| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Cell, Tumor, and Stem Cell Biology |
Department of Cellular and Structural Biology, The University of Texas Health Science Center at San Antonio, San Antonio, Texas
Requests for reprints: Gregory R. Mundy, Department of Medicine, Division of Clinical Pharmacology, Vanderbilt University Medical Center, 532 RRB, 23rd and Pierce Avenues, Nashville, TN 37232-6602. Phone: 615-322-3304; Fax: 615-322-4707; E-mail: mundy{at}vanderbilt.edu.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
In the developing growth plate, Indian Hedgehog (Ihh) has been shown to regulate PTHrP (5). This has been shown in part by studies involving in vitro assays as well as transgenic and knockout animals (57). For example, Ihh-deficient mice do not express PTHrP, signifying a link between these two important molecules (6). Furthermore, Ihh- and PTHrP-deficient mice have similar and overlapping phenotypes. Both knockout mouse lines are smaller in size and exhibit abnormalities in chondrocyte differentiation compared with wild-type littermates (5, 7). The overlap in phenotypes is consistent with regulation of PTHrP by Ihh. Accordingly, we reasoned that the Hedgehog (Hh) signaling pathway may also play an important role in the regulation of PTHrP expression by tumor cells that have metastasized to bone.
The Hh family of proteins signals through the membrane receptor Smoothened (Smo) by binding to the membrane receptor Patched, which releases Smo from a repressed state and allows it to signal (8). Hh signaling in mammalian cells is mediated by the Gli family of zinc finger transcription factors composed of Gli1, Gli2, and Gli3 (8). These factors have separate and discrete functions in mammalian cells (8, 9). In addition, Gli2-deficient mice display a decrease in PTHrP expression in the growth plate (10). Because Gli2 seems to be an important factor for expression of PTHrP in the developing growth plate, we hypothesized that this pathway is responsible for regulating PTHrP transcription in breast cancer cells and that overexpression of Gli2 in breast cancer cell lines will lead to an increase in their osteolytic potential by this mechanisms. Here, we present data indicating that Gli2 overexpression in tumor cell lines occurs in those lines that also secrete high levels of PTHrP and induce osteolysis in vivo and that overexpressing Gli2 in MDA-MB-231 cells leads to increased PTHrP production and increased tumor-induced osteolysis in a well-established murine model of human breast cancer metastasis to bone.
| Materials and Methods |
|---|
|
|
|---|
DNA constructs. Gli1 and Gli2 constructs were kindly provided by Dr. Sasaki (Institute for Molecular and Cellular Biology, Osaka, Japan; ref. 9). Gli3 constructs were used as described previously (12). Gli2-EnR construct was kindly provided by Ilona Skerjanc (University of Western Ontario, London, Ontario, Canada) as described previously (13).
Transfections. Cells were plated at a density of 0.8 x 105 per well in a 24-well plate on the day before transfection. Cells were transiently transfected with 0.25 µg of the luciferase construct, 0.2 µg ß-galactosidase (ß-gal) as a transfection efficiency control, and the indicated amounts of expression constructs. All transfections were done using LipofectAMINE Plus (Invitrogen) reagent per manufacturer's instructions.
Luciferase assay. Forty-eight hours after transfection, cells were harvested using 200 µL of 1x Glo lysis buffer (Promega, Madison, WI). After lysis was complete, 50 µL cell lysate was used for luciferase assay using 50 µL Bright-Glo reagent (Promega). In addition, to account for transfection efficiency, a 50-µL lysate was used to measure ß-gal activity using the Beta-Glo assay (Promega) per manufacturer's directions.
Stable cell lines. For stable transfection assays, cells were plated at 5 x 105 per 60-mm tissue culture dish 18 to 24 hours before transfection. Transfections were done as above using Gli2-pcDNA vector or pcDNA alone, both of which contain the neomycin resistance gene. After 48 hours, cells were plated at low density in medium containing 800 µg/mL geneticin (G418). Once colonies were formed, individual colonies were isolated and expanded. Cells were continuously maintained in medium containing 800 µg/mL G418.
