| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Cell, Tumor, and Stem Cell Biology |
1 Vanderbilt Ingram Cancer Center and Department of Cancer Biology, 2 Department of Biomedical Informatics, and Divisions of 3 Nephrology and 4 Hematology/Oncology, Department of Medicine, Vanderbilt University, Nashville, Tennessee; and 5 Department of Pharmacology and 6 Barbara Ann Karmanos Cancer Institute, Wayne State University, Detroit, Michigan
Requests for reprints: Lynn M. Matrisian, Department of Cancer Biology, Vanderbilt University, 771 PRB, 2220 Pierce Avenue, Nashville, TN 37232-6840. Phone: 615-322-0375; Fax: 615-963-2911; E-mail: Lynn.Matrisian{at}vanderbilt.edu.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To identify host- and tumor-derived proteases in models of cancer, we have used a customized Affymetrix protease microarray (Hu/Mu ProtIn chip).7 Traditional microarrays using RNA from whole tumors cannot distinguish if genes are expressed from tumor cells or surrounding host cells, such as fibroblasts, endothelial cells, or inflammatory cells. The Hu/Mu ProtIn chip was designed to distinguish mouse and human proteases and protease inhibitors by generating oligonucleotides specific for either mouse or human genes. By using a xenograft approach, in which human tumor cells are injected into a mouse, the Hu/Mu ProtIn chip allows the identification of genes transcribed by the tumor (human) and the host (mouse). The Hu/Mu ProtIn chip allows us to better understand the cross-talk between proteases in the tumor and the surrounding microenvironment. The Hu/Mu ProtIn chip contains many known families of proteases, including serine, cysteine, and metalloproteinases, as well as endogenous protease inhibitors, such as serpins, cystatins, and tissue inhibitor of metalloproteinases, allowing exploration of the balance between proteases and protease inhibitors that influence tumor progression (1).
To examine protease expression in the appropriate microenvironment in lung cancer, we developed an orthotopic model of lung cancer, where human lung cancer cells are injected directly into the mouse lung via the trachea. We have identified host-derived proteases that are differentially expressed in response to the tumor in our orthotopic model and tumor-derived proteases that are differentially expressed in response to the host. We did further studies to examine a functional role of host-derived matrix metalloproteinase (MMP)-12 and have shown that host MMP-12 exerts a protective influence on the growth of tumors in the lung.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Animals. Rag-2-null mice in a C57BL/6 background were obtained from Taconic Laboratories (Germantown, NY) and maintained in pathogen-free conditions receiving autoclaved food and water. Rag-2 mice were selected for these studies due to their lack of mature B and T lymphocytes and suitability for transplantation studies. Remaining natural killer cells were eliminated by nonlethal irradiation with 400 rad/mouse using a cesium 
source. MMP-12-null mice in a C57BL/6 background and C57BL/6 wild-type (WT) control mice were obtained from The Jackson Laboratory (Bar Harbor, ME). Mice were used at 6 weeks of age for the studies. The animals were maintained in accordance with the guidelines of the Committee for Protection of Animal Subjects at Vanderbilt University.
Orthotopic model. Six-week-old Rag-2-null mice were irradiated before injection of 1 x 106 GFP-labeled A549 cells into the lung via the trachea. The intratracheal injection, modified from McLemore et al. (8), is done using a 1-inch piece of Tygon microbore tubing (0.76 mm outer diameter) attached to a 2-inch 27-gauge blunt-end needle. A small incision is made in the neck of the mouse and in the trachea, and the tubing is carefully inserted. Tumor cells (1 x 106/100 µL PBS) are injected into the bronchus. The incision in the skin is closed by wound clips. A primary tumor in the right lung of the mouse is established after 6 weeks and confirmed by examining GFP expression under an Axioplan 2 imaging microscope (Zeiss, Thornwood, NY). Sham-operated mice injected with PBS alone were used as controls.
Lung colonization assay. At 6 weeks of age, 3 x 105 LLCs were injected into the tail vein of either MMP-12-null or C57BL/6 WT mice. After 2 weeks, the mice were sacrificed and surface lung tumors were counted and measured using digital calipers.
RNA extraction. Tumor and control lungs were extracted and submerged in RNA later for 24 hours. RNA was isolated using Trizol (Invitrogen, Carlsbad, CA) followed by cleaning using RNeasy Mini kit with the addition of DNase treatment according to the manufacturer's instructions (Qiagen, Valencia, CA).
Microarray experiments. RNA samples were assayed for integrity using Agilent Bioanalyzer microfluidic assay (Agilent Technologies, Palo Alto, CA). Spectrophotometry as well as fluorometry using the DNA-specific stain Hoechst 33258 were done to quantitate the nucleic acid samples and assess the amount of DNA that was contributing to the observed absorbance. This allowed a more rigorous assessment of the samples compared with spectrophotometry alone. Following quality control, the RNA was prepared for microarray analysis using the standard Affymetrix protocol (Affymetrix, Inc., Santa Clara, CA). Briefly, a total of 5 µg of total RNA were reverse transcribed to double-stranded cDNA using an oligo(dT) primer coupled to a T7 promoter. In vitro transcription from the double-stranded cDNA was carried out using T7 polymerase incorporating biotin-modified CTP and UTP ribonucleotides. The biotinylated cRNA (15 µg) was fragmented and hybridized to a customized Affymetrix protease microarray containing 979 human and mouse genes.7 Hybridized cRNA was detected using streptavidin coupled to phycoerythrin and visualized using a laser scanner. The image data were quantified to generate gene expression values and ratios of gene expression between the hybridized samples. CEL files were imported into GeneSpring 7.0 (Silicon Genetics, Redwood City, CA) and transformed by Robust Multichip Analysis (RMA; ref. 9). Data are presented using "absent," "marginal," and "present" calls or as relative values. Genes detected as 
2-fold up-regulated or down-regulated in at least two of three samples were identified. In the analysis of genes that were present in our samples, we found 
2% cross-reactivity between human and mouse genes. Affymetrix data from analysis of 21 human lung adenocarcinoma samples obtained from David Carbone (Vanderbilt University) using the U133 Plus 2.0 Affymetrix microarray were also normalized by RMA and compared with an average baseline of 8 samples of apparently normal nontumor lung from lung cancer patients to obtain ratios of gene expression (10).
Real-time PCR. For quantitative analysis, total RNA extracted was reverse transcribed using an iScript cDNA Synthesis kit (Applied Biosystems, Foster City, CA). Resulting cDNA was subjected to real-time reverse transcription-PCR (RT-PCR) using an ABI iCycler iQ system (Applied Biosystems). MMP-12 and MMP-13 primers were purchased from SuperArray (Frederick, MD; proprietary primers, sequence not disclosed). Sequences of primers were as follows: cathepsin K, 5'-GACCGTGATAATGTGAACC-3' (forward) and 5'-CAGGCGTTGTTCTTATTCC-3' (reverse); cystatin SN, 5'-ATAACGCAGACCTCAATGATG-3' (forward) and 5'-TTGCCTGGCTCTTAGTACC-3' (reverse); cystatin C, 5'-CAACTGCCCCTTCCATGACC-3' (forward) and 5'-CGTCCTGACAGGTGGATTTCG-3' (reverse); serpin A1, 5'-AAGGCTTCCAGGAACTCC-3' (forward) and 5'-AACTTATCCACTAGCTTCAGG-3' (reverse); human glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 5'-CATGTTCCAATATGATTCCAC-3' (forward) and 5'-CCTGGAAGATGGTGATG-3' (reverse); and mouse GAPDH, 5'-GCCTTCCGTGTTCCTACC-3' (forward) and 5'-CCTGGTCCTCAGTGTAGC-3' (reverse). PCR was carried out in 12.5 µL reaction volume using iQ SYBR Green Supermix (Applied Biosystems) using a standard two-step amplification with an annealing temperature of 55°C. Melt curves and gradients were run to ensure optimal PCR conditions and specificity. All genes were quantitated based on a standard curve with an arbitrary copy number of 1,000,000 copies in undiluted sample. For these reactions, a tumor sample was used to create a standard curve. A ratio was calculated for the average copy number of experimental transcripts per average number of GAPDH transcripts for each sample. A ratio was then calculated of the degree of change between individual experimental samples and the average control sample. For human genes, the ratio was calculated as the ratio of tumor gene/tumor GAPDH to A549 cells gene/A549 cells GAPDH. For mouse transcripts, the ratio was calculated as the ratio of tumor gene/tumor GAPDH to control lung gene/control lung GAPDH.
Northern blot. Total RNA was isolated as described above. Total RNA (10 µg) was loaded and separated in a 1% formaldehyde agarose gel and transferred to a nitrocellulose membrane. The membrane was hybridized with 32P-labeled cDNA probes labeled using Random Primed DNA Labeling kit (Roche, Basel, Switzerland). After washing, membranes were exposed to Kodak (Rochester, NY) autoradiography film. The mouse MMP-12 probe was generated using PCR primers TGAAGGGTGCTTGCTGGTTTT (sense) and TTACAGATAAACCAGTTGGCCTCTG (antisense).
Immunohistochemistry. Human tumor samples were obtained from the Vanderbilt Ingram Cancer Center's tissue core (Vanderbilt University). Mouse tissues were formalin fixed and paraffin embedded for immunohistochemical analysis. Sections were dewaxed in xylene and rehydrated in ethanol and TBS, and antigen retrieval was done using 100 mmol/L sodium citrate (pH 6.0). Rabbit anti-MMP-12 (1:1,000) was purchased from Triple Point Biologics (Forest Grove, OR). Rat monoclonal anti-F4/80 (1:100) was purchased from Serotec, Inc. (Raleigh, NC). Appropriate species specific IgG was used as a negative control. Sections were then incubated with appropriate secondary biotin-labeled IgG (Vector Laboratories, Burlingame, CA), and immunoreactivity was detected using avidin-biotin complex method Elite kit (Vector Laboratories) using 3,3'-diaminobenzidine as the substrate. Sections were counterstained with Mayer's hematoxylin. Freshly dissected tumors grown on the lung surface of WT and MMP-12-null mice were embedded in OCT compound and frozen at –80°C. Frozen tumor sections (5 µm) were stained with anti-mouse CD31 antibody (PharMingen, San Diego, CA) followed by rhodamine isothiocyanate–conjugated goat anti-rat antibody. Degree of vascularization, expressed as percentage of area occupied by CD31-positive structures/microscopic field, was evaluated using Scion Image software (Scion, Frederick, MD).
Western blot analysis. To analyze angiostatin levels, plasma from tumor-bearing mice was precleared with a mixture of protein A/G-Sepharose beads. Total plasma protein (50 µg) was loaded on 10% SDS-PAGE and run under nonreducing conditions. The gel was transferred onto a nitrocellulose membrane and incubated with a purified mouse monoclonal antibody recognizing mouse angiostatin (11). Angiostatin was visualized with a peroxidase-conjugated goat anti-mouse antibody and enhanced chemiluminescence kit (Pierce, Rockford, IL). The experiment was repeated twice, and densitometry was done using Alpha Imager 2000 (Alpha Innotech, San Leandro, CA).
Statistical analysis. Microarray data were analyzed using GeneSpring software. Tumor numbers and sizes from experimental metastasis assays were analyzed using an unpaired t test.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2-fold up-regulated in the tumor compared with the control lung. Genes depicted in blue are those genes that are 2-fold down-regulated in the tumor compared with the control lung. Genes depicted in yellow show no change >2-fold in the tumor compared with the control lung. The scatter plot illustrates an average of the three tumor samples versus an average of the three control samples. There are three mouse genes, MMP-12, MMP-13, and cathepsin K, which showed a 2-fold increase in expression in at least two of the three tumor samples compared with the control lung (highlighted in Fig. 2A). Because these genes are mouse derived, the expression of these genes originated from the host component of the tumor. The fold increase in expression of these genes in each of the three tumors examined relative to the average of the control lung samples is shown in Fig. 3
. These genes are either not detected (MMP-13) or present (cathepsin K and MMP-12) in the control lung but are significantly up-regulated by an average of 3.5-, 4.4-, and 24.3-fold, respectively, in the tumor.
