
[Cancer Research 66, 7502-7508, August 1, 2006]
© 2006 American Association for Cancer Research
Molecular Biology, Pathobiology, and Genetics |
MLH3 Mutation in Endometrial Cancer
Nicholas P. Taylor1,
Matthew A. Powell1,
Randall K. Gibb1,
Janet S. Rader1,
Phyllis C. Huettner2,
Stephen N. Thibodeau4,
David G. Mutch1 and
Paul J. Goodfellow1,3
1 Department of Obstetrics and Gynecology, Division of Gynecologic Oncology; Departments of 2 Pathology and Immunology and 3 Surgery, Washington University School of Medicine, St. Louis, Missouri; and 4 Laboratory Medicine and Pathology, Mayo Clinical College of Medicine, Rochester, Minnesota
Requests for reprints: Nicholas P. Taylor, Washington University School of Medicine, 4911 Barnes-Jewish Hospital Plaza, Maternity Building, 3rd Floor, St. Louis, MO 63110. Phone: 314-362-1977; Fax: 314-362-2893; E-mail: taylorni{at}wustl.edu.
 |
Abstract
|
|---|
MLH3 is a recently described member of the DNA mismatch repair gene family. Based on its interaction with the MutL homologue MLH1, it was postulated that MLH3 might play a role in tumorigenesis. Germ line and somatic mutations in MLH3 have been identified in a small fraction of colorectal cancers, but the role of MLH3 in colorectal cancer tumorigenesis remains controversial. We investigated MLH3's role in endometrial tumorigenesis through analysis of tumor and germ line DNA from 57 endometrial cancer patients who were at increased risk for having inherited cancer susceptibility. Patients with known MSH2 or MSH6 mutations were excluded as well as those who had MLH1-methylated tumors. Sixteen different variants were identified by single-strand conformational variant analysis. Of the 12 missense changes identified, three were somatic mutations. One patient had a germ line missense variant and loss of heterozygosity (LOH) in her tumor specimen. There was no evidence of MLH3 promoter methylation based on combined bisulfite restriction analysis. The identification of inherited missense variants, somatic missense mutations (present in 3 of 57 tumors), and LOH in the tumor from a patient with a germ line missense change suggest a role for MLH3 in endometrial tumorigenesis. (Cancer Res 2006; 66(15): 7502-8)
 |
Introduction
|
|---|
Genomic instability is an essential feature of human cancers and generally takes the form of either microsatellite instability or chromosomal instability (14). Defective DNA mismatch repair (DMMR) leading to a microsatellite instability (MSI) phenotype is seen in 17% to 30% of endometrial cancers (59). There are two possible explanations for how defects in DMMR contribute to tumorigenesis. When DMMR function is lost, the mutation rate increases dramatically. It has been suggested that tumor suppressor genes or critical cell cycle regulators may preferentially accumulate frameshift and/or single-base mismatch mutations in cells lacking DMMR (8, 10, 11). Alternatively, defective DMMR may fail to trigger apoptosis in cells with overwhelming DNA damage (12). Although considerable progress has been made in understanding the molecular basis of DMMR deficiency in endometrial tumorigenesis, a sizable fraction of sporadic MSI-positive endometrial cancers do not have identifiable mutations or epigenetic inactivation of one of the known DMMR genes (9).
MLH3 is a DMMR gene family member that has been investigated in hereditary and sporadic colorectal cancers (13, 14). The role of MLH3 mutation in colorectal tumorigenesis, however, remains controversial (1517). MLH3 was cloned using the MLH1-PMS2 binding domain, and initial functional evaluation suggested a role for MLH3 in the DNA repair process (18). In vitro studies in yeast showed that the MLH1-MLH3 complex participates in repairing insertion/deletion type mutations and has some functional redundancy with the MLH1-PMS2 complex (19). In a Pms2 null mouse cells, Mlh1 levels were normal, suggesting that Mlh1 may bind an alternative protein, such as Mlh3, to mediate DMMR (20, 21). MLH1 seems to interact with MLH3 and have some DMMR function in vitro, but its role in vivo is less clear (22). Initial studies in Mlh3 null mice suggested that Mlh3 played a role in meiosis but had a limited role in tumor formation (2325). Recent investigation, however, has shown that Mlh3 null mice have an abnormal response to DNA damage and increased cancer susceptibility (26). Taken together, it seems that MLH3 is likely to play a limited role in DMMR but may contribute to carcinogenesis through abnormal interaction with apoptotic pathways.