Western blotting. Stable cell lines were harvested into a radioimmunoprecipitation assay lysis buffer containing a cocktail of protease inhibitors (Roche, Basel, Switzerland). Equal protein concentrations were prepared for loading with laemmli sample buffer and run on SDS-PAGE Mini-Protein II ready gels (Bio-Rad, Hercules, CA). Separated proteins were then transferred to nitrocellulose membrane in transfer buffer [25 mmol/L Tris, 192 mmol/L glycine, 20% (v/v) methanol (pH 8.3)] at 100 V at 4°C for 1 hour. Membranes were blocked with 5% milk in TBS containing 1% Tween 20 (TBS-T) for 1 hour at room temperature and incubated with a 1:100 dilution of the omni-His antibody (Santa Cruz Biotechnology, Santa Cruz, CA) in 5% milk in TBS-T at 4°C overnight. The membrane was then washed several times with TBS-T and then incubated with a horseradish peroxidaseconjugated anti-mouse antibody (Amersham, Buckinghamshire, United Kingdom) at room temperature for 1 hour. Finally, the membranes were washed multiple times with TBS-T buffer, and signals were detected using an enhanced chemiluminescence system (Amersham). Membrane was stripped and reprobed using an antibody for HSC-70 (Santa Cruz Biotechnology) as a loading control.
Semiquantitative reverse transcription-PCR. Total RNA was extracted using TriReagent (Sigma, St. Louis, MO) according to the manufacturer's instructions. cDNA was synthesized using SuperScript II reverse transcriptase (Promega) and oligo(dT) from 2 µg of total RNA at 42°C for 50 minutes and 70°C for 15 minutes. cDNA (2 µL) was used for PCR amplification using 100 µmol/L deoxynucleotide triphosphate, 1.5 mmol/L MgCl2, 1 unit Taq polymerase, and 10 µmol/L of Gli2 forward and reverse primers using conditions as described previously (14). ß-Actin-specific primers were used as internal controls (15). PCR products were separated by electrophoresis on a 1% (w/v) agarose gel containing 0.5 µg/mL ethidium bromide.
Quantitative real-time PCR. Specific clones were selected by their expression of the pcDNA vector as determined by standard PCR. Quantitative real-time PCR was done using cDNA prepared as described above. PCR amplification was done using the RealMasterMix (Eppendorf, Hamburg, Germany) and 0.5 µL of prepared cDNA per manufacturer's instructions. Real-time PCR was done in triplicate using the RealPlex Machine (Eppendorf) with the following cycling conditions: 95°C for 15 seconds, 58°C for 30 seconds, and 68°C for 30 seconds. Quantification was done using the 
Ct relative quantification method using cyclophilin A as an internal control and comparing all values to the empty vector containing cells. Primer sequences are as follows: PTHrP, TTAAAGCAGTACCCCCCTACCA (sense) and ATGGGCTCTAGCGCCTCTCT3 (antisense) and cyclophilin A, GAGCTCTGAGCACTGGAGAGA (sense) and GATGCCAGGACCTGTATGCT (antisense).
Tumor cell inoculation into the left cardiac ventricle. Tumor cells were trypsinized, washed, and resuspended in PBS at a final concentration of 105/100 µL immediately before inoculation. Animals were anesthetized with ketamine/xylazine mixture and positioned ventral side up. The left cardiac ventricle was punctured through a percutaneous approach using a 27-gauge needle as described (3, 4).
Radiographs of mice. Animals were anesthetized deeply, laid down in a prone position against the film, and exposed to an X-ray at 35 kVp for 20 seconds using a Faxitron radiographic inspection unit (Kodak, Rochester, NY). Films were developed using an RPX-OMAT processor.
PTHrP immunoradiometric assay. PTHrP protein was measured in conditioned medium and plasma using a two-site immunoradiometric assay (IRMA) kit available from Nichols Institutes (San Clemente, CA). All samples, conditioned medium, and plasma were collected in protease inhibitors and placed immediately on ice and stored at 70° until assay. Assays were done per manufacturer's instructions.
