Cancer Research Targets  Advances in Breast Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gerdes, M. J.
Right arrow Articles by Vinson, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gerdes, M. J.
Right arrow Articles by Vinson, C.
[Cancer Research 66, 7578-7588, August 1, 2006]
© 2006 American Association for Cancer Research


Cell, Tumor, and Stem Cell Biology

Activator Protein-1 Activity Regulates Epithelial Tumor Cell Identity

Michael J. Gerdes1, Maxim Myakishev2, Nicholas A. Frost1, Vikas Rishi2, Jaideep Moitra2, Asha Acharya2, Michelle R. Levy1, Sang-won Park2, Adam Glick1, Stuart H. Yuspa1 and Charles Vinson2

1 Laboratory of Cellular Carcinogenesis and Tumor Promotion and 2 Laboratory of Metabolism, National Cancer Institute, Center for Cancer Research, Bethesda, Maryland

Requests for reprints: Stuart H. Yuspa, Laboratory of Cellular Carcinogenesis and Tumor Promotion, National Cancer Institute, Center for Cancer Research, Bldg. 37 Rm. 4068A, Bethesda, MD 20892. Phone: 301-496-2162; Fax: 301-496-8709; E-mail: yuspas{at}mail.nih.gov or Charles Vinson, Laboratory of Metabolism, National Cancer Institute, Center for Cancer Research, Bldg. 37, Rm 3128, Bethesda, MD 20892. Phone: 301-496-8753, Fax: 301-496-8419; E-mail: Vinsonc{at}mail.nih.gov.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
To examine the consequences of inhibiting activator protein-1 (AP-1) transcription factors in skin, transgenic mice were generated, which use the tetracycline system to conditionally express A-FOS, a dominant negative that inhibits AP-1 DNA binding. Older mice develop mild alopecia and hyperplasia of sebaceous glands, particularly around the eyes. When A-FOS was expressed during chemical-induced skin carcinogenesis, mice do not develop characteristic benign and malignant squamous lesions but instead develop benign sebaceous adenomas containing a signature mutation in the H-ras proto-oncogene. Inhibiting AP-1 activity after tumor formation caused squamous tumors to transdifferentiate into sebaceous tumors. Furthermore, reactivating AP-1 in sebaceous tumors results in a reciprocal transdifferentiation into squamous tumors. In both cases of transdifferentiation, individual cells express molecular markers for both cell types, indicating individual tumor cells have the capacity to express multiple lineages. Molecular characterization of cultured keratinocytes and tumor material indicates that AP-1 regulates the balance between the wnt/ß-catenin and hedgehog signaling pathways that determine squamous and sebaceous lineages, respectively. Chromatin immunoprecipitation analysis indicates that c-Jun binds several wnt promoters, which are misregulated by A-FOS expression, suggesting that members of the wnt pathway can be a primary targets of AP-1 transcriptional regulation. Thus, AP-1 activity regulates tumor cell lineage and is essential to maintain the squamous tumor cell identity. (Cancer Res 2006; 66(15): 7578-88)


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Activator protein-1 (AP-1) is a heterodimeric transcription factor complex composed of a Jun family member and a FOS family member that binds the TRE DNA sequence (5'-TGAGTCA-3') and is involved in a variety of cellular processes, including growth, apoptosis, and differentiation (1). The contribution of individual family members to mouse development has been examined for most genes using the "knockout" technology, with phenotypes varying from embryonic lethality for c-Jun, JunB, and Fra-1 to normal development and a nurturing defect for FosB (reviewed in ref. 2). Tissue-specific ablation in the skin of AP-1 family members with embryonic phenotypes indicates that c-Jun is needed for proper eyelid closure during development (3, 4). Transgenic expression of different AP-1 family members has identified adult phenotypes but not in the skin (2). Skin epidermis expression of an AP-1 dominant negative consisting of c-Jun without a transactivation domain did not produce a skin phenotype (5).

The mouse epidermal multistage carcinogenesis model provides a well-defined system for examining the evolution of squamous epithelial cells into benign squamous papillomas and their subsequent progression into squamous cell carcinomas (6). The majority of these tumors contain mutations in the H-ras oncogene. A function for AP-1 activity in skin tumorigenesis has been identified using knockout and transgenic mice that modulate AP-1 components. For example, papillomas in c-Fos knockout mice did not convert into malignant carcinomas (7). Deletion of c-Jun in skin produces mice that develop smaller papillomas (3). Expression of a c-Jun dominant negative in skin dramatically reduced papilloma formation in several protocols of cutaneous chemical carcinogenesis (5, 8) and reduced squamous cell cancer induction by UVB exposure (9).

Furthermore, upstream activators of the AP-1 complex also modulate tumor formation (10). AP-1 activity in the skin is regulated through a cascade of signaling events involving protein kinase C (PKC), Ras, and the p38 family of mitogen-activated protein kinases (11). Additionally, activation of AP-1 by c-Jun NH2-terminal kinase (12), PKC family members (13, 14), and tumor necrosis factor-{alpha} (15) and constitutive activation of Ras promote tumorigenesis (1618).

Although previous studies have shown that specific AP-1 factors modify tumor incidence or progression (1, 7), studies to date have been unable to examine the effects of AP-1 modulation after tumor development. We have used the two-transgene tetracycline system (19) to regulate expression of a high-affinity AP-1 dominant-negative protein (A-FOS). A-FOS is a chimeric protein containing the c-FOS leucine zipper and a designed acidic protein sequence that replaces the DNA-binding region. A-FOS heterodimerizes with c-FOS dimerization partners, which are primarily the JUN family of proteins (c-Jun, JunB, and JunD; ref. 20) to prevent AP-1 DNA binding (21). By establishing a mouse model whereby AP-1 activity in the skin is "on" or "off," we can document the influence of AP-1 transcriptional activity on specific stages of tumor development. Here, we report the powerful influence of AP-1 on determining tumor cell lineage and premalignant progression in the mouse skin model of multistage carcinogenesis.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Transgenic mice. To make the 7X-tetOp A-FOS transgene, the plasmid pUHD 10-3 (19) was linearized with SacII and BamHI and ligated to a 62-bp polylinker: top strand, 5'-GGCCACCATGGCGTATCCCTACGACGTGCCCGATTATGCCCGATTATGCCCATATGCAGGAATTCAAGCTTG-3' that encodes a Kozak consensus and a Hemagglutinin tag (YPYDVPDYA). An SV40 poly(A) fragment containing the small T-antigen intron that preceded the poly(A) site was obtained from the plasmid pRSVNeo as a 1,026-bp BamHI-SmaI fragment. This fragment, when ligated to the BamHI-NaeI–digested 2.7-kb vector (pTRE 850/85-ds) backbone, produced a plasmid with the SV40 poly(A) in reverse orientation (pTRE850/851 ds reversed). To obtain a plasmid with the SV40 poly(A) in the correct orientation, "pTRE850/851-ds-reversed" was digested with HindIII. The 2,704-bp vector and the 1,067-bp insert were then religated, and recombinants were selected in which the insert fragment [representing the SV40 poly(A)] is reversed when compared with the parental plasmid. This plasmid was digested with HindIII (partial) and NdeI and ligated to the A-FOS cDNA digested with the same enzymes from the CMV566 plasmid (22) to produce the construct "tet A-FOS." Tet-A-FOS was linearized with AatII and AflIII, and the 2.4-kb insert (bearing the 7X tetOp, hemagglutinin-tagged A-FOS, and the SV40poly A (with intron) was injected into mouse pronuclei by standard procedures. The founder pups on the FVB/N background were screened initially by Southern hybridization of tail DNA preparations using the complete AatII-AflII transgene fragment as probe and subsequently by PCR.