Studies in primary colorectal cancers indicate that MLH3 mutation plays a minor role in colorectal cancer tumorigenesis. A low frequency of pathogenic MLH3 mutations have been identified in inherited (hereditary nonpolyposis colorectal cancer or HNPCC) colorectal cancer (1417). Sporadic colorectal cancers with MSI frequently have somatic MLH3 mutations (
25%), but it is unclear if MLH3 mutations are a cause or consequence of defective DMMR (13). We hypothesized that MLH3 mutation may be important to endometrial tumorigenesis, as cancers of the colon and endometrium have a different spectrum of DMMR defects. For example, MSH2 and MSH6 loss are observed more frequently in endometrial cancer than colorectal cancer (27), and MSH6 mutations seem to confer a high risk for endometrial cancers (28). In a series of consecutively collected endometrial cancers, germ line MSH6 mutations were found in 5.5% of MSI-high tumors (9). These MSH6 mutations were shown to be highly penetrant (29).
Our efforts to define the role MLH3 mutation plays in endometrial cancers were focused on women with clinical or molecular features suggestive of inherited cancer susceptibility, including women who had early-onset endometrial cancer, synchronous or metachronous malignancies, and cases with unexplained MSI. We then screened tumor specimens from a cohort of 57 patients classified as "at risk" for MLH3 mutation using single-strand conformational variant (SSCV) analysis. Missense variants were then analyzed in silico to predict whether the observed amino acid changes were likely to have functional consequences. To our knowledge, this is the first report showing that mutations in MLH3 are likely to contribute to endometrial tumorigenesis.
 |
Materials and Methods
|
|---|
Inclusion/exclusion criteria for women with endometrial cancer. Institutional review board approval was obtained for the molecular analysis of all blood and tissue specimens. A cohort of 57 endometrial cancer patients treated in the Division of Gynecologic Oncology at Washington University School of Medicine was selected using the inclusion criteria shown in Table 1
. These patients are part of a consecutive series of 479 women whose tumors were evaluated for MSI. All tumors were evaluated for MSI using five microsatellite repeats (BAT25, BAT26, D2S123, D5S346, and D17S250) as previously described (9). Tumors were classified as MSI-high if aberrant PCR products were evident with two or more markers. Of the 479 cases evaluated, 134 (28%) were MSI-high. The MLH1 promoter methylation status was assessed by combined bisulfite restriction analysis (BstUI digestion for positions 250/252 relative to the ATG start site and Sau3AI digestion for position 262) as described previously (30). The selection criteria for this study were designed to enrich for patients with features consistent with inherited endometrial cancer susceptibility. Endometrial cancer patients with a synchronous or metachronous malignancy (endometrial cancer could be the second malignancy) were included with the exception of endometrial cancer occurring after known tamoxifen chemoprophylaxis for a prior breast cancer. Tamoxifen stimulates the endometrium and is associated with increased rates of endometrial cancer (31). All second primary malignancies were confirmed by review of pathology reports. Patients with endometrial cancer in a first-degree relative or pathologically confirmed endometrial cancer in a second-degree relative were also included. Environmental factors, such as age and body mass index (BMI), are significant risk factors for sporadic endometrial cancer. The mean age at diagnosis of endometrial cancer is 61 years, and obesity (BMI
30) is associated with increased plasma estrogen levels and early onset (age <50) endometrial cancer (32, 33). A combination BMI <27 and age <55 was, therefore, used to select for women who were less likely to have estrogen or age-related tumors and further enrich for genetic disease. Patients whose tumors had high-level MSI and did not have MLH1 promoter methylation (MSI-high unmethylated phenotype) were selected based on previous studies showing that the MSI-high unmethylated phenotype is associated with increased familial clustering of malignancies (30) and an increased risk of HNPCC-related synchronous and metachronous malignancies (34). One patient with an MSI-low (low-level MSI) tumor was also included. Patients with known mutations in MSH2 or MSH6 were excluded. Of the 57 patients in the cohort, 10 fulfilled more than one inclusion criteria.
Controls. DNA from a cancer-free control population of 91 Caucasians and 5 African Americans were available through the Siteman Cancer Center Hereditary Cancer and Tissue Procurement Cores. DNAs were used to estimate carrier frequency of MLH3 variants in a cancer-free population. Because of the limited number of African American DNAs available, a second population of 70 (not in our cohort) African American women with endometrial cancer was used to estimate the frequency of variants in African Americans.
Tissues and DNA preparation. Tumor tissues used to prepare DNA for molecular analysis were reviewed by a gynecologic pathologist (P.C.H.). Only tumors with >65% neoplastic cellularity were used. DNA preparation from tumor tissue and matched normal bloods was done as previously described (35).