Cell proliferation assay. To measure in vitro cell proliferation by 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) assay, cells were plated in 96-well plates and growth was measured at days indicated using the CellTiter 96 AQueous Non-Radioactive Cell Proliferation Assay (Promega) per manufacturer's instructions.
In vivo tumor growth assay. Cells (1 x 106) were injected s.c. into athymic nude mice. Tumor growth was measured approximately every 5 days by caliper measurement.
Bone histomorphometry. Forelimb and hindlimb long bones and spines were collected from each mouse at sacrifice. Bones were fixed in 10% buffered formalin, decalcified in 10% EDTA, and paraffin embedded. Sections for histomorphometric analysis were stained with H&E, orange G, and phloxine. Histomorphometric analyses for tumor burden and trabecular bone volume were done using the MetaVue program (Universal Image Corp., Downingtown, PA) as described previously (16).
| Results |
|---|
|
|
|---|
|
18-fold increase in activity at maximum concentrations of transfected Gli2 (Fig. 1C). Gli2 expression correlates with PTHrP secretion and osteolysis. Because Gli2 specifically regulated PTHrP promoter activity, we examined several cancer cell lines, including the squamous cell carcinoma RWGT2, prostate cancer cell line PC-3, and the breast cancer cell lines MDA-MB-231, MCF-7, ZR-75, and T47D, for expression of Gli2 mRNA and PTHrP protein production. Expression of Gli2 was examined by reverse transcription-PCR (RT-PCR) in several different tumor cell lines (Fig. 2, inset ). In addition, secreted PTHrP protein levels were measured in the medium of each of these cell lines. We found that Gli2 was highly expressed in cancer cell lines that had previously been shown to metastasize to bone in mouse models of bone metastases, cause osteolysis, and secrete high levels of PTHrP (Fig. 1). However, cell lines, such as T47D and MCF-7, which do not cause osteolytic bone metastases (16), do not express both detectable levels of secreted PTHrP and Gli2 mRNA. These data indicate that a positive correlation exists between Gli2 expression, PTHrP, and osteolysis and suggest that Gli2 may play a role in regulating PTHrP expression in breast cancer bone metastases.
|
C4), in which the activation domain has been deleted (9). This construct binds to Gli target genes but does not activate transcription. Using this construct in transient transfections of MDA-MB-231 and MCF-7 cells, we were able to block Gli2-induced PTHrP promoter activity (Fig. 3B
).
|
C4 construct, we used a Gli2 chimeric construct fused with the repressor domain of the engrailed protein (Gli2-EnR; ref. 13). This construct dramatically blocked Gli2 activation of PTHrP promoter activity to a level well below that of basal promoter activity (Fig. 3A). To confirm that Gli2-EnR blocked endogenous PTHrP expression, MDA-MB-231 cells were stably transfected with Gli2-EnR. We found that these MDA-Gli2-EnR cells exhibited a 72% to 93% decrease in PTHrP expression by quantitative real-time PCR when compared with MDA-MB-231 cells transfected with the empty vector (Fig. 3C). These data indicate that Gli2 is an important regulator of PTHrP expression. Gli2 overexpression increases PTHrP protein in conditioned medium. MDA-MB-231 cells were also stably transfected with the same Gli2 construct that was used in the transient transfections described above. We found that clones that expressed high levels of the Gli2 construct also expressed high levels of PTHrP protein by IRMA (Fig. 4A ). The stable clone that expressed the highest levels of Gli2 (MDA-Gli2) produced as much as 10-fold higher PTHrP protein than empty vector controls (MDA-EV). This result indicates that Gli2 can regulate PTHrP secretion levels as well as transcriptional regulation. Therefore, we rationalized that Gli2 overexpression would also increase the osteolytic bone destruction caused by MDA-MB-231 cells by increasing PTHrP secretion by the tumor cell line.