Mice from the keratin 5-tet-transactivator (K5-tTA) FVB/N line (23) were crossed with homozygous mice from the tetA-FOS line to produce double transgenic mice (K5/A-FOS) with tetracycline-regulated expression of A-FOS restricted to K5-expressing cells. For convenience, the tetA-FOS pups from this cross are referred to as wild type (WT). During mating and gestation, mothers were kept on doxycycline feed (20 mg/kg of feed; Bio-serve, Baltimore, MD) to repress expression of A-FOS and switched to a normal diet at weaning, which induced A-FOS expression. The TRE-Luciferase (TRE-LUC) mouse was originally described by Rincon et al. (24). This strain has 12-O-tetradecanoylphorbol-13-acetate/phorbol 12-myristate 13-acetate (PMA)–inducible luciferase expression dependent on the TRE (AP-1) site (24). K5/A-FOS mice were crossed with TRE-LUC mice to generate triple transgenic mice. Mice were sacrificed according to protocols approved by the National Cancer Institute Animal Care and Use Committee. Genotypes were determined by PCR analysis of DNA from tail biopsies. The following forward and reverse primer pairs were used: tetA-FOS, 5'-CCACGCTGTTTTGACCTCCATAG-3' and 5'-ATTCCACCACTGCTCCCATTC-3'; K5-tTA, 5'-AACAACCCGTAAACTCGCCC-3' and 5'-GCAACCTAAAGTAAAATGCCCCAC-3'; TRE-LUC, 5'-GCGGAATACTTCGAAATGTC-3', 5'-TTAGGTAACCCAGTAGATCCCC-3'.

Electrophoretic mobility shift assay. Six B-ZIP dimers, including the FOS|JUND heterodimer, CAAT/enhancer binding protein (C/EBP), cyclic AMP–responsive element binding protein (CREB), protease-activated receptor (PAR), activating transcription factor 6 (ATF6), and interleukin-3-regulated nuclear factor (NFIL3) homodimers, were mixed with 0, 1, 10, or 100 molar equivalents of A-FOS in a gel shift reaction buffer [25 mmol/L Tris-HCl (pH 8), 50 mmol/L KCl, 0.5 mmol/L EDTA, 2.5 mmol/L DTT, 1 µg/µL bovine serum albumin (BSA), 10% glycerol] to a final volume of 20 µL and incubated at 65°C for 20 minutes. The protein mix was cooled to room temperature, and 7 pg of double-stranded 32P-radiolabeled 28-mer oligonucleotide was added and incubated at 37°C for 20 minutes. The sequences of the 28-mer DNA probes are GTCAGTCAGAATGACTCATATCGGTCAG (AP-1) for FOS/JUND heterodimer, GTCAGTCAGATTGCGCAATATCGGTCAG for C/EBP, GTCAGTCAGATTACGTAATATCGGTCAG for PAR, and GTCAGTCAGATGACGTCATATCGGTCAG for CREB, ATF6, and NFIL3. Samples were separated in 7.5% acrylamide gel; the gel was dried and exposed for autoradiograghy.

To confirm the inhibition of DNA binding by A-FOS expression in transgenic mice, K5/A-FOS or WT primary keratinocytes were cultured in 0.05 mmol/L Ca2+ medium and PMA treated for 6 hours in the presence or absence of doxycycline. Nuclear extracts were prepared using the NE-PER reagent (Pierce, Rockford, IL); 10,000 cpm of labeled oligonucleotide was added to 2 µg of protein sample and then incubated in binding buffer (10 mmol/L HEPES, 80 mmol/L KCl, 0.05 mmol/L EDTA, 6% glycerol, 1 mmol/L DTT, and 1 mmol/L MgCl2) at 37°C for 20 minutes. Samples were separated on a 5% PAGE gel in 0.25x Tris-borate EDTA at 150 V for 2 hours. Oligonucleotides used contained DNA binding sites for AP-1 and CRE (25). To verify specificity of DNA binding, 50-fold unlabeled probe was added in a competition assay (26). To test the direct effect of recombinant A-FOS protein on the electrophoretic mobility shift assay (EMSA) results, WT FVB/N primary keratinocytes were cultured in 0.05 mmol/L Ca2+ media. Nuclear extracts were prepared identically except that the nuclei from one 150-mm dish (1.2 x 107 cells) were lysed in the presence of 2.5 ng pure recombinant A-FOS protein and incubated for 2 hours at 38°C before EMSA. These nuclear extracts were incubated with oligonucleotides containing binding sites for AP-1, CRE, C/EBP, and SP1 as described above.

Determination of luciferase activity. TRE-LUC and K5/A-FOS/TRE mice were placed on normal feed for 2 weeks before treatment with 5 µg PMA in 25 µL acetone on one ear, whereas the other ear was treated with acetone alone. Extracts were prepared directly in lysis buffer (Promega, Madison, WI) after 6 hours. Luminescence was quantified from 25 µL of extract in 200 µL luciferase reagent in triplicate from three mice for each group with error bars representing SE. Primary keratinocytes were cultured in 0.05 mmol/L calcium-containing media in the presence of doxycycline (15 ng/mL). Medium was changed to doxycycline-free medium 24 hours before the addition of PMA (100 ng/mL). After 4 hours, lysates were prepared (Promega), and luciferase activity was determined. For the TOP-FLASH (Upstate Biotechnology, Charlottesville, VA) ß-catenin reporter assays, cells were plated in 24-well plates and transfected with either TOP or the mutant FOP reporter at 0.8 µg plasmid per well with LipofectAMINE 2000 transfection reagent. After 6 hours, medium was changed to 0.05 mmol/L calcium growth medium overnight. LiCl (10 mmol/L) was added 6 hours before harvest, and assays were done as above.

Tumor initiation/promotion studies. Mice at 8 to 10 weeks of age were initiated with 7,12-dimethylbenz(a)anthracene (DMBA; 100 µg/200 µL acetone) on shaved dorsal skin. PMA (5 µg/200 µL acetone 1x/wk) promotion was started 1 week later and continued for 20 weeks, and tumor number was recorded weekly. Protocols used for dietary doxycycline are described in the Results and figure legends. Study groups included equal numbers of male and female mice for all groups. In Fig. 2C, animal numbers were WT [+Dox (n = 17), –Dox (n = 9)] and K5/A-Fos [+Dox (n = 14), –Dox (n = 10)]. In Fig. 2D, animal numbers were WT [+Dox (n = 16), –Dox (n = 15)] and K5/A-FOS [+Dox (n = 11), –Dox (n = 10)]. Some animals were sacrificed at time points after 27 weeks to examine tumor histology.


Figure 2
View larger version (62K):
[in this window]
[in a new window]
 
Figure 2. Skin phenotype in A-FOS-expressing mice. A, alopecia and ulcerative dermatitis in 9-month-old K5/A-FOS mouse expressing A-FOS. B, histology of H&E-stained sections showing sebaceous gland hyperplasia (sq, squamous epithelium; sb, hyperplastic sebaceous glands). C, ADRP (red) specifically localizes to developing sebaceous gland in neonatal skin, whereas K14 (green) localized to the basal epidermis. Blue, 4',6-diamidino-2-phenylindole staining of the nuclei. D, tumor induction in K5/A-FOS or tetA-FOS mice fed either a doxycycline or normal diet. Mice were treated once with DMBA followed by weekly treatments with PMA for 20 weeks. At week 27, all mice were fed a normal diet through the remainder of the study. E, K5/A-FOS and tetA-FOS mice were treated as in (C), but at week 27, food for all groups was switched. F, papillomas developed in control groups and K5/A-FOS mice on doxycycline diet (tetA-FOS shown at week 25). G, numerous small yellowish tumors develop on K5/A-FOS mice fed normal diet when A-FOS is expressed (tumors at week 25). H, mutations in the H-ras gene in genomic DNA isolated from normal skin, squamous papillomas, and a squamous carcinoma (SCC) excised from mice treated with DMBA/PMA and expressing AP-1 activity, and 11 sebaceous adenomas produced from the same DMBA/PMA treatment during continual A-FOS expression. Alternate lanes contain undigested or XbaI-digested PCR products. Arrows, migration of the restriction susceptible allele containing the A-T mutation in codon 61. The less robust amplification of mutant bands in sebaceous tumors is due to extensive overlying and adjacent normal tissue excised along with the small sebaceous tumors.

 
Ras mutation analysis. Genomic DNA was isolated from normal skin, three squamous papillomas, and a squamous cell carcinoma excised from mice treated with DMBA/PMA and expressing AP-1 activity and 11 sebaceous adenomas produced from the same DMBA/PMA treatment during continual A-FOS expression. DNA was amplified by nested PCR for a region spanning codon 61 of the H-ras gene, before digestion with XbaI, which specifically recognizes the activating A-T mutation, and subjected to gel electrophoresis (27).

