Cancer Research Targets EMT and Cancer Progression and Treatment
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by López-Knowles, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by López-Knowles, E.
[Cancer Research 66, 7401-7404, August 1, 2006]
© 2006 American Association for Cancer Research

Priority Reports

PIK3CA Mutations Are an Early Genetic Alteration Associated with FGFR3 Mutations in Superficial Papillary Bladder Tumors

Elena López-Knowles1, Silvia Hernández2, Núria Malats1, Manolis Kogevinas1, Josep Lloreta2,3, Alfredo Carrato4, Adonina Tardón5, Consol Serra2,6, Francisco X. Real1,2 EPICURO Study Group Investigators

1 Institut Municipal d'Investigació Mèdica; 2 Universitat Pompeu Fabra; 3 Hospital del Mar, Barcelona, Spain; 4 Hospital General Universitario, Instituto Biología Molecular y Celular, Universidad Miguel Hernández, Elche, Spain; 5 Universidad de Oviedo, Oviedo, Spain; and 6 Consorci Hospitalari Parc Tauli, Sabadell, Spain

Requests for reprints: Francisco X. Real, Institut Municipal d'Investigació Mèdica, Universitat Pompeu Fabra, Carrer del Dr. Aiguader 80, 08003 Barcelona, Spain. Phone: 34-93-2211009; Fax: 34-93-2213237; E-mail: preal{at}imim.es.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Bladder tumors constitute a very heterogeneous disease. Superficial tumors are characterized by a high prevalence of FGFR3 mutations and chromosome 9 alterations. High-grade and muscle-invasive tumors are characterized by Tp53 mutations and aneuploidy. We have analyzed the sequence of exons 9 and 20 of PIK3CA in a panel of bladder tumors covering the whole spectrum of the disease. DNA from formalin-fixed, paraffin-embedded tumor sections was amplified by PCR and products were sequenced. In an unselected panel of tumors representative of the disease, the PIK3CA mutation prevalence was 13% (11 of 87). Mutations occurred mainly at the previously identified hotspots (codons 542, 545, 1007, and 1047). The distribution according to stage was as follows: papillary urothelial neoplasms of uncertain malignant potential (PUNLMP; 11 of 43, 25.6%), Ta (9 of 57, 16%), T1 (2 of 10, 20%), and muscle-invasive tumors (0 of 20, 0%; P = 0.019). Mutations were associated with low-grade tumors: grade 1 (6 of 27, 22.2%), grade 2 (3 of 23, 13%), and grade 3 (2 of 37, 5.4%; P = 0.047). Overall, PIK3CA mutations were strongly associated with FGFR3 mutations: 18 of 69 (26%) FGFR3mut tumors were PIK3CAmut, versus 4 of 58 (6.9%) FGFR3wt tumors (P = 0.005). Our findings indicate that PIK3CA mutations are a common event that can occur early in bladder carcinogenesis and support the notion that papillary and muscle-invasive tumors arise through different molecular pathways. PIK3CA may constitute a novel diagnostic and prognostic tool, as well as a therapeutic target, in bladder cancer. (Cancer Res 2006; 66(15): 7401-4)


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
The phosphoinositide 3-kinase (PI3K) pathway plays a crucial role in the generation of 3'-phosphoinositides that, on binding to the pleckstrin homology domain of 3'-phosphoinositide-dependent kinase 1 and Akt, cause their translocation to the plasma membrane and activation. Several oncogenes have been shown to activate this pathway, including PI3Ks and Akt. Conversely, tumor suppressors such as phosphatase and tensin homologue (PTEN) and TSC2 inactivate it. In recent years, gene amplification, gene loss, and point mutations that can lead to an up-regulation of the activity of the PI3K pathway have been reported in human tumors (1).

The PI3K family is composed of three members that differ in their substrate specificity, activation mechanisms, and expression patterns. Class I enzymes are further subdivided into A and B types, the former being coupled to signal transduction by receptor tyrosine kinases and the latter to G-coupled receptors (2). Class IA enzymes are the only ones thus far shown to be directly involved in carcinogenesis: the catalytic p110{alpha} subunit, encoded by the PIK3CA locus, has recently been shown to be mutated in tumors from the colon, stomach, endometrium, ovary, thyroid, breast, and glioblastomas; the p110ß and p110{delta} subunits have been studied less extensively and have not been found to be mutated (1). Mutations in the regulatory p85 subunit have rarely been reported; their biological significance is uncertain. PIK3CA mutations occur mainly in the regions encoding for the helical and kinase domains and have been clearly shown to have oncogenic properties in a variety of assays (1, 3–5). However, little is known about the stages at which these mutations arise during carcinogenesis or about their association with tumor evolution.

Bladder cancer is an excellent paradigm for the study of tumor development and progression. The majority of tumors are urothelial cell carcinomas and are classified on the basis of bladder wall involvement (Ta, T1-T4) and nuclear grade (G1-G3). PUNLMPs have been attributed a very low risk of progression and are classified separately (6). It is currently thought that urothelial cell carcinomas progress through two different pathways: one, involving ~75% of cases, is associated with papillary growth, presentation as Ta or T1 stage tumors, and generally good prognosis. These tumors almost universally display alterations of genes in chromosome 9 and frequent mutations in FGFR3 or, alternatively, Ras genes (7). The other pathway is associated with dysplasia, muscle invasion, poor prognosis, Tp53 mutations, and genomic instability (8). Bladder cancer presents several formidable challenges: (a) many patients with low-grade papillary tumors present numerous recurrences that require continued medical control and the use of invasive procedures, and a few of them progress to develop muscle-invasive disease; (b) a subset of patients present with nonmuscle invasive high-grade Ta or T1 tumors that have a high risk of becoming muscle invasive, and the identification of risk factors predictive of disease progression is of utmost importance; (c) finally, other patients present with muscle-invasive or metastatic tumors and their disease is life-threatening (9).

In the course of a BAC array-CGH analysis of bladder cancer, we have found that the BAC harboring PIK3CA is gained or amplified in 54% or 9.7% of T1G3 tumors, respectively.7 We therefore hypothesized that this gene might also undergo activating mutations in bladder cancer. Here, we present evidence that PIK3CA mutations occur in ~20% of bladder tumors of low grade and stage. By contrast, mutations are less common in high-grade and invasive tumors. Mutations generally occur in the cluster regions and codons previously reported (1, 10). We also show that mutations occur preferentially in FGFR3-mutant tumors. These findings may have important implications to develop better strategies for bladder cancer detection as well as for the design of targeted therapy.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Bladder cancer cell lines. A panel of 14 bladder cancer cell lines (Table 1 ) was used for the analyses. Cells were obtained from the Ludwig Institute for Cancer Research New York Branch (Sloan-Kettering Institute) or from Yves Fradet (Laval University, Québec, Canada). DNA was extracted using Qiamp DNA Mini kit (Qiagen, Hilden, Germany).


View this table:
[in this window]
[in a new window]
  		Table 1. Mutational analysis of PIK3CA, FGFR3, and Tp53 in bladder cancer cell lines

 
Patients and tumors. Cases were drawn from the EPICURO Study, which is composed of 1,356 patients with bladder cancer recruited from 1997 to 2001 in 18 hospitals in Spain (11). For this work, a subset of cases (n = 87) representative of the whole study population was identified through stage/grade stratification and random selection. Based on the initial results, we subsequently analyzed all PUNLMPs from the study (n = 43). Staging and grading of tumors was carried out according to the criteria of the tumor-node-metastasis classification and the WHO International Society of Urological Pathology (8). Diagnostic slides from all paraffin-embedded blocks corresponding to each case were reviewed by a panel of expert pathologists to confirm diagnosis and ensure uniformity of classification criteria. The characteristics of cases included in the study are shown in Supplementary Table S1. Written informed consent was obtained from all patients. The study was approved by the Ethics Committees of all participating institutions.