|
MDA-MB-231 cells overexpressing Gli2 cause increased osteolytic lesion number and area by radiography. To determine the role of Gli2 in breast cancermediated osteolysis, we evaluated MDA-Gli2 and MDA-EV cells in a mouse model of breast cancer metastasis to bone. Four-week-old female athymic nude mice were inoculated with MDA-Gli2 or MDA-EV cells via the left cardiac ventricle. Baseline radiographs, body weights, blood ionized calcium levels, and plasma PTHrP levels were obtained. Mice were monitored weekly by radiography. At day 21, whole blood for ionized calcium levels and plasma for PTHrP measurements were collected and mice were euthanized. At this time point, osteolytic bone metastases were detectable by radiography in the majority of the animals in both groups. As seen in the representative radiographs shown in Fig. 5A , osteolytic bone metastases in the MDA-Gli2 tumor-bearing mice are much more aggressive and more extensive than those in the MDA-EV tumor-bearing mice. Quantitative analysis of the radiographs measuring osteolytic lesion area and number confirmed this observation (Fig. 5B and C). MDA-Gli2 tumor-bearing mice had both significantly increased lesion area and lesion number compared with the MDA-EV tumor-bearing mice, indicating that overexpression of Gli2 results in more aggressive osteolytic breast tumors.
|
|
| Discussion |
|---|
|
|
|---|
Our results that Gli2 and PTHrP expression are positively correlated further support our hypothesis that Gli2 regulates PTHrP production in breast cancer cells. We chose to focus on Gli2 in these studies because our initial studies showed that the other Gli family members did not affect PTHrP promoter activity. In addition, others have shown that Gli2 is overexpressed in several tumor cell types, including medulloblastomas and basal cell carcinomas (14, 15, 18), and that it is required for normal mammary development (19). These findings suggest that the breast cancer cells metastatic to bone use a normal developmental process (i.e., the Hh signaling pathway), which in turn leads to increased PTHrP production and osteolysis. Furthermore, our data show that this relationship is not only exclusive to breast cancer cell lines but also apparent in other osteolytic cell lines, including the prostate cancer cell line PC-3 and the squamous cell carcinoma cell line RWGT2 (Fig. 2). Ideally, we would have correlated Gli2 protein levels with the PTHrP protein levels measured by IRMA in these studies. However, due to the lack of a suitable antibody to Gli2, we were unable to measure endogenous Gli2 protein in these cell lines. The complete lack of detectable Gli2 mRNA expression in the nonosteolytic tumor cell lines suggests that these lines also do not express Gli2 protein.
Our studies clearly show that Gli2 and not the other Gli family members stimulates PTHrP production. We were initially surprised that Gli1, which has been reported as a positive effector of Hh signaling, did not also regulate PTHrP promoter activity. However, recent evidence suggests that, in cancer cells, Gli2 is the major regulator of target gene expression (9, 10, 20). Furthermore, it has been shown that Gli1 is a downstream target of Gli2 (21) and that Gli2 is required for the Hh response, whereas Gli1 is dispensable in some cell types (20, 22). Taken together, these data strongly suggest that Gli2 is the major regulator of Hh signaling in metastatic breast cancer cells to bone.
Blocking the capacity of Gli2 to activate transcription by deleting the activating domain of Gli2 blocked PTHrP promoter activity. We found that, at high concentrations of the Gli2-EnR fusion construct or the Gli2-
C4 deletion construct, PTHrP promoter activity was blocked below basal levels. Furthermore, cells overexpressing the Gli2-EnR construct showed a dramatic decrease in PTHrP expression. These data suggest that PTHrP production in breast cancer cells is dependent on Gli2 and that blocking Gli2 effects on PTHrP expression in metastatic tumors could be a valuable therapeutic approach to inhibit osteolytic bone metastases.