SSCV analysis of tumor specimens. The entire coding region and flanking intronic sequences of MLH3 (Ensembl #ENSG00000119684) were analyzed. MLH3 consists of 13 exons, the first of which is untranslated. The second exon comprises the majority of the transcript (3,280 of 5,216 bp total) and was assessed using eight overlapping PCR amplicons. All eight amplicons were restriction endonuclease digested to generate fragment sizes that would optimize SSCV detection (see Table 2
for a complete list of primers used for SSCV). Exons 10 and 11, separated by a 102-bp intron, were analyzed in the same amplicon. Each PCR reaction contained 20 ng of template DNA, 0.4 unit of Taq polymerase (Perkin-Elmer, Branchburg, NJ), 0.16 µmol of each primer, 0.1 mmol each nucleotide triphosphate, 1.5 mmol MgCl2, and 0.1 µCi 32P-labeled dCTP (Amersham, Arlington Heights, IL) in a 10-µL final volume. All reactions had a 5-minute denaturation at 95C followed by 30 cycles of PCR. Each PCR cycle included a 1-minute denaturation at 95C, annealing for 1 minute (see Table 2 for optimized Tm), and elongation at 72C for 1 minute. PCR products were denatured at 95C for 2 minutes, cooled on ice, and then applied to mutation detection enhancement gels (Cambrex, Rockland, ME) with and without 5% glycerol. Gels were run at 4 W for 16 to 20 hours. PCR product was detected by autoradiography, and any variants observed were directly sequenced.
Distinguishing germ line variants and somatic mutations. SSCV variants identified in the tumor specimens were defined as germ line variants or somatic mutations based on comparison with corresponding DNA extracted from blood (normal DNA). For each missense variant, the normal DNA was assessed for mutation by direct sequencing or by restriction digestion if the sequence involved a restriction site. The carrier frequencies for previously undescribed missense variants or those predicted to affect protein function were estimated in our cohort and/or in a control population (described above) by restriction digestion or SSCV. If SSCV was used to screen a control group, variants identified were sequenced to confirm the presence of the mutation and rule out a false-positive SSCV.
Sequencing. The same primers used for SSCV analysis (Table 2) were used for sequencing. An additional nested forward sequencing primer was required (5'-TCCCTGAATTAAACCCACCTC-3') for exon 5 because an insertion/deletion variant in the 3' intronic repeated sequences complicated sequence interpretation in heterozygotes. Amplification products were purified using the QIAquick PCR purification kit (Qiagen, Valencia, CA) and sequenced using the ABI Prism BigDye Terminator chemistry versions 1.1 and/or 3.1 (Applied Biosystems, Foster City, CA).
Assessing the potential functional significance of MLH3 sequence alterations. All missense variants were analyzed in silico for putative functional effects using the sorting intolerant from tolerant (SIFT) algorithm. SIFT is web-based algorithm5 that predicts how amino acid substitutions will affect protein function (36). Calculations are based on amino acid homology. In silico analysis using the SIFT algorithm was done on the entire MLH3 protein sequence (including variants) and on the MLH3 protein sequence without the MutL domains (amino acids 439-1188). Amino acid substitutions are reported as "tolerated" or as "affect function."
MLH3 promoter methylation analysis. A putative CpG island was identified upstream of the first translated exon (660 bp, 1,972 bp upstream of the initiation codon). Eleven CpG sites within a 243-bp amplicon (1,890 to 1,647 bp, ENSG 00000119684) were surveyed in 27 tumors for methylation using combined bisulfite conversion and restriction analysis (COBRA), essentially as previously described (9, 30). Briefly, 1 µg of tumor DNA was bisulfite converted using the CpGenome DNA Modification kit (Chemicon International, Temecula, CA). One microliter of converted DNA was then used as a template for a nested PCR reaction (total of 64 cycles). The first PCR reaction (Tm = 54°C for 32 cycles) used the following primers (shown 5' to 3') to generate a 373-bp amplicon containing the CpG-rich region: GTTTATTGAATTTTGGGATG (forward) and AACCCCTCCCTAACCAAC (reverse). The second-round (nested) PCR reaction was done at a Tm of 55°C also for 32 cycles. A 243-bp product was generated using the primers (shown 5' to 3'): ATTTTTGGTTGGAATAATTGG (forward) and CAACCATCATCAAAACCCTT (reverse). The 243-bp product was digested with BstUI (CGCG) and TaqI (TCGA; New England Biolabs, Beverly, MA) to test for methylated cytosines. PCR products were size separated on 10% polyacrylamide gels, stained with ethidium bromide, and visualized with UV fluorescence.