Mutational analyses. Microdissection, DNA extraction, and controls used for PCR have been reported elsewhere (11). Primers were designed to avoid amplification of a known PIK3CA pseudogene: 9F TGAAAATGTATTTGCTTTTTCTGT, 9R TGTAAATTCTGCTTTATTTATTCC; 20.1F TTTGCTCCAAACTGACCAA, 20.1R GCATGCTGTTTAATTGTGTGG, 20.2F ACTGAGCAAGAGGCTTTGGA, and 20.2R TTTGGACTTAAGGCATAACATGAA. PCR reactions were done using 10 to 50 ng of DNA, 0.2 µmol/L of each primer, 200 µmol/L deoxynucleotide triphosphates, 3.5 mmol/L MgCl2, 1x PCR II buffer, and 1.5 units of Amplitaq Gold DNA polymerase (Applied Biosystems, Foster City, CA). PCR conditions were as follows: 94°C (10 minutes) for 1 cycle, 94°C (40 seconds), 60°C (40 seconds), 72°C (40 seconds) for 42 cycles, and a final extension step of 72°C (10 minutes). All mutations were confirmed by analyzing the products of a second independent PCR. When a previously undescribed sequence variant was found in tumor DNA, it was confirmed using independent PCR reaction products. Germ line DNA was used to determine the somatic nature of previously undescribed variants. As quality control, 6% of all PCR products were sequenced in both directions and findings were replicated. FGFR3 mutational analysis was carried out as described elsewhere (11).

Statistical analyses. Association between PIK3CA and FGFR3 mutational status was tested by applying {chi}2 Mantel-Haenszel test. The trend of PIK3CA mutational prevalence according to stage and grade was estimated using {chi}2 for linear trend test.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Mutational analysis of PIK3CA in bladder cancer cell lines. We analyzed exons 9 and 20 in a panel of 14 bladder cancer cell lines; 2 (14.3%) were found to have a mutation (Table 1). MGH-U4 had the H1047R hotspot mutation, which is widely reported in several tumor types (1, 9); in these cells, both FGFR3 and exons 4 to 9 of Tp53 were wild type. 253J cells harbored the E545G mutation; this codon is a hotspot in PIK3CA but the most commonly reported mutation is the E545K substitution. These cells also display wild-type FGFR3 and Tp53 genes. RT4, the only line analyzed derived from a low-grade papillary tumor, had normal PIK3CA sequences. Table 1 summarizes the results of mutational analysis in these cell lines.

Mutational analysis of PIK3CA in bladder cancer tissues. The tumors included cover the whole spectrum of bladder cancer and their distribution by T and G is representative of the disease at presentation. Overall, 11 of 87 (13%) tumors harbored PIK3CA mutations. The distribution according to stage was as follows: Ta (9 of 57, 16%), T1 (2 of 10, 20%), and muscle-invasive tumors (0 of 20, 0%; P = 0.098). The prevalence of mutations was higher in low-grade tumors: grade 1 (6 of 27, 22.2%), grade 2 (3 of 23, 13%), and grade 3 (2 of 37, 5.4%; P = 0.047; Fig. 1 ). Most mutations were found at hotspot codons: E542K (n = 1), E545K (n = 5), G1007R (n = 1), H1047L (n = 1), and H1047R (n = 3). Eleven of 87 cases harbored a G-to-A germ line polymorphism located at –55 bp from the start of exon 9, which was unrelated to the somatic mutations and of which the significance is unknown.


Figure 1
View larger version (14K):
[in this window]
[in a new window]
  		Figure 1. Prevalence of PIK3CA and FGFR3 mutations in bladder tumors according to T stage and grade.

 
Mutational analysis of PIK3CA in PUNLMP. The results described above suggested that PIK3CA mutations are associated with superficial tumors. Therefore, we extended our initial study to include all PUNLMP from our study. Eleven of 43 (25.6%) tumors were mutant; when this group was included to compare the prevalence of PIK3CA mutations according to tumor progression (PUNLMP, Ta, T1, and muscle invasive), the P value of the trend test was highly significant (P = 0.019). The mutations identified were E542K (n = 3), E545K (n = 4), E545G (n = 1), H1047L (n = 1), and H1047R (n = 2). These findings support the notion that PIK3CA mutations can occur early in the course of urothelial carcinogenesis (i.e., before muscle invasion occurs).