Immunohistochemistry. Tissue sections were deparaffinized, rehydrated through a graded series of ethanol followed by PBS, and blocked with 10% normal goat serum/3% BSA/PBS for 1 hour. Primary antibodies were applied: rabbit anti-keratin 5 or 6-FITC conjugated (Covance, Princeton, NJ), guinea pig anti-ADRP (Research Diagnostics, Flanders, NJ), rabbit anti-ß-catenin (Sigma, St. Louis, MO), goat anti-Indian Hedgehog (IHH; Santa Cruz Biotechnology, Santa Cruz, CA), and goat anti-FRP3 (R&D Systems, Minneapolis, MN) in a solution of 3% BSA/PBS. Slides were washed in PBS before application of respective FITC- or Cy3-conjugated donkey secondary antibodies (Jackson Immunologicals, West Grove, PA). Slides were stained with 4',6-diamidino-2-phenylindole for visualization of nuclei before fluorescence microscopy.

Immunoblot analysis. Total protein lysates were prepared by extracting primary keratinocyte cultures with M-PER reagent (Pierce). Protein extracts were loaded into NuPage gels (Invitrogen, Carlsbad, CA) and run according to manufacturer's protocols. Blotted extracts were blocked in TBS-Tween + 3% BSA. Primary antibodies diluted in TBS-Tween + 3% BSA were incubated at 4°C overnight. Secondary antibodies conjugated to horseradish peroxidase were applied for 30 minutes at room temperature diluted in TBS-Tween + 3% BSA. Immunoblots were developed using enhanced chemiluminescence reagents from Pierce. Bound antibodies were detected using the Pierce Pico substrate and exposing to BioMax film (Kodak, Rochester, NY). Membranes were reprobed for actin protein to confirm equivalent loading between the samples. Immunoblot detection of A-FOS protein in cultured K5/A-FOS primary keratinocytes grown in the presence or absence of doxycycline for the times indicated. Cellular lysates were collected and analyzed on a 12.5% SDS-PAGE gel. A-FOS protein was detected with a c-FOS antibody (Santa Cruz Biotechnology) that recognizes the conserved region between A-FOS and c-FOS. Keratinocyte lysates from single transgenic tetA-FOS mice or 0.2 pg recombinant A-FOS protein (rA-FOS) were included as negative and positive controls respectively (data not shown).

Reverse transcription-PCR analysis. RNA from primary keratinocytes was isolated with Trizol (Invitrogen) and DNase treated (Ambion, Austin, TX). Initial-strand cDNA was first prepared (Invitrogen) and used for reverse transcription-PCR with equal amounts of synthesized cDNA determined by equal amplification of ß-actin. For PCR amplification, the forward and reverse primer pairs are listed in the Supplementary Data.

Oil Red-O analysis. WT and K5/A-FOS skin keratinocytes were cultured in 0.05 mmol/L calcium growth media for 48 hours, and then differentiation was induced in 0.12 mmol/L calcium medium for 48 hours before fixation in 4% paraformaldehyde and staining with Oil Red-O. To quantify the number of Oil Red-O cells, 25 fields were counted for each genotype using a x10 objective, and mean ± SE was determined for each genotype.

Chromatin immunoprecipitation: ChIP on chip. Binding of phospho-c-JUN, CREB, and C/EBPß to the promoter of 13 genes shown on Fig. 6A was examined using ChIP-on-chip assay with mouse promoter microarrays from NimbleGen (Madison, WI). Primary mouse keratinocytes were treated with 1% formaldehyde for 8 minutes, and the reaction was stopped by glycine. The chromatin immunoprecipitation (ChIP) was done with Upstate ChIP reagents and protease inhibitors (Roche, Indianapolis, IN). The cells were washed, collected in cell lysis buffer, sheared by ultrasound producing DNA fragments of 700 bp average size. The lysate was centrifuged, diluted 20 times, precleared with BSA- and yeast tRNA-saturated protein A/G agarose mix (Invitrogen), and immunoprecipitated with antibodies against phospho-c-JUN (Santa Cruz Biotechnology), CREB (Upstate Biotechnology), and custom C/EBPß antibody. The ChIP with nonspecific IgG was used as negative control. The ChIP eluate was incubated with NaCl at 65°C overnight, at 95°C for 1 hour, and digested with Proteinase K and extracted with phenol. The ChIP DNA was purified using Qiagen (Valencia, CA) MinElute kit; 5 ng of ChIP DNA were randomly amplified using "RoundA/B" protocol (28) with Cy5-labeled primers in 400 µL total PCR volume. The PCR reaction consisted of 42 cycles and produced 20 µg of product. The total genomic DNA ("input") from an aliquot of the sonicated cell lysate was extracted, amplified with Cy3 primers in parallel, and used as a reference in hybridization. The PCR product was cleaned by ethanol precipitation and hybridized in presence of yeast tRNA, COT1 DNA, and poly-dATP (10 µg each) overnight in MAUI hybridization station at 42°C to mouse promoter microarrays (Nimblegen). Each array contained promoters of 21,815 unique genes. Each promoter was represented by 15 unique 50-mer oligonucleotides located from 1,300 bp upstream to 200 bp downstream of transcription start. The arrays were washed with 2x SSC, 0.1 % SDS for 2 minutes, 1x SSC for 1 minute, and with 0.2 x SSC for 15 seconds; scanned with Axon 4000B scanner; and analyzed with NimbleScan software.


Figure 6
View larger version (44K):
[in this window]
[in a new window]
 
Figure 6. Analysis of mRNA levels of Wnt pathway family members in the presence of A-FOS and c-Jun binding to Wnt pathway promoter sequences. A, K5/A-FOS and WT FVB keratinocytes were cultured in 0.05 mmol/L calcium growth medium for 5 days before RNA isolation. cDNA was prepared and amplified with primers specific for individual Wnt pathway components. Also analyzed and found to not be altered by A-FOS expression are APC, Frp-1, Disheveled, van Gogh, tcf1, tcf3, and tcf4 (data not shown). The + sign next to each gene indicates that phospho-c-JUN binds to the promoter as defined by a 4-fold enrichment in three or more oligonucleotides used to interrogate the promoter according to a ChIP-on-chip assay. Frzd5 and Prl1 promoters (marked by dots) were not on the Nimblegen microarray. B, ChIP with antibodies to phospho-c-JUN, C/EBPß, and CREB was used to isolate DNA bound by these transcription factors. This DNA was amplified and hybridized to Nimblegen mouse promoter arrays. The results for the Wnt4 and Wnt5a promoters are presented. Top, schematic for these promoters with the transcriptional start site marked by an arrow. Bottom, location of potential AP-1 binding sites with canonical bases in bold. The fold enrichment of the ChIP DNA relative to the reference genomic DNA shown for the oligonucleotides used to interrogate the promoter is plotted at the location of the middle of the oligonucleotide. C, schematic representation showing that modulation of AP-1 activity causes alterations in wnt and hedgehog family members, shifting the balance between squamous and sebaceous lineages, respectively.

 

    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A-FOS inhibits AP-1 binding to TRE DNA and transcriptional activity. To express A-FOS, an inhibitor of AP-1 binding to the TRE sequence in mouse epidermis, we crossed K5-tTA mice that use the bovine keratin 5 promoter to express the tetracycline transactivator protein (tTA) in basal keratinocytes and outer root sheath cells of the skin with tetA-FOS mice that express A-FOS under the regulated control of seven tetracycline responsive elements to produce double transgenic mice (K5-tTA/tetA-FOS referred to as K5/A-FOS). Immunohistochemical analysis indicates that the K5/A-FOS mice express the A-FOS protein in the epidermis and hair follicles (Fig. 1A ). A-FOS mRNA expression is inhibited in the skin in the presence of doxycycline, a tetracycline analogue, because the tetracycline transactivator when bound to doxycycline is inhibited from binding DNA (Fig. 1B). A similar doxycycline dependence of A-FOS expression is observed in primary cultures of newborn keratinocytes from double transgenic mice (Fig. 1C).


Figure 1
View larger version (27K):
[in this window]
[in a new window]
 
Figure 1. A, A-FOS protein was detected by immunostaining of tail skin of K5/A-FOS mice with an antibody that recognizes the hemagglutinin antigen at the NH2 terminus of the A-FOS protein. A-FOS protein expression is in basal epidermis and overlaps the expression seen with a keratin 5 antibody. No staining was seen in non–A-FOS-expressing skin. B, to examine doxycycline (Dox)–dependent A-FOS expression, RNA was isolated from skin of K5/A-FOS mice fed doxycycline or normal food from birth and analyzed by reverse transcription-PCR. A-FOS mRNA is strongly induced in the absence of doxycycline. C, immunoblot detection of A-FOS protein in cultured K5/A-FOS primary keratinocytes grown in the presence or absence of doxycycline. A-FOS protein was detected with a c-FOS antibody (Santa Cruz Biotechnology) that recognizes the c-FOS leucine zipper, a conserved region between A-FOS and c-FOS. D and E, AP-1-dependent luciferase activity in skin from single (TRE-LUC) or triple transgenic (K5/A-FOS/TRE) mice or primary skin keratinocytes from each genotype was determined before and after PMA exposure. Units are arbitrary. F, A-FOS expression inhibits TRE DNA binding. K5/A-FOS or WT primary keratinocytes were cultured in 0.05 mmol/L Ca2+ medium and PMA treated for 6 hours in the presence or absence of doxycycline. G, specificity of A-FOS inhibition of DNA binding of AP-1 factors was shown in EMSAs by incubating lysates of WT keratinocytes with recombinant A-FOS protein and labeled oligonucleotides for AP-1, CRE, and SP1. Samples were separated with 5% PAGE. H, inhibition of DNA binding of different B-ZIPs by A-FOS. Six B-ZIP dimers, including the FOS|JUND heterodimer, C/EBP, CREB, PAR, ATF6, and NFIL3 homodimers, were mixed with 0, 1, 10, or 100 molar equivalents of A-FOS. The protein mix was then incubated with double-stranded 32P-radiolabeled 28-mer oligonucleotide for each protein dimer pair. Samples were separated with a 7.5% PAGE gel.

 
To determine if A-FOS expression in skin epidermis inhibits TRE-DNA transcriptional activity, triple transgenic mice (K5/A-FOS/TRE) containing K5-tTA, tetA-FOS, and the TRE reporter transgene TRE-Luciferase (TRE-LUC; ref. 24) were treated with the phorbol ester PMA to stimulate TRE activity, which increased ~7-fold in WT skin. However, in the presence of A-FOS expression, basal TRE activity was unaffected, whereas PMA-induced TRE activity was nearly eliminated (Fig. 1D). In primary keratinocyte cultures produced from triple transgenic newborn pups, A-FOS expression suppressed both basal and induced activity. The difference in A-FOS inhibition of basal TRE activity in vivo and in vitro most likely reflects the regulation of the K5 promoter that is down-regulated in differentiating epidermis but not cultured keratinocytes. Thus, A-FOS inhibits TRE-dependent transcriptional activity in both skin and cultured keratinocytes, presumably by inhibiting AP-1 binding to the TRE sequence. Previously, we have shown that the AP-1 complex in murine epidermis encompasses c-Jun, Jun B, Jun D, c-Fos, Fra 1, and Fra 2, whereas c-Fos is not detected in cultured keratinocytes (26).

A series of EMSA were used to evaluate the specificity of A-FOS at inhibiting the binding of nuclear extracts to different DNA sequences. Nuclear extracts isolated from primary newborn keratinocytes expressing A-FOS for 24 hours after the removal of doxycycline do not bind either in the basal or PMA-stimulated case to a TRE-containing oligonucleotide (5'-TGAGTCA-3'). However, these nuclear extracts do bind to the closely related CRE-containing oligonucleotides (Fig. 1F). To evaluate if inhibition of TRE binding was a direct consequence of the A-FOS protein, recombinant A-FOS protein was added to nuclear extracts prepared from WT keratinocytes. The EMSA indicates that exogenous A-FOS inhibited DNA binding to TRE-containing DNA oligonucleotide but not three additional oligonucleotides containing consensus-binding sites for CREB, C/EBP, or SP1 (Fig. 1G). Furthermore, recombinant A-FOS protein specifically inhibits DNA binding of AP-1 dimers (c-FOS|JunD) but not five other B-ZIP dimers in EMSA assays at equimolar equivalents (Fig. 1H). Interference with C/EBP binding is detected only at 10- to 100-fold molar excess. Thus, A-FOS specifically and directly inhibits DNA binding and transcriptional activity of the TRE.

A-FOS expression in skin causes hyperplasia of sebaceous glands. Expression of A-FOS in mouse epidermis did not produce an obvious phenotype until late in life when mice often developed mild hair loss (alopecia), sebaceous gland hyperplasia (particularly but not exclusively on the eyelids), and focal skin erosions (Fig. 2A and B ). In the focal erosions, the hyperplastic sebaceous glands became independent of the adjacent hairs follicles that were degenerating.

cDNA microarrays were used to further characterize the consequences of expressing A-FOS in the epidermis. One of the up-regulated genes is adipocyte differentiation–related protein (ADRP), which functions in lipid sequestration (29). Immunohistochemical localization of ADRP indicates that it is a novel marker for sebocytes in developing sebaceous glands from newborn skin (Fig. 3C, inset, red ) and mature sebaceous glands (data not shown). These data further support the observation that A-FOS expression shifts the balance toward the sebaceous lineage.


Figure 3
View larger version (99K):
[in this window]
[in a new window]
 
Figure 3. Modulating AP-1 activity during tumorigenesis alters tumor cell lineage. H&E-stained section of a (A) squamous papilloma and (B) sebaceous adenoma from K5/A-FOS mice fed a normal diet respectively. C, immunofluorescent staining for ADRP (red) and K6 (green) of sebaceous adenoma. D and E, H&E stain of a mixed squamous-sebaceous lesion from K5/A-FOS mice where diets are switched. Double-immunofluorescent staining of ADRP (F; red) or IHH (H; red) and K6 (green) with strong colocalization in individual cells (arrows). G, papilloma where A-FOS expression was initiated at 27 weeks with total transdifferentiation into sebaceous adenoma. J, IHH is not detected on immunostaining of squamous papillomas compared with (K) K6 that is abundant in all squamous tumors. I, Oil Red-O staining of a sebaceous adenoma.

 
Inhibiting AP-1 during skin carcinogenesis produces sebaceous adenomas. To examine the consequence of inhibiting AP-1 activity in a skin carcinogenesis protocol, K5/A-FOS mice and single transgenic littermates (tetA-FOS referred to as WT) that do not express A-FOS were initiated at 8 to 10 weeks with a single topical application of DMBA followed by weekly applications of the phorbol ester PMA for 20 weeks to induce skin tumors. Mice of both genotypes (K5/A-FOS and WT) were fed two different diets, a doxycycline-containing diet or normal diet 2 weeks before initiation with DMBA. In this double transgenic system, a normal diet results in A-FOS expression and the suppression of the TRE activity in K5/A-FOS mice, whereas mice on a doxycycline diet retain AP-1 activity regardless of genotype.

The three groups of mice with normal AP-1 activity (WT mice on doxycycline, WT mice off doxycycline, and K5/A-FOS mice on doxycycline) developed two to three tumors per mouse during the course of two independent carcinogenesis protocols (Fig. 2D and E). These tumors were large (100-300 mm3) glistening lesions typical of squamous papillomas (Fig. 2F), and this diagnosis was confirmed with histologic examination of the tumors (Fig. 3A). As expected, these tumors had the A-to-T mutation in codon 61 of the H-ras gene characteristic of DMBA-initiated papillomas (ref. 30; Fig. 2H). In contrast, the K5/A-FOS mice continually expressing A-FOS developed approximately five times more tumors per mouse (Fig. 2D and E) that were small (2-8 mm3) and pale yellow (Fig. 2G). Histologic examination of these tumors identified 91% well-differentiated sebaceous adenomas (Fig. 3B; Table 1 ), an uncommon tumor type that arises from the sebaceous gland of the hair follicle. These tumors also contained the characteristic H-ras mutation found in control papillomas (Fig. 2H). Tumors from all groups were dependent on DMBA mutagenesis, as PMA treatment alone for 20 weeks did not produce tumors (Table 1). One third of the squamous papillomas from control (tetA-FOS) mice converted to carcinomas, whereas none of the tumors on the K5/A-FOS mice expressing A-FOS underwent malignant conversion (summarized in Table 1).


View this table:
[in this window]
[in a new window]
 
Table 1. Summary of tumor phenotype from carcinogenesis

 
The expression of sebocyte specific molecular markers was used to further characterize the differentiation status of the sebaceous adenomas observed histologically. ADRP is overexpressed in A-FOS-expressing skin, is expressed in normal sebaceous glands, and is also expressed in sebaceous adenomas (Fig. 3C, red). Additionally, the established sebaceous gland molecular marker IHH (31) also localized to sebaceous tumor cells (Fig. 3H, red). These data indicate that the histologically observed sebaceous adenomas are expressing molecular markers of sebaceous cells. However, neither ADRP nor IHH was detected in squamous tumors (Fig. 3J). In contrast, the hyperproliferative keratinocyte cell marker, keratin 6 (K6), was abundantly expressed in papillomas (Fig. 3K; ref. 32) and not expressed in the sebocytes or sebaceous adenomas (Fig. 3C, green). Expression of these molecular markers coupled with strong staining of the adenomas with Oil Red-O (Fig. 3I) indicates the tumors are functionally well-differentiated sebaceous adenomas.

Inhibiting AP-1 activity in squamous tumors induces sebaceous adenomas. We used the inducible capacity of the tetracycline system to induce A-FOS expression in K5/A-FOS mice after squamous papillomas formed. The doxycycline diet was switched to a normal diet 27 weeks after the initiation of the carcinogenesis protocol when squamous papillomas had formed and tumor growth continued for an additional 22 weeks. Expression of A-FOS results in an 80% reduction in malignant conversion, indicating that inhibition of AP-1 activity after papilloma formation is sufficient to block or delay carcinoma formation (Table 1). Provocatively, approximately half of the tumors showed a profound alteration of the standard squamous papilloma histology not observed in control mice that do not express A-FOS: 26% of the tumors became mixed sebaceous/squamous lesions, 14% converted to pure sebaceous adenomas, and 53% remained squamous papillomas (see Table 1 for summary; Fig. 3D and E). These results show that continuous AP-1 activity is necessary to maintain the squamous phenotype, and after A-FOS expression, there is a conversion from a squamous to sebaceous phenotype.

Activating AP-1 activity in sebaceous adenomas induces squamous tumors. To determine if restoring AP-1 activity in sebaceous adenomas could produce a reciprocal conversion of sebaceous tumors into squamous tumors, A-FOS expression was repressed in K5/A-FOS mice with existing sebaceous adenomas to reactivate AP-1 activity. Twenty-seven weeks after the initiation of the carcinogenesis protocol, K5/A-FOS mice were switched to a doxycycline diet to restore AP-1 activity, and tumors were collected at multiple time points. Twenty percent of sebaceous adenomas converted to papillomas; 24% were mixed squamous/sebaceous tumors; and 56% remained pure sebaceous adenomas when tumors were analyzed for all time points (Table 1). Mixed tumors were detected after only 5 weeks of AP-1 activity, whereas a complete change in tumor phenotype into squamous tumors was not observed until 22 weeks.

In mixed tumors arising from either sebaceous adenomas or squamous papillomas, the topology was similar; the squamous portion was at the periphery; and the sebocytes were in a central portion of the tumor mass (Fig. 3D and E). In addition to modulating tumor lineage identity, continual suppression of AP-1 activity inhibited malignant progression of sebaceous tumors (Table 1). However, when AP-1 activity was restored to sebaceous adenomas, 5% of the sebaceous tumors converted to sebaceous carcinomas. These data are similar to the inhibition of malignant conversion of squamous papillomas expressing A-FOS, indicating that AP-1 activity is necessary for malignant conversion of both squamous and sebaceous tumors of the skin.

The cellular composition of the mixed tumors was complex. Although certain cells clearly seemed to be either squamous or sebaceous by histologic criteria, many cells seemed to have morphologic similarity to sebocytes with condensed central nuclei, while maintaining a basophilic staining akin to squamous keratinocytes (Fig. 3E). Immunohistochemical analysis of mixed tumors derived by expressing A-FOS in squamous papillomas identified individual cells that express both K6 and ADRP (Fig. 3F), suggesting transdifferentiation of squamous cells into sebaceous cells. However, in some tumors where AP-1 activity has been inhibited after papilloma formation, cells are observed that express ADRP but not K6, suggesting a complete transdifferentiation from squamous cells to sebaceous cells (Fig. 3G). Likewise, in mixed tumors derived through activating AP-1 in sebaceous adenomas, a similar colocalization of squamous and sebaceous markers in the same cells is observed (Fig. 3H, IHH and K6 are shown).

No differences in proliferation or cell death are observed in the mixed tumors compared with either the papillomas or sebaceous adenomas. Tumor regression was not detected after A-FOS induction (based on consistent tumor number and size), suggesting that sebaceous conversion was not due to death of squamous cells and selection of cells of the sebaceous lineage. All tumor types showed equivalent levels of cellular proliferation based on nuclear proliferating cell nuclear antigen staining (data not shown). Furthermore, apoptotic cells were not detected by terminal deoxynucleotide transferase–mediated nick-end labeling or active caspase-3 staining (data not shown) of papillomas, sebaceous adenomas, or mixed tumors.

Recent reports indicate that the sebaceous cell fate results from destabilization of the ß-catenin protein (33). To determine if A-FOS expression affects ß-catenin protein abundance and distribution, papillomas (Fig. 4A ), sebaceous adenomas (Fig. 4B), and mixed tumors (Fig. 4C and D) were immunostained for ß-catenin. Papillomas stain strongly for ß-catenin, with a membrane and diffuse cytoplasmic localization, whereas sebaceous adenomas are negative. In mixed tumors, intense ß-catenin staining is only evident in the peripheral region of the tumor acquiring a squamous phenotype (Fig. 4D). After restoring AP-1 activity in sebaceous adenomas, some mixed tumors had ß-catenin staining in regions with sebaceous cells, further supporting the notion that transdifferentiation is occurring. The staining pattern of sFRP-3 (previously known as Frizzled B), a secreted protein known to inhibit wnt signaling resulting in ß-catenin protein destabilization (34), has the opposite staining pattern to that seen for ß-catenin. sFRP-3 is abundant in a mixed tumor expressing A-FOS, localizing to cells with either a sebaceous or squamous phenotype (Fig. 4E) but was not detected in squamous papillomas (Fig. 4F).


Figure 4
View larger version (93K):
[in this window]
[in a new window]
 
Figure 4. ß-Catenin protein is suppressed by A-FOS expression. A, immunofluorescence localization of ß-catenin (red) in a papilloma or epidermis surrounding a sebaceous adenoma (B) but not in the sebaceous adenoma. C, in a mixed tumor with reexpressed AP-1 activity (outlined with dashed line), ß-catenin (red) stains a subpopulation of transdifferentiating sebaceous cells and surrounding squamous epidermis but is not present in the residual sebaceous component. D, a mixed tumor reexpressing AP-1 activity showing a ß-catenin-positive peripheral region assuming the squamous phenotype. E, sFRP-3 is detected throughout tumors expressing A-FOS (shown is a mixed tumor from K5/A-FOS mice). F, sFRP-3 is not detected in papillomas.

 
Inhibiting AP-1 in primary keratinocytes induces sebaceous markers. We are able to recapitulate the induction of the sebaceous phenotype in cultured transgenic newborn primary keratinocytes by expressing A-FOS. Keratinocyte cultures expressing A-FOS have a 12-fold increase in cells staining with Oil Red-O (Fig. 5A-C ), a marker for lipid accumulation as occurs in differentiating sebaceous cells (Fig. 3I). Genetic approaches from several laboratories have provided evidence that the balance between wnt and IHH signaling pathways determines commitment to the squamous or sebaceous lineages (31, 35). Consistent with the induction of a sebaceous phenotype in cultured keratinocytes, A-FOS alters the expression of genes in the wnt and frizzled families. A-FOS up-regulates mRNA transcripts for the wnt antagonists sFRP-3 and DKK3 (36) and down-regulates the wnt target gene c-Myc (37) when keratinocytes are grown in either a proliferative medium (0.05 mmol/L calcium; Fig. 5D) or a differentiation medium (0.12 mmol/L calcium; data not shown). Figure 5E confirms these changes at the protein level. Furthermore, up-regulation of the ADRP protein by A-FOS in keratinocytes supports a sebaceous phenotype (Fig. 5E). Supporting the functional inhibition of AP-1 activity in these cultures is the down-regulation of cyclooxygenase-2, a known AP-1-regulated gene (ref. 10; Fig. 5E).


Figure 5
View larger version (36K):
[in this window]
[in a new window]
 
Figure 5. Development of Oil Red-O–positive cells in tissue culture following A-FOS expression. WT (A) and K5/A-FOS (B) skin keratinocytes were induced to differentiate with 0.12 mmol/L calcium for 48 hours before staining with Oil Red-O. The differentiating K5/A-FOS keratinocytes in 0.12 mmol/L calcium medium developed large intracellular deposits of lipid, whereas WT cells were Oil Red-O negative. C, to quantify the number Oil Red-O cells, 25 fields were counted for each genotype using a x10 objective. Columns, mean for each genotype; bars, SE. D, gene expression determined by reverse transcription-PCR from 0.05 mmol/L calcium cultures of WT and K5/A-FOS keratinocytes for A-FOS, sFRP-3, IHH, DKK, c-Myc, ß-catenin (ß-cat), and actin control. E, immunoblot analysis of protein expression from WT and K5/A-FOS keratinocytes cultured in 0.12 mmol/L calcium for 48 hours for COX-2, ß-catenin, c-Myc, ADRP, IHH, and sFRP3. F, plasmid DNAs for the ß-catenin-dependent reporter gene (TOP-FLASH) or control (FOP-FLASH) were transfected into WT FVB or K5/A-FOS cultured keratinocytes, and luciferase activity was determined after treatment for 6 hours with 10 mmol/L LiCl to activate ß-catenin.

 
The levels of ß-catenin in keratinocyte cultures did not change (Fig. 5D and E), suggesting that A-FOS acts downstream to inhibit ß-catenin function. To test this possibility, we examined a ß-catenin-dependent luciferase reporter (TOP-FLASH), which contains TCF/LEF DNA-binding sites. When introduced into WT or K5/A-FOS keratinocytes and activated by lithium chloride, A-FOS inhibits the reporter activity, indicating that ß-catenin transcriptional activity in this assay is dependent on active AP-1 (Fig. 5F). Previous studies have shown physical cooperation between c-Jun, an AP-1 component and the TCF/LEF transcription factors (38).

To evaluate the role for AP-1 in wnt signaling, we examined the mRNA expression of canonical and noncanonical wnt family and pathway transcripts in primary keratinocytes by expressing A-FOS. Figure 6A indicates a broad regulation of wnt family transcripts by AP-1 activity with both increased and decreased expression in a complex pattern, suggesting that an intimate crosstalk exists between AP-1 and wnt pathways. This relationship is supported by several recent studies using alternative approaches (3941).

c-JUN binds to the promoters of Wnt family members. To determine if the wnt and frizzled family members whose mRNA concentrations changed after A-FOS expression are direct targets of AP-1 transcription factors in tissue culture, we examined if phospho-c-Jun, a member of the AP-1 complex, is bound to their promoter regions using the ChIP assay. In brief, the ChIP assay was done with four different antibodies: phospho-c-JUN (specific to phosphorylated Ser73), CREB, C/EBP, and IgG. We used the Nimblegen mouse promoter array to examine binding to 21,815 promoters, each represented by 15 oligonucleotides. Phospho-c-JUN was enriched over 4-fold (for ≥3 of the 15 oligos per promoter) in 1,060 promoters, CREB was enriched in 451 promoters and C/EBPß in 95 promoters. Previously identified known targets of phospho-c-JUN were also enriched (42). The genes containing multiple TRE motifs were enriched in phospho-c-JUN ChIPs.

The promoters of 31% (4 of 13) of the wnt and frizzled genes mentioned in Fig. 6A were enriched over 4-fold (for three or more oligos per promoter) for phospho-c-JUN, whereas on average, only 5% (1,060 of 21,815) of promoters are enriched for phospho-c-JUN. This suggests that A-FOS misregulation of these genes is because they are direct targets of the AP-1 complex containing phospho-c-JUN. Figure 6B presents the binding of these three antibodies to the promoter region for two genes. Phospho-c-JUN binds in the promoter region of Wnt4 and Wnt5a, but C/EBPß and CREB do not.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We describe a two-transgene tetracycline regulated mouse system that allows for the reversible expression in the skin of A-FOS, a dominant negative to the AP-1 transcription factor complex. The A-FOS dominant negative heterodimerizes with c-FOS dimerization partners, and these heterodimers can not bind to DNA, thus inhibiting AP-1 transcriptional activity. A genome-wide analysis of FOS dimerization partners indicates that the three Jun family members are the preferred FOS dimerization partners (20). A-FOS expression in skin results in hyperplasia of sebaceous glands in older mice. Expression of A-FOS during skin carcinogenesis reveals a remarkable plasticity of tumor phenotype; squamous tumors form when AP-1 is active, and sebaceous adenomas form when AP-1 is not active. By reversing AP-1 activity after tumors form, we observe each tumor type transdifferentiating into the other tumor type, schematically represented in Fig. 6C. Furthermore, we observe an absolute requirement for functional AP-1 activity for premalignant progression and malignant conversion in experimental skin carcinogenesis. This requirement is found not only in squamous tumors but also in sebaceous adenomas.

The AP-1 transcriptional complex is composed of multiple combinations of Jun and Fos family heterodimers. A knockin experiment that placed the JunB protein coding region into the c-Jun locus, creating a JunB protein under the regulation of c-Jun promoter, has been able to rescue the embryonic lethality associated with the c-Jun deletion (43). This shows that these proteins have redundant functions during embryogenesis and suggests that the difference in the phenotypes of c-Jun and JunB knockout mice is a consequence of their different spatial and temporal expression properties (43). The redundant properties of related Jun family members makes it difficult to identify the function of the AP-1 complex when individual members of the AP-1 family are genetically deleted from the mouse genome.

Several knockout and transgenic mice have been generated that have revealed the function of AP-1 in the skin. The tissue-specific deletion of c-Jun produces an eye-open-at-birth phenotype (EOB; refs. 3, 4). The double ablation of JunB and c-Jun in the skin produces a hyperplastic, inflamed phenotype observed in ears and paws of mice, which disappears when the mice are given antibiotics (44). A transgenic mouse that expresses an NH2-terminal truncated c-Jun protein without a transactivation domain in the skin does not produce a basal phenotype but does diminish papilloma and carcinoma formation (5, 45). This construct serves as a dominant negative outside of the DNA-binding complex and interacts with multiple pathways, including AP-1, nuclear factor-{kappa}B, and the cAMP response element (8). The unique phenotype of the A-FOS mice suggests that this transgene inhibits more of the AP-1 complex than the single or double knockout mice already described. Thus, it will be interesting to determine the phenotype of the triple deletion of all three Jun family members in the skin to determine if a sebaceous hyperplasia is observed. One conclusion is that A-FOS is doing something distinct from inhibiting only c-Jun as we do not observe an EOB phenotype.

Several additional possibilities could explain these differences in phenotypes produced by deleting Jun family members and expressing A-FOS. One possibility is the incomplete inhibition of AP-1 activity in the differentiated layers of the epidermis. As the normal epidermis differentiates, the K5 promoter is silenced; thus, A-FOS is not expressed in the differentiated strata. This is in contrast to the knockout experiment that irreversibly eliminates activity in all cells that are produced after basal layer differentiation. Furthermore, K5 expression is up-regulated and expanded into the differentiating strata of skin tumors (46); thus, A-FOS would be even more highly expressed in multiple differentiating states of tumor tissue. Thus, the hyperplastic sebaceous glands in aging K5/A-FOS mice could reflect a modification of K5 or AP-1 expression in aging skin. The mixed mouse strains used in the tissue-specific knockout experiments and subsequent crosses could also influence the phenotype relative to the pure FVB/N strain we have used. Transgenic mice expressing dominant-negative A-CREB or A-C/EBP do not produce the sebaceous adenoma phenotype in similar carcinogenesis studies3, indicating that the A-FOS targets do not overlap with the specificity of A-CREB or A-C/EBP.

These results with tumor induction in K5/A-FOS mouse skin may explain why only squamous tumors develop in the classic mouse skin carcinogenesis assay induced by DMBA, whereas tumors of other phenotypes are not observed. In chemically induced squamous tumors of the skin, H-ras mutations are frequent and result in elevated AP-1 activity (17). This favors the wnt/ß-catenin pathway and directs cells to the squamous lineage, resulting in papillomas that progress to squamous cell carcinomas (31). This signal could be further amplified by a positive feedback loop of wnt signaling activating AP-1, as ß-catenin overexpression up-regulates the expression and activity of c-Jun and Fra-1 (47).