Hh signaling is critical for tumor cell growth. When Hh signaling has been blocked using the Smo inhibitor cyclopamine, cell growth is decreased and apoptosis is induced. In vitro tumor cells, including the medulloblastoma cell line PZp53med (18), prostate cancer cell lines PC-3, Du145, and 22RV1 (17), and the colorectal tumor cell lines AA/C1, RG/C2, CaCO2, HT29, and SW48 (23), are growth inhibited by cyclopamine. To determine if Gli2 expression in MDA-MB-231 cells would affect cell growth, we monitored the cell growth of these tumor cells in vivo and in vitro. We found that there were no significant differences in cell growth between the MDA-Gli2 and the MDA-EV tumor cells. This result indicates that Gli2 may play a specific role in the vicious cycle between the tumor cells and host but not in tumor cell growth outside of the skeleton. In addition, this finding verifies that the effects seen in bone are not simply due to differences in tumor cell growth.
The fact that Gli2 can increase PTHrP expression and subsequent osteolysis by tumor cells that have metastasized to bone raises the question of what causes increased expression of Gli2. We are currently examining possible mechanisms to explain how Gli2 regulates PTHrP transcription and why Gli2 is overexpressed in the osteolytic cell lines. With respect to the latter, we expect that, in MDA-MB-231 and RWGT2 cells, there are likely mutations at some point in the Hh signaling pathway that cause Gli2 expression levels to remain high as described previously in PC-3 cells (16). Interestingly, we have found that Gli2 increases mRNA expression levels
20% by real-time PCR (data not shown) compared with a
10-fold increase in protein production. This suggests that Gli2 may regulate PTHrP expression at multiple levels. To address this, experiments are currently under way to investigate mRNA stability and protein regulation. Regardless of the exact mechanisms involved, Gli2 is clearly an important factor in the regulation of PTHrP in human breast cells.
In conclusion, these data indicate that Gli2 regulates both PTHrP promoter activity and production by breast tumor cells. In addition, overexpression of Gli2 increases osteolysis and tumor burden. Furthermore, blocking transcriptional activation by Gli2 decreases PTHrP promoter activity. These data clearly implicate Gli2 and its regulation as potential therapeutic targets for drug discovery with the goal of decreasing osteolytic destruction by breast tumor cells that have metastasized to bone.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Rosie Bernal for technical assistance, Dr. Cara Knight for assistance with quantitative real-time PCR, and Dr. Xiangli Yang for assistance with Western blots.
Received 2/ 6/06. Revised 5/ 7/06. Accepted 5/25/06.
| References |
|---|
|
|
|---|
enhance hypercalcemia in vivo and bone resorption in vitro. J Clin Endocrinol Metab 1993;77:405.[Abstract]This article has been cited by other articles:
![]() |
J. Pratap, J. J. Wixted, T. Gaur, S. K. Zaidi, J. Dobson, K. D. Gokul, S. Hussain, A. J. van Wijnen, J. L. Stein, G. S. Stein, et al. Runx2 Transcriptional Activation of Indian Hedgehog and a Downstream Bone Metastatic Pathway in Breast Cancer Cells Cancer Res., October 1, 2008; 68(19): 7795 - 7802. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Karpinski, D. Ramsey, Z. Grzebieniak, M. M. Sasiadek, and N. Blin The CpG Island Methylator Phenotype Correlates with Long-Range Epigenetic Silencing in Colorectal Cancer Mol. Cancer Res., April 1, 2008; 6(4): 585 - 591. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. R. Mundy and J. R. Edwards PTH-Related Peptide (PTHrP) in Hypercalcemia J. Am. Soc. Nephrol., April 1, 2008; 19(4): 672 - 675. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Aubin, R. Bouillon, T. A. Guise, and I. R. Reid Meeting Report from the 17th Scientific Meeting of the International Bone and Mineral Society: June 24-29, 2007 in Montreal, Quebec, Canada IBMS BoneKEy, November 1, 2007; 4(11): 299 - 313. [Full Text] [PDF] |
||||
![]() |
Y. Kim, J. W. Yoon, X. Xiao, N. M. Dean, B. P. Monia, and E. G. Marcusson Selective Down-Regulation of Glioma-Associated Oncogene 2 Inhibits the Proliferation of Hepatocellular Carcinoma Cells Cancer Res., April 15, 2007; 67(8): 3583 - 3593. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |