[Abstract/Free Full Text]
  52. Yuspa SH. The pathogenesis of squamous cell cancer: lessons learned from studies of skin carcinogenesis. J Dermatol Sci 1998;17:1–7.[CrossRef][Medline]
  53. Steinberg SF. Distinctive activation mechanisms and functions for protein kinase C{delta}. Biochem J 2004;384:449–59.[CrossRef][Medline]
  54. Kikkawa U, Matsuzaki H, Yamamoto T. Protein kinase C{delta} (PKC{delta}): activation mechanisms and functions. J Biochem (Tokyo) 2002;132:831–9.[Abstract/Free Full Text]
  55. Tortora G, Ciardiello F. Antisense strategies targeting protein kinase C: preclinical and clinical development. Semin Oncol 2003;30:26–31.[Medline]
  56. Pu Y, Perry NA, Yang D, et al. A novel diacylglycerol-lactone shows marked selectivity in vitro among C1 domains of protein kinase C (PKC) isoforms {alpha} and {delta} as well as selectivity for RasGRP compared with PKC{alpha}. J Biol Chem 2005;280:27329–38.[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Choi, S. H.
Right arrow Articles by Blumberg, P. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Choi, S. H.
Right arrow Articles by Blumberg, P. M.