Immunohistochemistry. Immunohistochemistry was used to assess DNA mismatch repair protein expression in selected tumors. In brief, formalin-fixed paraffin sections were stained with antibody to MLH1, MSH2, MSH6, and PMS2 as previously described (37).
 |
Results
|
|---|
Characteristics of the cohort. The distribution of histologic subtypes of endometrial cancers in our cohort of 57 patients approximates that of the general population. The majority (82.5%) of women had endometrioid endometrial adenocarcinoma; 8.8% had mixed cell types present; and 5.3% had clear cell histology. The racial makeup of the study population was also similar to that of general endometrial cancer populations (38) with Caucasians representing 84.2% and African Americans representing 14% of the cohort. The MSI status of the patients' tumors was also comparable with sporadic endometrial cancer cohorts (9). Eighteen of the 57 patients (31.6%) had MSI-positive cancers (17 MSI-high and 1 MSI-low). The remainder (68.4%) were microsatellite stable (MSS).
MLH3 variants. A total of 22 variants were identified. Twelve of the 22 sequence alterations were missense changes. There were four silent and six intronic variants. No frameshift or nonsense mutations were identified. Five of the six intronic variants are single nucleotide polymorphisms (SNP), and one is an insertion/deletion polymorphism in a TA repeat (Table 3
). Of the 12 missense variants, three were somatic mutations (Table 4
). One tumor specimen had both a germ line missense variant (T942I) and loss of heterozygosity (LOH). Figure 1
illustrates the distribution and type of the variants in relation to the conserved structural domains. The majority of the missense changes occurred in a region of MLH3 that has no homology with other known proteins (Table 4). Four variants are predicted to affect protein function by in silico analysis using the SIFT algorithm (36). These are:
- R647C. The R647C change was identified in a poorly differentiated endometrioid adenocarcinoma tumor specimen from a 54-year-old Caucasian patient. This patient met two of the criteria for inclusion in our study: (a) MSI-high, MLH1-unmethylated tumor phenotype and (b) BMI
27 and age
55. She did not have a family history suggestive of inherited cancer susceptibility. The R647C variant was identified at low frequency (carrier frequency 1.8%) in our study population. The R647C has been previously described in a study of colorectal cancer patients with genetic cancer susceptibility, and in that study, the missense change was not identified in a population-matched control group (14). We analyzed DNA from 91 race-matched (Caucasian) cancer-free controls from our institution. None of these carried the R647C variant.
- P844L. P844L is a common germ line missense variant that has been investigated previously in a large colorectal cancer case-control study (39). Thirty-three of 54 (61%) patients in our cohort were heterozygous. This common polymorphism is predicted to affect protein function (Table 4).
- E828D. The E828D somatic mutation (Fig. 2A
) is predicted to affect protein function based on SIFT analysis (36). The E828D mutation was identified in a MSS tumor from a 46-year-old Caucasian patient with an early-stage endometrioid adenocarcinoma. The patient was included in our study because she had a second primary malignancy (multiple myeloma). She also gives an extensive family history of unconfirmed HNPCC-related malignancies (confirmation pending). It is noteworthy that this patient also carried the germ line P844L variant in cis with the somatic E828D mutation (data not shown).
- T942I in a tumor with LOH. The T942I germ line variant (predicted to affect protein function) was seen in a tumor that exhibited LOH at the MLH3 locus (Fig. 2B). The patient was a 64-year-old African American who presented with an early-stage endometrioid adenocarcinoma. She had a second primary malignancy (nonsmall cell lung cancer). The patient expired, and it has not been possible to further assess her family history for cancers. Interestingly, the T942I variant is reported in the National Center for Biotechnology Information SNP database (rs#17102999). The minor allele, however, has only been identified among Chinese Americans. Although no family history is available for this patient, the fact that the variant was not identified in 64 additional African Americans indicates that the minor allele is rare in this population. Immunohistochemistry for the endometrial cancer revealed normal expression for MLH1, MSH2, MSH6, and PMS2 (data not shown).

View larger version (25K):
[in this window]
[in a new window]
|
Figure 2. Representative examples of MLH3 variants. N, normal: DNA extracted from blood; T, tumor: DNA extracted from the endometrial tumor. A, somatic mutation (heterozygosity in the tumor specimen), leading to the amino acid change from glutamate to aspartate. B, germ line heterozygosity in the normal specimen and LOH in the tumor.
|
|
Other somatic mutations and inherited variants. In addition to the LOH and the E828D mutation described above, two additional somatic mutations not predicted to affect protein function were discovered (Table 4). The Y720C somatic mutation was identified in an MSS tumor specimen from a 71-year-old African American patient included in the study because she had a second primary malignancy, gastric cancer (an HNPCC-type cancer). The H823Y mutation was identified in a 49-year-old Caucasian patient with an MSI-high, MLH1-unmethylated endometrioid adenocarcinoma. She was included in the study because of the molecular phenotype (MSI-high and MLH1 unmethylated) of her tumor. Her sister had colon cancer at age 45 and endometrial cancer at age 53. Detailed four-generation pedigree analysis was otherwise unremarkable for cancers. Immunohistochemistry for the proband's endometrial cancer and her sister's colon cancer revealed normal expression of MSH2, MLH1, and MSH6. PMS2 expression, however, was absent for both endometrial and colon cancer (data not shown).