|
|
|
Tumor-derived cystatin SN, cystatin C, serpin A1, and adipsin show increased expression in the tumor from the orthotopic model compared with A549 cells in culture. A distribution of gene expression from a comparison of all human and mouse genes present in the tumor versus the A549 cells in culture is shown in Fig. 2B. Genes depicted in red are those genes that are 2-fold up-regulated in the tumor compared with the A549 cells in culture. Genes depicted in blue are those genes that are 2-fold down-regulated in the tumor compared with the A549 cells in culture. Genes depicted in yellow show no change >2-fold in the tumor compared with the A549 cells in culture. The scatter plot illustrates an average of the three tumor samples versus an average of the two control samples. The majority of the genes that are up-regulated are mouse genes because the A549 cells contain no mouse genes and were compared with the tumor that contains both host-derived mouse genes and tumor-derived human genes. The human genes that are up-regulated in the tumor are highlighted in the plot. The human cysteine protease inhibitors cystatin SN and cystatin C, the serine protease inhibitor serpin A1 (
-1-antitrypsin), and the serine protease adipsin (complement factor D, EC3.4.21.46) were up-regulated 2-fold in at least two of three tumor samples compared with the A549 cells in culture. Cystatin SN and serpin A1 are absent in the A549 cells in culture and up-regulated an average of 37.1- and 2.6-fold, respectively, in the tumor. Cystatin C and adipsin are present in the A549 cells in culture but are up-regulated an average of 2.0- and 3.2-fold, respectively, in the tumor.
There was 2% cross-reactivity among the samples; therefore, a few human genes were found to be present in the mouse lung and a few mouse genes were found to be present in the human tumor cells. Importantly, none of the genes mentioned as differentially expressed cross-reacted in our samples (i.e., no human samples analyzed with this chip showed expression of MMP-12, MMP-13, or cathepsin K).
Real-time PCR analysis confirms up-regulation of genes identified by microarray. Real-time quantitative PCR analysis confirmed the up-regulation of mouse genes MMP-12, MMP-13, and cathepsin K in the tumor samples compared with control lung with levels ranging from a 5-fold to >100-fold increase (Fig. 2C). The up-regulation of the human genes cystatin SN, cystatin C, and serpin A1 in the tumor samples compared with the A549 cells in culture was also confirmed using real-time PCR analysis with levels ranging from 5-fold to >1,000-fold increase (Fig. 2C). Adequate primers to distinguish mouse versus human adipsin could not be generated.
Correlation of increased expression of MMP-12, MMP-13, and cathepsin K in orthotopic model and human lung adenocarcinoma samples. RNA from 21 human lung adenocarcinoma samples was previously analyzed using the Affymetrix U133 Plus 2.0 chip (10). Mining of this data indicated that MMP-12, MMP-13, and cathepsin K were overexpressed in at least a subset of human samples, consistent with the results obtained with the orthotopic model (Fig. 3).
In the human samples, all 21 of the lung adenocarcinomas showed an increase in MMP-12 expression compared with normal lung ranging from a 24-fold to a 106-fold increase in expression. The orthotopic model showed 13.6-, 28.0-, and 37.6-fold increase in expression for MMP-12 in the three tumors examined compared with the average values for the control lung. MMP-13 was overexpressed in a subset of 6 of 21 human lung tumor samples 20-fold, with the remaining samples having no significant change in expression. The orthotopic model showed a similar distribution, with 1.4-, 4.7-, and 6.4-fold increase in expression compared with control lung. Cathepsin K was increased from 1.3- to 5-fold in the human lung tumors and 3.1-, 4.9-, and 5.8-fold in the orthotopic model.
Of the human genes up-regulated in the tumor from the orthotopic model versus the A549 cells in culture (Fig. 2B), cystatin SN was also increased 2-fold in 15 of 21 human lung adenocarcinomas compared with control lung. Cystatin SN showed the most increase in expression in the model of up to 45-fold. Only 2 of 21 human lung adenocarcinomas showed a 2-fold increase in expression of cystatin C compared with normal lung. Serpin A1 and adipsin showed no change in expression or a decrease in expression in the human lung adenocarcinoma tumors compared with normal lung. Thus, we did not observe a strong correlation between the human genes identified in the model as up-regulated in the tumor compared with the A549 cells in culture and human lung adenocarcinoma samples. The changes in gene expression in the tumor compared with cells in culture may be an artifact of tissue culture conditions or a change due to growth in a three-dimensional environment.
From the analysis of the human lung adenocarcinomas using the Affymetrix U133 2.0 Plus array, we also found other proteases, including members of the MMP and cysteine cathepsin families, which were up-regulated in the human tumors compared with normal lung but which we did not observe in our xenograft model. These genes may be expressed by the tumor cells and not the surrounding stroma and would not be identified by examining mouse genes up-regulated in the model. The protease array identified some mouse MMPs that were detected as being present in the tumor but were not up-regulated compared with normal lung. For example, MMP-1, MMP-7, MMP-9, MMP-10, MMP-11, and MMP-14 were up-regulated in the human tumors, and of these, murine MMP-9, MMP-11, and MMP-14 were also identified as being present in the tumor samples from the model. The model therefore identified a specific subset of stromally up-regulated genes and did not recapitulate all aspects of human lung adenocarcinoma samples.
Expression and role of MMP-12 in lung adenocarcinomas. To determine if the Hu/Mu ProtIn chip provided information relevant to the biology of tumors, we focused on one of the induced host genes, MMP-12. Increased expression of MMP-12 mRNA is a predictor of good outcome in human colorectal cancer (12) and hepatocellular carcinoma (13). However, in non–small cell lung cancer (NSCLC), MMP-12 expression is associated with local recurrence and metastatic disease (14).
The same RNA samples used in the microarray analysis were first analyzed by Northern blot for MMP-12 expression. Northern blot analysis confirms increased RNA expression of MMP-12 in the tumor compared with normal lung (Fig. 4A ). Increased levels of mouse MMP-12 are shown at 1.8 kb in two of the tumor samples with very low levels of MMP-12 in the control lungs. The Northern blot analysis validates the results from the array, in which mouse RNA levels of MMP-12 are increased in the lungs with tumor compared with the control lungs.
|
To determine if host-derived MMP-12 has a functional role in lung tumor formation, we did experimental metastasis assays in MMP-12-null and WT mice. LLCs (3 x 105) were injected into the tail vein of either control or MMP-12-null mice. After 2 weeks, surface lung tumors were counted and measured. Two independent experiments were done revealing similar results. There was no difference in tumor number in control and MMP-12-null mice (data not shown). However, MMP-12-null mice showed a 2- to 3-fold increase in the number of tumors that were 2 mm compared with control mice for both experiments (P = 0.047 and 0.001; Fig. 5A
). This observation is consistent with a reference to unpublished results suggesting MMP-12 limits lung metastasis growth in a LLC model (15). MMP-12-null mice have shown an impairment of macrophage infiltration into basement membrane in vivo (16). However, we found a similar number of macrophages in control and MMP-12-null mice in tumor-bearing lungs (data not shown), suggesting that macrophage infiltration is not impaired in our model.
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2-fold up-regulated in the tumor. These same genes were similarly up-regulated in human tumors compared with normal lung. By immunohistochemical analysis, we confirmed stromal expression of MMP-12 in samples of human lung adenocarcinomas. These results suggest that the application of the Hu/Mu ProtIn chip in a xenograft model is useful to identify host proteases that are induced in response to a tumor and guide further experimentation to determine the contribution of these enzymes to tumor progression. Based on the robust up-regulation of stromal MMP-12 in the orthotopic model of lung cancer and the confirmation that MMP-12 is significantly overexpressed in human lung adenocarcinomas, we undertook studies to examine the effect of stromal MMP-12 on lung tumor development and growth using the experimental metastasis assay. In contrast to the prevailing view that MMPs contribute to tumor progression, the absence of host MMP-12 caused an increase in tumor size compared with control lung, indicating that MMP-12 has a protective role in lung tumor formation. These results are consistent with reports that MMP-12 expression correlates with better overall survival in colorectal (12) and hepatocellular (13) carcinomas. However, recently, