| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Immunology |
1 Center for Immunology, Department of Pathology and Immunology, 2 Department of Otolaryngology, and 3 Division of Rheumatology, Washington University School of Medicine, St. Louis, Missouri
Requests for reprints: Robert D. Schreiber, Department of Pathology and Immunology, Washington University School of Medicine, Box 8118, 660 South Euclid Avenue, St. Louis, MO 63110. Phone: 314-362-8748; Fax: 314-362-8888; E-mail: schreiber{at}immunology.wustl.edu.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|

-T cells, and
ß-T cells. During the last few years, we have continued to refine our understanding of cancer immunoediting such that we now envisage it as a process composed of three phases: elimination, which represents the host-protective actions of immunity; equilibrium, which potentially maintains cancer in a dormant or persistent state; and escape, where clinically apparent tumors emerge and grow in an unrestrained manner. Although it has been difficult to experimentally document this process in humans, various clinical studies strongly suggest that immune responses to cancer indeed occur (6, 13, 14). Immunosuppressed transplant recipients develop a higher incidence of cancers of nonviral and viral origin compared with the normal population. Furthermore, cancer patients frequently develop T cells reactive with the tumor that they bear, and spontaneous regression has been noted in patients with melanoma and paraneoplastic neurologic degenerations (1519). Additionally, a positive correlation has been found between the presence, location, and activation state of CD8+ T cells in a tumor and disease prognosis (2023).
Nevertheless, the emergence of a clinically apparent tumor is evidence that endogenous tumor surveillance mechanisms have failed (24). The cancer immunoediting hypothesis suggests that, because of its interaction with the immune system, a tumor may either be altered in a way so that it escapes immune recognition or may escape immune destruction by actively suppressing the antitumor immune response (3, 7). Over the past 10 years, a subset of T cells, which exert immunosuppressive function, has been characterized (2527) and was shown not only to prevent autoimmunity but also to inhibit immune responses against developing tumors. These cells are known as regulatory T cells (Tregs) and are a lineage of CD4+ T cells that express the surface molecule CD25 and the transcription factor Foxp3. Tregs suppress T-cell proliferation and cytokine secretion via contact-dependent and cytokine-mediated mechanisms.
In mice, the participation of Tregs in promoting tumor escape from immune control was inferred from the observation that pretreatment of mice with a single dose of the CD25-specific, depleting PC61 monoclonal antibody (mAb) before tumor transplant converted the growth phenotype of some but not all tumors from progressor to regressor (2831). Furthermore, the combination of PC61 pretreatment and subsequent vaccination against a tumor led to enhanced protection of mice to tumor challenge (32, 33). However, these experiments used tumor cells derived from immunocompetent hosts that presumably had already developed mechanisms of escaping immune control (7, 8, 24). Even more importantly, these studies did not explore whether all tumors, even those which eventually regress, might evoke a natural Treg response due to expression of endogenous self-antigens (25). In humans, a causal role for Tregs in tumor escape has yet to be clearly established (reviewed in refs. 24, 25, 27). Thus, the issue of whether Tregs function as a physiologically relevant mechanism of tumor escape remains unresolved.
We previously reported the development of a unique mouse model, in which similar tumors arising in immunocompetent versus immunodeficient mice display reproducibly different growth behaviors when transplanted into naive, syngeneic wild-type (WT) recipients (3). 3'-Methylcholanthrene (MCA) sarcomas from immunodeficient 129/Sv strain RAG2/ mice, generated in the absence of adaptive immunity (i.e., unedited sarcomas), display high immunogenicity, and many are rejected when transplanted into naive, syngeneic WT hosts. For this reason, these tumors are called regressor tumors. In contrast, MCA sarcomas derived from 129/Sv strain WT mice (progressor tumors) are able to grow when transferred into naive recipients presumably because they arose by evading cancer immunosurveillance. In the current report, we present the first in-depth comparison of the antitumor response to these regressor and progressor tumor cell lines, placing special attention on the presence and/or action of Tregs in the developing tumor. Our results document that one factor regulating the regressor versus progressor phenotypes of MCA sarcomas is their differential capacity to recruit and/or activate regulatory versus effector T cells.