A novel germ line variant (P551S) was identified in a 57-year-old Caucasian patient with an MSI-high, MLH1-unmethylated endometrioid adenocarcinoma. Although P551S was not predicted to alter protein function (SIFT analysis), the variant was not seen in 91 race-matched controls. Interestingly, this patient has a significant family history with a confirmed esophageal malignancy in a first-degree relative and a confirmed uterine cancer in a second-degree relative.
Methylation analysis. None of the 27 tumors analyzed for promoter methylation using COBRA were methylated.
 |
Discussion
|
|---|
It has been well established that defective DMMR is an important feature of endometrial tumorigenesis. MSH2 and MSH6 defects play a significant role in the development of hereditary and sporadic endometrial cancers (9, 27, 28, 40). Approximately 30% of MSI-positive endometrial cancers have a DMMR defect of unknown origin (9) in that they have neither MSH2 or MSH6 mutations (germ line or somatic) nor epigenetic inactivation of MLH1. Although this represents a small fraction (
4%) of all endometrial cancers, identification of causal germ line variants in this group could lead to significant clinical benefit for these women and their families through intensified cancer surveillance.
MLH3, a relatively new member of the MMR gene family, was proposed to participate in DNA error correction (based on in vitro studies) with some functional redundancy with PMS2 (1821). Recent studies suggested functional interaction with MLH1 in vitro and limited participation in DMMR function (22). Additional evidence has implicated MLH3 as a putative tumor suppressor, as Mlh3 null mice have increased cancer susceptibility and significantly shorter life spans than wild-type mice (26). In primary MSI-positive tumors, MLH3 mutations are infrequent (16), perhaps because MLH3 and PMS2 have some functional redundancy (20), or possibly MLH3 plays a role in tumorigenesis distinct from DMMR. In fact, Mlh3 null mouse embryonic fibroblasts display decreased apoptosis when exposed to an alkylating agent (26).
In human cancer, an inherited frameshift mutation in MLH3 was identified in a single representative of a cohort of colorectal cancer patients with suspected HNPCC (14). A study of 70 probands with apparent genetic predisposition to colorectal cancer revealed a relatively high frequency of germ line MLH3 mutations (23%), although the mutations identified were believed to be of low penetrance (15). Although MLH3's role in colorectal cancer remains controversial (17), we sought to assess whether MLH3 mutation contributes to the development of endometrial cancer. The frequency and spectrum of other DMMR gene defects differ in endometrial and colorectal cancers, and we hypothesized that MLH3 might account for cancer susceptibility in a subset of endometrial cancer patients with molecular and clinical features suggestive of inherited endometrial cancer.
Our analysis of a cohort of 57 endometrial cancer patients enriched for genetic susceptibility (see Table 1 for a complete list of the inclusion criteria) revealed both germ line and somatic MLH3 mutations. The mutations identified suggest a role for MLH3 in the initiation and/or progression of endometrial cancers. Although the cohort investigated was selected to enrich for genetic disease, tumor histology, rate of MSI positivity, and patient race were not different from our larger endometrial cancer patient population (9).
Of the 16 coding sequence variants identified, the majority (12 or 75%), were missense changes. Three were somatic changes: two occurring in MSS tumors and one in an MSI-high tumor. SIFT analysis suggested that three germ line variants (R647C, P844L, and T942I) and one somatic mutation (E828D) would affect protein function (see Table 4). The prediction accuracy of the SIFT analysis has been determined experimentally as ranging from 63% to 68%.5 Because MLH3 is not well conserved, and because SIFT predictions were based on closely related sequences, it is not possible to know how reliable SIFT predictions are and how the sensitivity and specificity of this method are uncertain. Of the variants predicted to affect function, only one, the germ line T942I alteration was seen along with a second mutation, LOH. The two somatic mutations (Y720C and H823Y) as well as one germ line variant (P551S), both not predicted to alter function, were not seen in a race-matched control population. A common polymorphism in our endometrial cancer population (P844L) was predicted to be functionally significant (Table 4). The SIFT algorithm makes predictions, in part, based on homology with known proteins. As shown in Fig. 1, all the sequence changes predicted to alter function fall outside of conserved domains, and as such, SIFT algorithm may be giving both false-positive and false-negative results. It is noteworthy that three of the four silent changes were in the MutL-conserved NH2 terminus of the protein (Fig. 1).
Only one tumor specimen in our series had sequence alterations involving both alleles ("double hit" T942I + LOH). If MLH3's role in endometrial tumorigenesis is similar to that of other DMMR family members (e.g., MSH2, MSH6, or MLH1), then loss of function mutations would be expected. The fact that we saw a single example of LOH plus an inherited missense mutation in our patient population does not exclude a cellular recessive mode of action for MLH3 in endometrial carcinoma. We identified several variants predicted to alter function, but in all cases other than the case carrying the T942I variant, the second allele seemed to be wild type. The missense changes we observed (both germ line and somatic) could act as dominant negatives. Alternatively, in those cases, there may have been other "second" mutations in MLH3 that we failed to detect. The SSCV method that was used to screen for mutations may have failed to reveal some sequence alterations. Mutations in regulatory sequences, deletions, or rearrangements cannot be excluded. Although Cannavo et al. (22) saw MLH3 promoter methylation in cancer cell lines, epigenetic silencing of this gene is unlikely based on COBRA of 27 cancers. Functional studies for the variants seen in our cancer population could help verify the in silico analysis, but it is unclear whether MLH3 plays a primary role in DNA error correction or in cellular apoptosis (18, 22, 26). The functional assessment of mismatch repair activity using reporter plasmids that is frequently applied in the analysis of MSH2, MSH6, MLH1, and PMS2 alterations would provide information only on mismatch repair function. Cavanno et al. (22) suggest that MLH3 is unlikely to play a role in mismatch repair in vivo, but other cancer-relevant functions are yet to be determined. Interestingly, the missense mutations predicted to affect protein function occurred within a domain that is not evolutionarily conserved. Of the three somatic mutations (E828D, Y720C, and H823Y), two were identified in microsatellite stable tumors (MSS), and as such, it is unlikely the somatic mutations are secondary to existing DMMR defects. The H823Y somatic defect was identified in an MSI-positive tumor that expressed MLH1, MSH2, and MSH6 but had no immunodetectable PMS2. PMS2 mutation analysis has not been undertaken but seems likely given the specific defect seen in both the proband's endometrial cancer and her sister's colon cancer. A germ line PMS2 mutation and loss of mismatch repair in the tumor could have led to a secondary mutation in MLH3. The partial redundancy MLH3 has with PMS2 (19, 22) could lead to selection for mutation/inactivation of both MLH3 and PMS2 in tumors. Of the two germ line variants predicted to affect protein function, one (T942I + LOH) was identified in an MSS tumor that had normal expression of the MLH1, PMS2, MSH6, and MSH2 mismatch repair proteins. If the missense mutation coupled with deletion of the wild-type allele contributes to the tumor phenotype, it seems likely selection is for loss of a function distinct from mismatch repair.
The location of the missense variants identified in endometrial cancers, as well as the fact that a significant number of variants were identified in MSS tumors, supports the knockout mouse and primary tumor data that suggest MLH3 may contribute to tumorigenesis through a mechanism other than DNA error correction. As MMR proteins have been shown to induce apoptosis in response to DNA damage (12), it is possible that MLH3 also acts to promote endometrial cancer tumorigenesis through disruption of apoptotic pathways.
Our analysis provides evidence that MLH3 mutation plays a role in endometrial cancers. In this selected cohort of 57 endometrial cancers, six putative mutations were identified (10.5%). Three lines of evidence suggest these variants are likely to be mutations. First, the germ line variants R647C, T942I, and P551S were not observed in race-matched controls. However, the number of controls evaluated was modest and, as such, does not rule out the possibility that these are rare polymorphisms. Second, in one case (the patient with the T942I substitution), the tumor also had LOH at the MLH3 locus. Finally, somatic MLH3 mutations were observed in 3 of 57 tumors. Based on these observations, we conclude that MLH3 mutations are likely to play a role in a subset of endometrial cancers. Further studies are needed to better understand what role inherited MLH3 variants play in cancer susceptibility.
 |
Acknowledgments
|
|---|
Grant support: NIH grant R01 CA071754, Barnes-Jewish Hospital Foundation grant 00161-0205, and National Cancer Institute Cancer Center Support grant P30 CA91842 (Siteman Cancer Center).
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Ken Walls, Mary Ann Mallon, and Amy Schmidt for providing excellent technical support and the Alvin J. Siteman Cancer Center at Washington University School of Medicine and Barnes-Jewish Hospital Hereditary Cancer and Tissue Procurement Cores for providing cancer-free control DNAs.
 |
Footnotes
|
|---|
Note: None of the authors listed above have any conflict of interest to report.
5 http://blocks.fhcrc.org/sift/SIFT.html 
Received 1/23/06.
Revised 5/ 4/06.
Accepted 5/31/06.
 |
References
|
|---|
- Loeb LA. Mutator phenotype may be required for multistage carcinogenesis. Cancer Res 1991;51:30759.[Free Full Text]
- Lengauer C, Kinzler KW, Vogelstein B. Genetic instabilities in human cancers. Nature 1998;396:6439.[CrossRef][Medline]
- Charames GS, Bapat B. Genomic instability and cancer. Curr Mol Med 2003;3:58996.[CrossRef][Medline]
- Draviam VM, Xie S, Sorger PK. Chromosome segregation and genomic stability. Curr Opin Genet Dev 2004;14:1205.[CrossRef][Medline]
- Risinger JI, Berchuck A, Kohler MF, et al. Genetic instability of microsatellites in endometrial carcinoma. Cancer Res 1993;53:51003.[Abstract/Free Full Text]
- Burks RT, Kessis TD, Cho KR, Hedrick L. Microsatellite instability in endometrial carcinoma. Oncogene 1994;9:11636.[Medline]
- Kobayashi K, Sagae S, Kudo R, et al. Microsatellite instability in endometrial carcinomas: frequent replication errors in tumors of early onset and/or of poorly differentiated type. Genes Chromosomes Cancer 1995;14:12832.[Medline]
- Gurin CC, Federici MG, Kang L, Boyd J. Causes and consequences of microsatellite instability in endometrial carcinoma. Cancer Res 1999;59:4626.[Abstract/Free Full Text]
- Goodfellow PJ, Buttin BM, Herzog TJ, et al. Prevalence of defective DNA mismatch repair and MSH6 mutation in an unselected series of endometrial cancers. Proc Natl Acad Sci U S A 2003;100:590813.[Abstract/Free Full Text]
- Vassileva V, Millar A, Briollais L, Chapman W, Bapat B. Genes involved in DNA repair are mutational targets in endometrial cancers with microsatellite instability. Cancer Res 2002;62:40959.[Abstract/Free Full Text]
- Vassileva V, Millar A, Briollais L, Chapman W, Bapat B. Apoptotic and growth regulatory genes as mutational targets in mismatch repair deficient endometrioid adenocarcinomas of young patients. Oncol Rep 2004;11:9317.[Medline]
- Fishel R. The selection for mismatch repair defects in hereditary nonpolyposis colorectal cancer: revising the mutator hypothesis. Cancer Res 2001;61:736974.[Free Full Text]
- Lipkin SM, Wang V, Stoler DL, et al. Germline and somatic mutation analyses in the DNA mismatch repair gene MLH3: evidence for somatic mutation in colorectal cancers. Hum Mutat 2001;17:38996.[CrossRef][Medline]
- Wu Y, Berends MJ, Sijmons RH, et al. A role for MLH3 in hereditary nonpolyposis colorectal cancer. Nat Genet 2001;29:1378.[CrossRef][Medline]
- Liu HX, Zhou XL, Liu T, et al. The role of hMLH3 in familial colorectal cancer. Cancer Res 2003;63:18949.[Abstract/Free Full Text]
- Loukola A, Vilkki S, Singh J, Launonen V, Aaltonen LA. Germline and somatic mutation analysis of MLH3 in MSI-positive colorectal cancer. Am J Pathol 2000;157:34752.[Abstract/Free Full Text]
- Hienonen T, Laiho P, Salovaara R, et al. Little evidence for involvement of MLH3 in colorectal cancer predisposition. Int J Cancer 2003;106:2926.[CrossRef][Medline]
- Lipkin SM, Wang V, Jacoby R, et al. MLH3: a DNA mismatch repair gene associated with mammalian microsatellite instability. Nat Genet 2000;24:2735.[CrossRef][Medline]
- Flores-Rozas H, Kolodner RD. The Saccharomyces cerevisiae MLH3 gene functions in MSH3-dependent suppression of frameshift mutations. Proc Natl Acad Sci U S A 1998;95:124049.[Abstract/Free Full Text]
- Yao X, Buermeyer AB, Narayanan L, et al. Different mutator phenotypes in Mlh1- versus Pms2-deficient mice. Proc Natl Acad Sci U S A 1999;96:68505.[Abstract/Free Full Text]