In contrast, tumor models that prevent signaling through ß-catenin (31) may also up-regulate hedgehog signaling through the inhibition of AP-1 (this report). This would favor sebaceous tumors that rarely, if ever, progress to cancer in the absence of AP-1 signaling. The elevation of IHH by AP-1 inhibition may also contribute to antagonizing wnt signaling as shown in colonic epithelium (48). Furthermore, the up-regulation of sFRP-3 by AP-1 inhibition may contribute to suppression of wnt signaling and increased ß-catenin turnover, a finding that may have significance in other tumors of mixed phenotype. The involvement of activated ß-catenin in inducing squamous cells in glandular and secretory epithelia argues for a general mechanism that epithelia use to differentiate various cell types (49). The results from the mixed tumors and cultured keratinocytes support a dynamic link between AP-1 activity, wnt and hedgehog signaling, ß-catenin stability, and discrimination between the squamous and sebaceous cell types. The ChIP experiment that shows that phospho-c-Jun is bound to the promoters in the wnt and frizzled families suggests that the link between AP-1 and the choice between the wnt and hedgehog signaling pathways is a direct transcriptional link. A requirement for AP-1 signaling in wnt/ß-catenin–mediated intestinal cancer development has been shown in the APCmin mouse model, consistent with a broader role for AP-1/wnt signaling in cancer development (39). It will be interesting to determine if A-FOS expression can switch cell identity in other epithelial systems.

Recently, attention has focused on the potential role of a subpopulation of stem-like cells in cancers that account for the infinite replicative capacity and frequent phenotypic diversity of the tumor mass (5053). Changes in the tumor microenvironment could regulate transcriptional pathways, including AP-1, in multi-potential cells to produce focal lineage alterations. In the K5/A-FOS tumor model described here, we detect cells that express markers of two distinct lineages as the tumor transdifferentiates from squamous to sebaceous or vice versa. Such biology suggests that tumor cells of defined terminal lineage are in fact plastic and can change lineage commitment between squamous or sebaceous end points as a result of changes in AP-1 transcriptional activity. Whether such cells also represent a population of stem cells with infinite proliferative capacity remains to be determined. However, it was recently reported that terminally differentiated pancreatic islet cells can be induced to replicate (54). Our studies reveal a previously unknown role of AP-1 transcriptional activity in determination and maintenance of cellular lineage. The reversible activation of AP-1 transcriptional potential reveals the plastic nature of tumor cell differentiation and a mechanism for balancing signaling pathways that control cell lineage determination.


    Acknowledgments
 
Grant support: Intramural Research Program of the NIH, National Cancer Institute, Center for Cancer Research.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Erin Kennedy and Susana Walters for their excellent assistance with carcinogenesis studies and animal husbandry, Drs. Matthew Young and Nancy Colburn (National Cancer Institute) for providing TRE-Luciferase (TRE-LUC) mice, and Drs. Jeffery Rubin and Melinda Larsen for critical reading of the article.


    Footnotes
 
Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/).

3 Vinson et al., unpublished results. Back

Received 4/ 5/06. Revised 5/19/06. Accepted 5/26/06.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Eferl R, Wagner EF. AP-1: a double-edged sword in tumorigenesis. Nat Rev Cancer 2003;3:859–68.[CrossRef][Medline]
  2. Jochum W, Passegue E, Wagner EF. AP-1 in mouse development and tumorigenesis. Oncogene 2001;20:2401–12.[CrossRef][Medline]
  3. Zenz R, Scheuch H, Martin P, et al. c-Jun regulates eyelid closure and skin tumor development through EGFR signaling. Dev Cell 2003;4:879–89.[CrossRef][Medline]
  4. Li G, Gustafson-Brown C, Hanks SK, et al. c-Jun is essential for organization of the epidermal leading edge. Dev Cell 2003;4:865–77.[CrossRef][Medline]
  5. Young MR, Li JJ, Rincon M, et al. Transgenic mice demonstrate AP-1 (activator protein-1) transactivation is required for tumor promotion. Proc Natl Acad Sci U S A 1999;96:9827–32.[Abstract/Free Full Text]
  6. Dlugosz A, Merlino G, Yuspa SH. Progress in cutaneous cancer research. J Investig Dermatol Symp Proc 2002;7:17–26.[CrossRef][Medline]
  7. Saez E, Rutberg SE, Mueller E, et al. c-fos is required for malignant progression of skin tumors. Cell 1995;82:721–32.[CrossRef][Medline]
  8. Thompson EJ, Gupta A, Stratton MS, Bowden GT. Mechanism of action of a dominant negative c-jun mutant in inhibiting activator protein-1 activation. Mol Carcinog 2002;35:157–62.[CrossRef][Medline]
  9. Cooper SJ, MacGowan J, Ranger-Moore J, Young MR, Colburn NH, Bowden GT. Expression of dominant negative c-jun inhibits ultraviolet B-induced squamous cell carcinoma number and size in an SKH-1 hairless mouse model. Mol Cancer Res 2003;1:848–54.[Abstract/Free Full Text]
  10. Bachelor MA, Cooper SJ, Sikorski ET, Bowden GT. Inhibition of p38 mitogen-activated protein kinase and phosphatidylinositol 3-kinase decreases UVB-induced activator protein-1 and cyclooxygenase-2 in a SKH-1 hairless mouse model. Mol Cancer Res 2005;3:90–9.[Abstract/Free Full Text]
  11. Eckert RL, Efimova T, Balasubramanian S, Crish JF, Bone F, Dashti S. p38 Mitogen-activated protein kinases on the body surface: a function for p38delta. J Invest Dermatol 2003;120:823–8.[CrossRef][Medline]
  12. Chen N, Nomura M, She QB, et al. Suppression of skin tumorigenesis in c-Jun NH(2)-terminal kinase-2-deficient mice. Cancer Res 2001;61:3908–12.[Abstract/Free Full Text]
  13. Jansen AP, Verwiebe EG, Dreckschmidt NE, Wheeler DL, Oberley TD, Verma AK. Protein kinase C-epsilon transgenic mice: a unique model for metastatic squamous cell carcinoma. Cancer Res 2001;61:808–12.[Abstract/Free Full Text]
  14. Wheeler DL, Ness KJ, Oberley TD, Verma AK. Inhibition of the development of metastatic squamous cell carcinoma in protein kinase C epsilon transgenic mice by {alpha}-difluoromethylornithine accompanied by marked hair follicle degeneration and hair loss. Cancer Res 2003;63:3037–42.[Abstract/Free Full Text]
  15. Arnott CH, Scott KA, Moore RJ, et al. Tumour necrosis factor-{alpha} mediates tumour promotion via a PKC {alpha}- and AP-1-dependent pathway. Oncogene 2002;21:4728–38.[CrossRef][Medline]
  16. Bode AM, Dong Z. Signal transduction pathways: targets for chemoprevention of skin cancer. Lancet Oncol 2000;1:181–8.[CrossRef][Medline]
  17. Rutberg SE, Adams TL, Glick A, Bonovich MT, Vinson C, Yuspa SH. Activator protein 1 transcription factors are fundamental to v-rasHa-induced changes in gene expression in neoplastic keratinocytes. Cancer Res 2000;60:6332–8.[Abstract/Free Full Text]
  18. Casanova ML, Larcher F, Casanova B, et al. A critical role for ras-mediated, epidermal growth factor receptor-dependent angiogenesis in mouse skin carcinogenesis. Cancer Res 2002;62:3402–7.[Abstract/Free Full Text]
  19. Resnitzky D, Gossen M, Bujard H, Reed SI. Acceleration of the G1/S phase transition by expression of cyclins D1 and E with an inducible system. Mol Cell Biol 1994;14:1669–79.[Abstract/Free Full Text]
  20. Newman JR, Keating AE. Comprehensive identification of human bZIP interactions with coiled-coil arrays. Science 2003;300:2097–101.[Abstract/Free Full Text]
  21. Vinson C, Myakishev M, Acharya A, Mir AA, Moll JR, Bonovich M. Classification of human B-ZIP proteins based on dimerization properties. Mol Cell Biol 2002;22:6321–35.[Free Full Text]
  22. Olive M, Krylov D, Echlin DR, Gardner K, Taparowsky E, Vinson C. A dominant negative to activation protein-1 (AP1) that abolishes DNA binding and inhibits oncogenesis. J Biol Chem 1997;272:18586–94.[Abstract/Free Full Text]
  23. Diamond I, Owolabi T, Marco M, Lam C, Glick A. Conditional gene expression in the epidermis of transgenic mice using the tetracycline-regulated transactivators tTA and rTA linked to the keratin 5 promoter. J Invest Dermatol 2000;115:788–94.[CrossRef][Medline]
  24. Rincon M, Flavell RA. AP-1 transcriptional activity requires both T-cell receptor-mediated and co-stimulatory signals in primary T lymphocytes. EMBO J 1994;13:4370–81.[Medline]
  25. Moll JR, Acharya A, Gal J, Mir AA, Vinson C. Magnesium is required for specific DNA binding of the CREB B-ZIP domain. Nucleic Acids Res 2002;30:1240–6.[Abstract/Free Full Text]
  26. Rutberg SE, Saez E, Glick A, Dlugosz AA, Spiegelman BM, Yuspa SH. Differentiation of mouse keratinocytes is accompanied by PKC-dependent changes in AP-1 proteins. Oncogene 1996;13:167–76.[Medline]
  27. Rehman I, Lowry DT, Adams C, et al. Frequent codon 12 Ki-ras mutations in mouse skin tumors initiated by N-methyl-N'-nitro-N-nitrosoguanidine and promoted by mezerein. Mol Carcinog 2000;27:298–307.[CrossRef][Medline]
  28. Bohlander SK, Espinosa R III, Le Beau MM, Rowley JD, Diaz MO. A method for the rapid sequence-independent amplification of microdissected chromosomal material. Genomics 1992;13:1322–4.[CrossRef][Medline]
  29. Brasaemle DL, Barber T, Wolins NE, Serrero G, Blanchette-Mackie EJ, Londos C. Adipose differentiation-related protein is an ubiquitously expressed lipid storage droplet-associated protein. J Lipid Res 1997;38:2249–63.[Abstract]
  30. Quintanilla M, Brown K, Ramsden M, Balmain A. Carcinogen-specific mutation and amplification of Ha-ras during mouse skin carcinogenesis. Nature 1986;322:78–80.[Medline]
  31. Niemann C, Unden AB, Lyle S, Zouboulis Ch C, Toftgard R, Watt FM. Indian hedgehog and ß-catenin signaling: role in the sebaceous lineage of normal and neoplastic mammalian epidermis. Proc Natl Acad Sci U S A 2003;100 Suppl 1:11873–80.[Abstract/Free Full Text]
  32. Wilson JB, Weinberg W, Johnson R, Yuspa S, Levine AJ. Expression of the BNLF-1 oncogene of Epstein-Barr virus in the skin of transgenic mice induces hyperplasia and aberrant expression of keratin 6. Cell 1990;61:1315–27.[CrossRef][Medline]
  33. Niemann C, Owens DM, Hulsken J, Birchmeier W, Watt FM. Expression of DeltaNLef1 in mouse epidermis results in differentiation of hair follicles into squamous epidermal cysts and formation of skin tumours. Development 2002;129:95–109.[Abstract/Free Full Text]
  34. Jones SE, Jomary C. Secreted Frizzled-related proteins: searching for relationships and patterns. Bioessays 2002;24:811–20.[CrossRef][Medline]
  35. Alonso L, Fuchs E. Stem cells in the skin: waste not, Wnt not. Genes Dev 2003;17:1189–200.[Free Full Text]
  36. Weidinger G, Moon RT. When Wnts antagonize Wnts. J Cell Biol 2003;162:753–5.[Abstract/Free Full Text]
  37. He TC, Sparks AB, Rago C, et al. Identification of c-MYC as a target of the APC pathway. Science 1998;281:1509–12.[Abstract/Free Full Text]
  38. Rivat C, Le Floch N, Sabbah M, et al. Synergistic cooperation between the AP-1 and LEF-1 transcription factors in activation of the matrilysin promoter by the src oncogene: implications in cellular invasion. FASEB J 2003;17:1721–3.[Abstract/Free Full Text]
  39. Nateri AS, Spencer-Dene B, Behrens A. Interaction of phosphorylated c-Jun with TCF4 regulates intestinal cancer development. Nature 2005;437:281–5.[CrossRef][Medline]
  40. Hwang SG, Yu SS, Lee SW, Chun JS. Wnt-3a regulates chondrocyte differentiation via c-Jun/AP-1 pathway. FEBS Lett 2005;579:4837–42.[Medline]
  41. Le Floch N, Rivat C, De Wever O, et al. The proinvasive activity of Wnt-2 is mediated through a noncanonical Wnt pathway coupled to GSK-3ß and c-Jun/AP-1 signaling. FASEB J 2005;19:144–6.[Abstract/Free Full Text]
  42. Hayakawa J, Mittal S, Wang Y, et al. Identification of promoters bound by c-Jun/ATF2 during rapid large-scale gene activation following genotoxic stress. Mol Cell 2004;16:521–35.[CrossRef][Medline]
  43. Passegue E, Jochum W, Behrens A, Ricci R, Wagner EF. JunB can substitute for Jun in mouse development and cell proliferation. Nat Genet 2002;30:158–66.[CrossRef][Medline]
  44. Zenz R, Eferl R, Kenner L, et al. Psoriasis-like skin disease and arthritis caused by inducible epidermal deletion of Jun proteins. Nature 2005;437:369–75.[CrossRef][Medline]
  45. Thompson EJ, MacGowan J, Young MR, Colburn N, Bowden GT. A dominant negative c-jun specifically blocks okadaic acid-induced skin tumor promotion. Cancer Res 2002;62:3044–7.[Abstract/Free Full Text]
  46. Sundberg JP, Erickson AA, Roop DR, Binder RL. Ornithine decarboxylase expression in cutaneous papillomas in SENCAR mice is associated with altered expression of keratins 1 and 10. Cancer Res 1994;54:1344–51.[Abstract/Free Full Text]
  47. Mann B, Gelos M, Siedow A, et al. Target genes of ß-catenin-T cell-factor/lymphoid-enhancer-factor signaling in human colorectal carcinomas. Proc Natl Acad Sci U S A 1999;96:1603–8.[Abstract/Free Full Text]
  48. van den Brink GR, Bleuming SA, Hardwick JC, et al. Indian Hedgehog is an antagonist of Wnt signaling in colonic epithelial cell differentiation. Nat Genet 2004;36:277–82.[CrossRef][Medline]
  49. Li W, Qiao W, Chen L, et al. Squamous cell carcinoma and mammary abscess formation through squamous metaplasia in Smad4/Dpc4 conditional knockout mice. Development 2003;130:6143–53.[Abstract/Free Full Text]
  50. Hope KJ, Jin L, Dick JE. Acute myeloid leukemia originates from a hierarchy of leukemic stem cell classes that differ in self-renewal capacity. Nat Immunol 2004;5:738–43.[CrossRef][Medline]
  51. Al-Hajj M, Becker MW, Wicha M, Weissman I, Clarke MF. Therapeutic implications of cancer stem cells. Curr Opin Genet Dev 2004;14:43–7.[CrossRef][Medline]
  52. Dontu G, Al-Hajj M, Abdallah WM, Clarke MF, Wicha MS. Stem cells in normal breast development and breast cancer. Cell Prolif 2003;36 Suppl 1:59–72.[CrossRef][Medline]
  53. Gerdes M, Yuspa S. The contribution of epidermal stem cells to skin cancer. Stem Cell Reviews 2005;1:225–32.[Medline]
  54. Dor Y, Brown J, Martinez OI, Melton DA. Adult pancreatic ß-cells are formed by self-duplication rather than stem-cell differentiation. Nature 2004;429:41–6.[CrossRef][Medline]



This article has been cited by other articles:


Home page
Mol Cancer ResHome page
J. Rozenberg, V. Rishi, A. Orosz, J. Moitra, A. Glick, and C. Vinson
Inhibition of CREB Function in Mouse Epidermis Reduces Papilloma Formation
Mol. Cancer Res., May 1, 2009; 7(5): 654 - 664.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Durchdewald, J. Guinea-Viniegra, D. Haag, A. Riehl, P. Lichter, M. Hahn, E. F. Wagner, P. Angel, and J. Hess
Podoplanin Is a Novel Fos Target Gene in Skin Carcinogenesis
Cancer Res., September 1, 2008; 68(17): 6877 - 6883.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
K. S. Suh, M. Mutoh, T. Mutoh, L. Li, A. Ryscavage, J. M. Crutchley, R. A. Dumont, C. Cheng, and S. H. Yuspa
CLIC4 mediates and is required for Ca2+-induced keratinocyte differentiation
J. Cell Sci., August 1, 2007; 120(15): 2631 - 2640.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
W. J. Oh, V. Rishi, A. Orosz, M. J. Gerdes, and C. Vinson
Inhibition of CCAAT/Enhancer Binding Protein Family DNA Binding in Mouse Epidermis Prevents and Regresses Papillomas
Cancer Res., February 15, 2007; 67(4): 1867 - 1876.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gerdes, M. J.
Right arrow Articles by Vinson, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gerdes, M. J.
Right arrow Articles by Vinson, C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online