Association of PIK3CA mutations with alterations in FGFR3. FGFR3 mutations are associated with low-stage and low-grade urothelial tumors and thought to occur early in tumor development (7, 12). Therefore, the pattern of PIK3CA mutations suggested that this genetic change might constitute an alternative pathway to urothelial cell carcinoma development. FGFR3 exons 7 and 10 were amplified and sequenced and the results of the analysis of mutations in both genes are shown in Table 2 and Supplementary Table S2. All but one of the PIK3CA mutations found in PUNLMP occurred among FGFR3-mutant samples. Among tumors of higher stage or grade, 8 of 11 PIK3CA-mutant tumors also harbored FGFR3 mutant alleles, supporting the notion that mutations in these two genes do not represent alternative pathways of tumor progression. The results were analyzed also according to different tumor strata. Tumors were categorized into three groups on the basis of the T stage, grade, prevalence of FGFR3 mutations, and prognosis (13, 14): TaG1 and TaG2 tumors; high-grade nonmuscle invasive tumors (TaG3 and T1G3 tumors); and muscle-invasive tumors. Eighteen of 69 (26%) FGFR3mut tumors were PIK3CAmut, versus 4 of 58 (6.9%) FGFR3wt tumors (P = 0.005). The findings were similar in the three tumor groups described above (Table 2). These results indicate that PIK3CA mutations are strongly associated with FGFR3 mutations.


View this table:
[in this window]
[in a new window]
  		Table 2. Association of PIK3CA and FGFR3 mutations in bladder tumors

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
PI3K and Akt kinases link crucial signaling pathways involved in cancer development and progression: they are activated by receptor tyrosine kinases (in part through ras proteins), modulate p53 activity through murine double minute-2 phosphorylation, modulate the pRb pathway through induction of cyclin D and inhibition of its degradation, and regulate the Wnt pathway through glycogen synthase kinase 3ß (2). Furthermore, the PI3K pathway affects fundamental processes such as protein synthesis and cellular growth, mediated by mammalian target of rapamycin and S6 kinase.

A recently reported mechanism for PI3K pathway activation in cancer cells is the presence of activating mutations (1, 3–5, 15). Here, we have searched for activating mutations in PIK3CA in bladder tumors. We find that mutations occur in ~20% of superficial tumors and have a very low prevalence among muscle-invasive tumors. Within the former group, PIK3CA mutations tend to occur in a subset of cases harboring FGFR3 mutations, supporting the notion that they do not represent an alternative pathway of tumor progression. The lower prevalence of PIK3CA mutations in muscle-invasive tumors further strengthens the notion that papillary and muscle-invasive tumors are two different molecular entities.

Somatic FGFR3 mutations present in bladder tumors also occur as germ line alterations in patients with skeletal dysplasias (16). It has been shown that in chondrocytes, FGFR3 activation leads to growth arrest, differentiation, and apoptosis, whereas PI3K pathway activation can bypass these effects and enhance cell survival (17). FGFR3 mutations are associated with bladder tumors of good prognosis (12, 13, 18). By contrast, FGFR3 mutations fail to predict the risk of recurrence, progression, or death among patients with higher stage or grade in superficial tumors (11), suggesting that their effect is overridden by additional genetic alterations. Based on these observations and the findings in chondrocytes (17), it is conceivable that activation of the PI3K pathway in bladder cancer may contribute to enhance the malignant behavior of FGFR3-mutant tumors.

A striking observation is that the prevalence of PIK3CA mutations decreases with increasing stage and grade. It is tempting to speculate that the PI3K pathway may contribute to bladder cancer progression through different molecular mechanisms: in low-grade, low-stage tumors, PIK3CA mutations would play a major role; in higher-stage, higher-grade tumors, genomic changes, such as PIK3CA gain/amplification and PTEN loss, may play a more crucial role. This notion would be supported by the finding that PTEN loss of expression has been reported to be associated with muscle-invasive tumors (19). Furthermore, we have found that 10q23 losses, where the tumor suppressor PTEN maps, are associated with high tumor stage and grade, with a prevalence of 58% in T1G3 and muscle-invasive tumors.7 Other genes may also play a role: TSC1 is mutated in a small proportion of bladder tumors (20), leading to activation of mammalian target of rapamycin, a downstream component of the PI3K pathway. However, mutations in TSC1 have not been reported to be associated with stage or grade. Further work will be necessary to precisely establish the role of the PI3K pathway in bladder cancer progression. The cell lines of which the PIK3CA mutations status is reported herein may be useful for these studies. However, it is known that bladder cancer lines do not adequately represent the spectrum of bladder cancer from patients: few of them are derived from papillary low-grade superficial tumors and only 2 of 14 lines tested had mutations in FGFR3, a proportion that is much lower than that found in bladder tumors.

The association of PIK3CA mutations with superficial tumors suggests that they may also be of diagnostic and prognostic value. The mutations found in bladder cancer occur in the same codons in which they have been described in other tumors (1). Because only a few nucleotides are mutated, diagnostic strategies for early detection of tumor recurrences may be warranted. Furthermore, PIK3CA mutations may identify a subset of FGFR3-mutant tumors with discrete clinical behavior and thus be of prognostic use. Whyte et al. (21) have used microarrays to describe a gene expression profile characteristic of cultured cells harboring mutations in PIK3CA. These cells also showed significantly increased sensitivity to various compounds, including topoisomerase I inhibitors, when compared with cells with wild-type PIK3CA (21). It is thus conceivable that a PIK3CA mutation–associated expression profile can also be identified in bladder tumors.

Based on the findings reported herein, large, preferably prospective, studies should be conducted to determine the prognostic value of PIK3CA mutations in combination with FGFR3 mutations in bladder cancer. Our findings also support the notion of combining drugs targeting FGFR3 and PIK3CA for the treatment of superficial urothelial cell carcinoma.


   Acknowledgments
 
Grant support: Grants FIS 00/0745, C03/009, C03/010, G03/160, and G03/174 from Instituto de Salud Carlos III, Ministerio de Sanidad.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank the many investigators, nurses, and monitors having participated in the EPICURO study for their numerous contributions; F.J. Rodríguez, A. Alfaro, and G. Carretero for technical assistance; F. Fernández and A. Amorós for statistical help; Dr. I. Campbell for providing unpublished primer sequences; Dr. F. Waldman for valuable contributions; H. Larue and Y. Fradet for providing information on bladder cancer cell lines; and Drs. X. Mayol and G. Gil for critical comments to a previous version of the manuscript.


   Footnotes
 
Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/).

7 E. López-Knowles et al., in preparation. Back

Received 3/30/06. Revised 5/15/06. Accepted 6/15/06.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Bader AG, Kang S, Zhao L, Vogt PK. Oncogenic PI3K deregulates transcription and translation. Nat Rev Cancer 2005;5:921–9.[CrossRef][Medline]
  2. García Z, Kumar A, Marqués M, Cortés I, Carrera AC. Phosphoinositide 3-kinase controls early and late events in mammalian cell division. EMBO J 2006;25:655–61.[CrossRef][Medline]
  3. Samuels Y, Diaz LA, Jr., Schmidt-Kittler O, et al. Mutant PIK3CA promotes cell growth and invasion of human cancer cells. Cancer Cell 2005;7:561–73.[CrossRef][Medline]
  4. Bader AG, Kang S, Vogt PK. Cancer-specific mutations in PIK3CA are oncogenic in vivo. Proc Natl Acad Sci U S A 2006;103:1475–9.[Abstract/Free Full Text]
  5. Zhao JJ, Liu Z, Wang L, Shin E, Loda MF, Roberts TM. The oncogenic properties of mutant p110{alpha} and p110ß phosphatidylinositol 3-kinases in human mammary epithelial cells. Proc Natl Acad Sci U S A 2005;102:18443–8.[Abstract/Free Full Text]
  6. Epstein JI, Amin BM, Reuter VR, Mostofi FK; Bladder Consensus Conference Committee. The World Health Organization/International Society of Urological Pathology consensus classification of urothelial (transitional cell) neoplasms of the urinary bladder. Am J Surg Pathol 1998;22:1435–48.[CrossRef][Medline]
  7. Jebar AH, Hurst CD, Tomlinson DC, Johnston C, Taylor CF, Knowles MA. FGFR3 and Ras gene mutations are mutually exclusive genetic events in urothelial cell carcinoma. Oncogene 2005;24:5218–25.[CrossRef][Medline]
  8. Knowles MA. Molecular subtypes of bladder cancer: Jekyll and Hyde or chalk and cheese. Carcinogenesis 2006;27:361–73.[Abstract/Free Full Text]
  9. Dinney CP, McKonkey DJ, Milligan RE, et al. Focus on bladder cancer. Cancer Cell 2004;6:111–6.[CrossRef][Medline]
  10. Karakas B, Bachman KE, Park BH. Mutation of the PIK3CA oncogene in human cancers. Br J Cancer 2006;94:455–9.[CrossRef][Medline]
  11. Hernández S, Lopez-Knowles E, Lloreta J, et al. FGFR3 and TP53 mutations in T1G3 transitional bladder carcinomas: independent distribution and lack of association with prognosis. Clin Cancer Res 2005;11:5444–50.[Abstract/Free Full Text]
  12. Cappellen D, De Oliveira C, Ricol D, et al. Frequent activating mutations of FGFR3 in human bladder and cervix carcinomas. Nat Genet 1999;23:18–20.[Medline]
  13. Hernández S, López-Knowles E, Lloreta J, et al; on behalf of the EPICURO Study Investigators. FGFR3 mutations as a prognostic factor in non-muscle invasive urothelial bladder carcinomas: results of a prospective study. J Clin Oncol. In press 2006.
  14. Malats N, Bustos A, Nascimento CM, et al. P53 as a prognostic marker for bladder cancer: a meta-analysis and review. Lancet Oncol 2005;6:678–86.[Medline]
  15. Samuels Y, Wang Z, Bardelli A, et al. High frequency of mutations of the PIK3CA gene in human cancers. Science 2004;304:554.[Free Full Text]
  16. Ornitz DM, Marie PJ. FGF signalling pathways in endochondral and intramembranous bone development and human genetic disease. Genes Dev 2002;16:1446–65.[Free Full Text]
  17. Koike M, Yamanaka Y, Inoue M, Tanaka H, Nishimura R, Seino Y. Insulin-like growth factor-1 rescues the mutated FGF receptor 3 (G380R) expressing ATDC5 cells from apoptosis through phosphatidylinositol 3-kinase and MAPK. J Bone Miner Res 2003;18:2043–51.[CrossRef][Medline]
  18. van Rhijn BW, Vis AN, van der Kwast TH, et al. Molecular grading of urothelial cell carcinoma with fibroblast growth factor receptor 3 and MIB-1 is superior to pathologic grade for the prediction of clinical outcome. J Clin Oncol 2003;21:1912–21.[Abstract/Free Full Text]
  19. Koksal IT, Yasar D, Dirice E, et al. Differential PTEN protein expression profiles in superficial versus invasive bladder cancers. Urol Int 2005;75:102–6.[CrossRef][Medline]
  20. Hernigold N, Devlin J, Davies AM, Aveyard JS, Abuchi T, Knowles MA. Mutation of the 9q34 gene TSC1 in sporadic bladder cancer. Oncogene 1999;18:2657–61.[CrossRef][Medline]
  21. Whyte DB, Holbeck SL. Correlation of PIK3CA mutations with gene expression and drug sensitivity in NCI-60 cell lines. Biochem Biophys Res Commun 2006;340:469–75.[CrossRef][Medline]



This article has been cited by other articles:


Home page
 Clin. Cancer Res.Home page
F. M. Platt, C. D. Hurst, C. F. Taylor, W. M. Gregory, P. Harnden, and M. A. Knowles
Spectrum of Phosphatidylinositol 3-Kinase Pathway Gene Alterations in Bladder Cancer
Clin. Cancer Res., October 1, 2009; 15(19): 6008 - 6017.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
C. Hafner, E. Lopez-Knowles, N. M. Luis, A. Toll, E. Baselga, A. Fernandez-Casado, S. Hernandez, A. Ribe, T. Mentzel, R. Stoehr, et al.
Oncogenic PIK3CA mutations occur in epidermal nevi and seborrheic keratoses with a characteristic mutation pattern
PNAS, August 14, 2007; 104(33): 13450 - 13454.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by López-Knowles, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by López-Knowles, E.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online