| Materials and Methods |
|---|
|
|
|---|
Tumor cell lines. Regressor and progressor MCA sarcoma cell lines were derived from 129/Sv RAG2/ or WT mice by injecting MCA (Sigma, St. Louis, MO) as described (3). The growth characteristics have been described elsewhere (3, 8). All the sarcomas grow with similar kinetics in vitro and following s.c. injection of 1 x 106 cells into RAG2/ mice. When injected into WT mice (1 x 106 s.c.), regressor tumors grow to 5 to 10 mm (average diameter) and then are rejected 8 to 10 days after tumor transplant. Progressor tumors all reach 20 mm by 20 to 30 days after tumor transplant, after which time the mice are sacrificed. Cell lines were maintained in RPMI 1640 (Cambrex, East Rutherford, NJ) supplemented with 10% FCS (Hyclone, Logan, UT) as described previously. The BALB/c-derived fibrosarcoma cell line CMS-5 was obtained from Dr. Hiroshi Shiku (MIE University School of Medicine, MIE, Japan; ref. 34).
Mice. 129/Sv strain or (129/Sv x C57BL/6) F1 mice were purchased from Taconic Farms (Germantown, NY). BALB/c (Thy1.2) and BALB/c.SCID (Thy1.2) mice were from the National Cancer Institute (Bethesda, MD). BALB/c (Thy1.1) mice were a gift from Paul Allen (Washington University, St. Louis, MO).
Antibodies and fluorescence-activated cell sorting analysis. CD45-FITC, CD4-APC, CD8-APC, CD25-PE (PC61 clone), CD25-FITC (7D4 clone), B220-PE, CD44-FITC, CD62L-PE, MAC1-APC, F4/80-PE, CD69-FITC, purified anti-CD16/32, and the bromodeoxyuridine (BrdUrd) staining kit were from BD PharMingen (San Diego, CA). The Foxp3 staining kit was from eBiosciences (San Diego, CA). Staining was conducted for 15 to 20 minutes at 4°C in fluorescence-activated cell sorting (FACS) tubes containing 1 to 2 million total cells, 0.5 to 1 µL antibody, 1 µL Fc block (anti-CD16/32), and 100 µL staining buffer [PBS with 1% FCS and 0.05% NaN3 (Sigma)]. Propidium iodide (PI) was from Sigma and was added at 1 µg/mL immediately before FACS analysis. For quantitative analysis of tumor-infiltrating lymphocytes/leukocytes (TIL) and lymph node populations, a CD45+PI gate was used. For Foxp3 and BrdUrd analysis of lymph node and TILs, small lymphocytes were analyzed base on a forward and side scatter gate rather that CD45 and PI because the cells had to be permeabilized. Gated events (10,000) were collected on a FACSCalibur and analyzed using FloJo software. The mAb PC61 was generated from purified supernatant of the PC61 hybridoma obtained from the American Type Culture Collection (Manassas, VA). Control rat IgG was obtained from Sigma.
PC61 depletion. Four days before tumor transplant, mice were injected i.p. with a single dose of 250 µg of purified PC61 or control Rat IgG. PC61 treatment led to a 70% depletion of CD25+ cells as detected by flow cytometry using the 7D4 CD25-specific mAb that recognizes an epitope on CD25 separate from that recognized by PC61 (data not shown). After 7 days, an increase in 7D4-staining cells could be detected in the thymus of nontumor-bearing mice, suggesting that the depletion was transient, although full recovery of CD25+ cells was not evident even at day 14 (data not shown).
Tumor transplantation. Tumor cell lines were washed thrice with PBS and resuspended at 5 x 106/mL. Recipient 129/Sv strain or (129/Sv x C57BL/6) F1 strain mice were either pretreated with a single i.p. injection of 250 µg PC61 or control rat IgG at day 4 or used untreated and then were injected with 1 x 106 tumor cells in 0.2 mL s.c. along the flank on day 0. The mice were monitored for tumor growth by measurement of mean tumor diameter, defined as the average of the two maximum dimensions of the tumor mass. Some mice also received a single injection of 100 µg BrdUrd (Sigma) i.p. and subsequently were maintained on water containing 0.8 mg/mL BrdUrd and 1% sucrose, which was changed daily.
Tumor, draining lymph node, and nondraining lymph node harvest. On various days after transplant, tumor was excised from mice, minced, and treated with 1 mg/mL type IV collagenase (Sigma) in HBSS for 2 hours at room temperature. The ipsilateral inguinal (tumor draining) or contralateral (nondraining) lymph nodes were also harvested, and single-cell suspensions were made by crushing the lymph nodes between two glass slides. All cell suspensions were vigorously resuspended, washed in FACS staining buffer, and filtered before staining.
Foxp3 real-time PCR. The tumor cell suspension was incubated in a Petri dish at 37°C for 2 hours to remove tumor cells and macrophages. The lymph node cell suspensions were incubated with anti-B220 Dynabeads (Dynal Biotech, Brown Deer, WI) to deplete B cells using a magnet (Dynal Biotech). Partially purified cell suspensions were stained with CD4-APC and CD25-PE and sorted on a FACSVantage. RNA was prepared from sorted cells using the RNA-Bee protocol (Tel-Test, Friendswood, TX). cDNA was made using the Applied Biosystems (Branchburg, NJ) protocol. Real-time PCRs were done using the following primers: Foxp3-1, GGCCCTTCTCCAGGACAGA; Foxp3-2, GCTGATCATGGCTGGGTTGT; and Foxp3-probe, 6FAMACTTCATGCATCAGCTCTCCACTGTGGATTAMRA (35, 36). CD3 primers were ordered through Assays-on-Demand (Applied Biosystems) and used according to the manufacturer's instructions.
Adoptive transfer. Lymph nodes and spleens from BALB/c mice were homogenized and pooled. For CD25-depleted cells, Thy1.1 mice were used. Cells were stained with CD25-PE, incubated with anti-PE magnetic-activated cell sorting (MACS) beads (Miltenyi Biotech, Auburn, CA), and loaded onto a MACS MS column (Miltenyi Biotech). The flow through was collected and analyzed by FACS. The population was >99% CD25 negative. For CD25-enriched cells, Thy1.2 mice were used. Cells were magnetically depleted using B220 and CD8 Dynabeads, stained with CD25-PE, incubated with anti-PE MACS beads, and loaded onto a MACS MS column. The bound cells were eluted and consisted of >85% CD4+CD25+ cells. The purified cells were mixed and injected i.v. into BALB/c.SCID mice. The ratio of the transferred CD4+CD25Thy1.1+ to CD4+CD25+Thy1.2+ cells was 10:1.
| Results |
|---|
|
|
|---|
|
The CD4+CD25+ cells that infiltrate progressor and regressor tumors express Foxp3. Because CD25 can be expressed on either activated helper cells or Tregs, we next determined whether the CD25+ cells that infiltrated the tumors expressed the transcription factor Foxp3, a marker that is pathognomonic of the Treg lineage (26). We therefore stained TILs or draining lymph node cells for intracellular Foxp3. Anti-Foxp3 stained a subset of CD4+ cells, which did not stain with control IgG (Fig. 2A ). The subset of Foxp3+ cells was also identified by anti-CD25 and was at a higher percentage in progressor WT-P1 than in regressor RAG2-R1 CD4+ TILs (Fig. 2B), confirming the findings in Fig. 1B (right). When CD4+CD25+ cells from either progressor or regressor TILs were sorted, the expression of Foxp3 (as assessed by real-time PCR) was similar to that of endogenous Tregs isolated from naive animals (Fig. 2C). Thus, the CD25+ cells that infiltrate progressor and regressor tumors express amounts of Foxp3 similar to endogenous Tregs. Our results are consistent with the findings in patients that increased percentages of Foxp3-expressing cells in a tumor mass are indicators of poor prognosis (21, 22).
|
|
We next examined the effect of depleting CD25+ cells on the kinetics of accumulation of different immune cells in the tumor. As shown in Fig. 3C (left), PC61 pretreatment led to a maintenance and even slight increase of CD45+ cells in the tumor over the 14-day observation period. In contrast, CD45+ TILs decreased in control Igtreated mice. By day 14, a 1.6-fold difference in TILs was observed (P = 0.0079). Concomitantly, PC61 pretreatment caused a 2.7-fold increase in CD8+ cell percentages in the tumor compared with control Ig pretreatment (P = 0.028; Fig. 3C, middle) but did not affect the percentage of CD4+ cells within the TIL population (Fig. 3C, right). The selective CD8+ T-cell increase within the tumor coincided with tumor regression, suggesting that Tregs limited the participation of CD8+ T cells in controlling tumor growth.
Because other groups have shown a function for Tregs in the lymph node, we also examined draining lymph node and nondraining lymph node cells of tumor-bearing mice pretreated with PC61 or control rat Ig. We did not find differences in the percentages of CD25+ cells within the CD4+ subset in the draining lymph node versus nondraining lymph node of tumor-bearing mice during the time course of our experiment (Fig. 3A, middle and right). Furthermore, no change in the composition of the major T-cell subsets was observed in PC61 versus rat Ig pretreatment in the draining and nondraining lymph nodes over the 2-week tumor challenge (data not shown).
PC61-treated mice have larger draining lymph nodes after tumor challenge compared with control Igtreated mice. Although there was no change in the composition of the draining lymph nodes of PC61-treated, tumor-bearing mice, there was a 2.7-fold increase in cellularity in lymph nodes from PC61-treated and rat Igtreated mice (Fig. 4A ). To test whether the increased cellularity was due to enhanced proliferation, we measured the incorporation of BrdUrd into CD8+ and CD4+ draining lymph node versus nondraining lymph node cells from tumor-bearing mice pretreated with PC61 or rat Ig. Although PC61 treatment enhanced the incorporation of BrdUrd into CD8+ and CD4+ cells from draining lymph node but not from nondraining lymph node of tumor-bearing mice (Fig. 4B-C, left), the enhanced incorporation was not statistically significant (P = 0.163 and 0.052, respectively) and did not correspond to the 2.7-fold increase in tumor-draining lymph node cellularity. Thus, the major effect of PC61 was to increase lymph node cellularity without affecting changes in any particular cellular subset. This finding suggests that Tregs limit the recruitment and/or migration of polyclonal lymphocytes to areas of immune activation.
|
CD25+CD4+ cells are actively proliferating within tumors. In many tumor systems, it is unclear whether tumor-infiltrating Tregs are activated and/or proliferating. Recently, it was shown that colon and melanoma tumors contain immature dendritic cells that can induce Treg proliferation through a transforming growth factor-ß (TGF-ß)-dependent mechanism (41). To determine whether CD25+CD4+ TILs were actively proliferating in progressor and regressor MCA sarcomas, we monitored CD4+ TILs and draining lymph node cells from tumor-bearing mice for BrdUrd incorporation and CD25 positivity. As shown in Fig. 5A , proliferating cells from a representative mouse bearing a progressor tumor could be distinguished from nonproliferating cells within both CD25+ and CD25 subsets in TIL and draining lymph node cell preparations. When these analyses were conducted using four mice per group, 63% of CD4+CD25+ TILs incorporated BrdUrd compared with 14% of CD4+CD25+ draining lymph node cells, a 4.5-fold increase (Fig. 5B, left). Furthermore, there was a greater percentage of BrdUrd+ cells within the CD25+ subset versus the CD25 subset of CD4+ TILs in both progressor and regressor tumors (Fig. 5B), confirming previous studies that Tregs may represent a subset of CD4+ cells, which are partially activated and have higher turnover. We were unable to costain BrdUrd and Foxp3 because the fixation conditions were different for the different antibodies. However, because virtually all CD25+ TILs were Foxp3+ (Fig. 2B), we conclude that Tregs are activated to proliferate within both progressively growing and rejecting MCA sarcomas.
|
We sorted CD25+CD4+ cells from the lymph nodes and spleens of naive BALB/c mice congenic for the Thy1.2 marker and mixed these cells with Thy1.1+ BALB/c splenocytes that had been depleted of CD25+ cells. We then reconstituted BALB/c strain severe combined immunodeficient (SCID) mice with the mixture of Thy1.1+CD25+CD4+ and Thy1.2+CD25 cells and challenged the reconstituted host with CMS-5. As observed in WT mice, reconstituted SCID mice responded to tumor challenge by recruiting CD25+CD4+ cells into the developing tumor mass (Fig. 6 ). These cells represented 30% to 50% of CD4+ cells within the TIL population (data not shown). Notably, 80% of CD25+CD4+ TILs expressed Thy1.2, showing that they were indeed derived from native peripheral CD25+ cells rather than from CD25 cells that were induced to express CD25. Thus, the tumor microenvironment preferentially recruits and activates natural peripheral Tregs rather than inducing Treg development from CD25 cells.
|
| Discussion |
|---|
|
|
|---|
For progressively growing tumors, this ratio is tipped to favoring Tregs. In contrast, for regressor tumors, the balance is tipped toward the effector T cells and, thus, the tumor is rejected. This hypothesis is supported by the findings that manipulations, which decrease the regulatory to effector T-cell ratio, such as depletion with PC61 or increasing effector T-cell precursors through immunization (44),4 can lead to a successful antitumor response and rejection of progressor tumors. In addition, manipulations that increase the regulatory to effector T-cell ratio, such as immunization of naive mice with known Treg epitopes, establish an in vivo environment that is less capable of eliminating developing tumors (45, 46). Moreover, our conclusions using an experimentally tractable mouse tumor transplantation approach are consistent with those stemming from analysis of Treg to CD8+ T-cell ratios found in naturally occurring human primary tumors (22). Specifically, cancer patients, whose tumors contain high levels of Tregs compared with CD8+ cells, have a poor clinical prognosis. Conversely, patients with tumors containing high numbers of CD8+ T cells relative to Tregs have a favorable prognosis.
Several experimental findings support the hypothesis that the increase in Tregs in progressor tumors is causally related to tumor progression. First, Tregs accumulated early within the tumor. Second, depletion of the Tregs before tumor challenge led to tumor rejection, a result that correlated with increased CD8+ proliferation and accumulation in the tumor. Third, the Tregs within progressor tumors were actively proliferating, suggesting that they were activated and could exert their immunosuppressive function at a time point early enough to influence subsequent immune events.
We also present the novel finding that the CD4+CD25+ tumor-infiltrating cells are derived from the peripheral CD4+CD25+ Treg pool. Previous studies have shown that Tregs can be induced from CD25 cells under conditions that lead to tolerance to foreign antigens (38, 47). Although many groups have shown Treg infiltration into tumors, it has, until now, not been clear whether tumor-infiltrating Tregs are converted from CD4+CD25 precursors or derived from the preexisting CD4+CD25+ cellular pool. Our results clearly establish that the vast majority of tumor-infiltrating Tregs originates from peripheral CD4+CD25+ cells in the MCA sarcoma model. The implication of these findings is that the specificity of tumor-infiltrating Tregs must reflect that of the peripheral CD4+CD25+ cellular pool, which is thought to be directed toward self-antigens (48). This conclusion suggests that the specificity of the Treg populations that participate in suppressing tumor immunity would be distinct from that of CD4+CD25 cells, which display a distinct spectrum of T-cell receptor sequences (48) and which may be the cellular sources of CD4+ helper T cells needed to promote the antitumor response. Thus, our data provide support for the tenet that presentation of endogenous self-antigens by tumors recruits and activates peripheral native Tregs, which function to protect the tumor from "autoimmunity" and thus facilitate escape from immune rejection (25, 30).
We speculate that the number of regulatory and effector T cells within a developed tumor reflects not only the inherent host response against antigens recognized by these two cell populations but also the immunologic environment in which the tumor originally formed. We propose that progressor tumors, because they arose in an editing environment, express antigens with either a higher quantity and/or quality of Treg epitopes compared with effector T-cell epitopes. In contrast, regressor tumors, which arose in a nonediting environment, may have stronger and/or greater numbers of effector versus regulatory T-cell epitopes. This antigen imbalance model will need to be tested further by identifying the relative distribution of regulatory and effector T-cell epitopes within regressor versus progressor tumors. Several Treg antigens have already been identified in fibrosarcomas from immunocompetent BALB/c mice (45). These include the self-proteins DnaJ-like 2, Galectin-8, and Ligase 1, and their common characteristic is their expression of CD4+ epitopes but not CD8+ epitopes. However, although highly relevant in the context of BALB/c tumor models, these same antigens are not differentially expressed in our 129/Sv strain progressor versus regressor tumors.4 Thus, the antigen imbalance model must also take into account the contextual immunogenicity of a multiantigenic tumor.
The differential accumulation of Tregs into progressor versus regressor tumors can also be attributed to differences in recruitment and/or expansion of Tregs within the tumor microenvironment. In particular, the secretion of TGF-ß, which often occurs within the tumor microenvironment, has been shown to enhance Treg proliferation (41, 43, 47). In our studies, we found that CD25+ cells in regressor tumors incorporated BrdUrd at an equivalent rate as in progressor tumors, suggesting that the microenvironments (e.g., TGF-ß production) of both regressor and progressor tumors may be similar in their capacity to support Treg proliferation. Further studies will delineate the relative contribution of tumor antigen content versus TGF-ß production in setting the regulatory to effector T-cell ratio during tumor development.
In conclusion, we have taken advantage of the availability of large cohorts of well-characterized MCA sarcomas from WT and immunodeficient mice to show that one major difference between tumor progression and rejection is the relative proportion of CD4+CD25+Foxp3+ cells that become associated with the tumor mass. These Tregs are activated to proliferate, derive from peripheral CD4+CD25+ cells, and function to inhibit CD8+ cell proliferation and potentially effector functions in progressor tumors. We propose that both regressor and progressor tumors contain effector and regulatory T-cell antigens. However, the balance of these antigens may have been preestablished by a cancer immunoediting process that acted during tumor development. From an evolutionary perspective, we hypothesize that evoking Treg activity may represent the most direct and generalizable mechanism by which tumors evade immune destruction, as Tregs would exert a "dominant" form of immunotolerance on many different cell types, such as NK and CD8+ cells (25, 27, 49, 50). In contrast, other immunoediting changes that result in the elimination of specific immune recognition structures on the tumor might be considered "recessive," as other forms of immune attack on the tumor would remain unaltered. Future studies will begin to define whether this dominant form of tumor escape can be modulated to effect clinical tumor regression.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Dr. Hiroshi Shiku for CMS-5, Paul Allen for the congenic BALB/c mice, Ken Matsui for help with the adoptive transfers, and Lloyd Old, Catherine Koebel, Lyse Norian, Gavin Dunn, and Fei Shih for critical discussion of the article.
| Footnotes |
|---|
Received 2/13/06. Revised 4/21/06. Accepted 4/27/06.
| References |
|---|
|
|
|---|

T cells. Science 2001;294:6059.
-dependent tumor surveillance system in immunocompetent mice. Proc Natl Acad Sci U S A 1998;95:755661.
and lymphocytes prevent primary tumour development and shape tumour immunogenicity. Nature 2001;410:110711.[CrossRef][Medline]
T cells. J Exp Med 2004;199:87984.
. J Exp Med 2002;196:12934.
) monoclonal antibody. Cancer Res 1999;59:312833.
-induced, CD8(+) T-cell-dependent immune defense of B16 melanoma. Cancer Res 2001;61:86436.This article has been cited by other articles:
![]() |
N. Chaput, G. Darrasse-Jeze, A.-S. Bergot, C. Cordier, S. Ngo-Abdalla, D. Klatzmann, and O. Azogui Regulatory T Cells Prevent CD8 T Cell Maturation by Inhibiting CD4 Th Cells at Tumor Sites J. Immunol., October 15, 2007; 179(8): 4969 - 4978. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. H. Schreiber The Use of FoxP3 as a Biomarker and Prognostic Factor for Malignant Human Tumors Cancer Epidemiol. Biomarkers Prev., October 1, 2007; 16(10): 1931 - 1934. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Gao, S.-J. Qiu, J. Fan, J. Zhou, X.-Y. Wang, Y.-S. Xiao, Y. Xu, Y.-W. Li, and Z.-Y. Tang Intratumoral Balance of Regulatory and Cytotoxic T Cells Is Associated With Prognosis of Hepatocellular Carcinoma After Resection J. Clin. Oncol., June 20, 2007; 25(18): 2586 - 2593. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Cell Growth & Differentiation |