- Jiricny J. Mediating mismatch repair. Nat Genet 2000;24:68.[CrossRef][Medline]
- Cannavo E, Marra G, Sabates-Bellver J, et al. Expression of the MutL homologue hMLH3 in human cells and its role in DNA mismatch repair. Cancer Res 2005;65:1075966.[Abstract/Free Full Text]
- Wang TF, Kleckner N, Hunter N. Functional specificity of MutL homologs in yeast: evidence for three Mlh1-based heterocomplexes with distinct roles during meiosis in recombination and mismatch correction. Proc Natl Acad Sci U S A 1999;96:139149.[Abstract/Free Full Text]
- Santucci-Darmanin S, Neyton S, Lespinasse F, et al. The DNA mismatch-repair MLH3 protein interacts with MSH4 in meiotic cells, supporting a role for this MutL homolog in mammalian meiotic recombination. Hum Mol Genet 2002;11:1697706.[Abstract/Free Full Text]
- Lipkin SM, Moens PB, Wang V, et al. Meiotic arrest and aneuploidy in MLH3-deficient mice. Nat Genet 2002;31:38590.[CrossRef][Medline]
- Chen PC, Dudley S, Hagen W, et al. Contributions by MutL homologues Mlh3 and Pms2 to DNA mismatch repair and tumor suppression in the mouse. Cancer Res 2005;65:866270.[Abstract/Free Full Text]
- Schweizer P, Moisio AL, Kuismanen SA, et al. Lack of MSH2 and MSH6 characterizes endometrial but not colon carcinomas in hereditary nonpolyposis colorectal cancer. Cancer Res 2001;61:28135.[Abstract/Free Full Text]
- Wijnen J, De Leeuw W, Vasen H, et al. Familial endometrial cancer in female carriers of MSH6 germline mutations. Nat Genet 1999;23:1424.[CrossRef][Medline]
- Buttin BM, Powell MA, Mutch DG, et al. Penetrance and expressivity of MSH6 germline mutations in seven kindreds not ascertained by family history. Am J Hum Genet 2004;74:12629.[CrossRef][Medline]
- Whelan A, Babb S, Mutch D, et al. MSI in endometrial carcinoma: absence of MLH1 promoter methylation is associated with increased familial risk for cancers. Int J Cancer 2002;99:697704.[CrossRef][Medline]
- Fisher B, Costantino JP, Wickerham DL, et al. Tamoxifen for prevention of breast cancer: report of the National Surgical Adjuvant Breast and Bowel Project P-1 Study. J Natl Cancer Inst 1998;90:137188.[Abstract/Free Full Text]
- Kaaks R, Lukanova A, Kurzer MS. Obesity, endogenous hormones, and endometrial cancer risk: a synthetic review. Cancer Epidemiol Biomarkers Prev 2002;11:153143.[Abstract/Free Full Text]
- Soliman PT, Oh JC, Schmeler KM, et al. Risk factors for young premenopausal women with endometrial cancer. Obstet Gynecol 2005;105:57580.[Abstract/Free Full Text]
- Buttin BM, Powell MA, Mutch DG, et al. Increased risk for HNPCC-associated synchronous and metachronous malignancies in patients with MSI-positive endometrial carcinoma lacking MLH1 promoter methylation. Clin Cancer Res 2004;10:48190.[Abstract/Free Full Text]
- Simpkins SB, Bocker T, Swisher EM, et al. MLH1 promoter methylation and gene silencing is the primary cause of microsatellite instability in sporadic endometrial cancers. Hum Mol Genet 1999;8:6616.[Abstract/Free Full Text]
- Ng PC, Henikoff S. Predicting deleterious amino acid substitutions. Genome Res 2001;11:86374.[Abstract/Free Full Text]
- Gill S, Lindor NM, Burgart LJ, et al. Isolated loss of PMS2 expression in colorectal cancers: frequency, patient age, and familial aggregation. Clin Cancer Res 2005;11:646671.[Abstract/Free Full Text]
- Madison T, Schottenfeld D, James SA, Schwartz AG, Gruber SB. Endometrial cancer: socioeconomic status and racial/ethnic differences in stage at diagnosis, treatment, and survival. Am J Public Health 2004;94:210411.[Abstract/Free Full Text]
- de Jong MM, Hofstra RM, Kooi KA, et al. No association between two MLH3 variants (S845G and P844L) and colorectal cancer risk. Cancer Genet Cytogenet 2004;152:701.[CrossRef][Medline]
- Stefansson I, Akslen LA, MacDonald N, et al. Loss of hMSH2 and hMSH6 expression is frequent in sporadic endometrial carcinomas with microsatellite instability: a population-based study. Clin Cancer Res 2002;8:13843.[Abstract/Free Full Text]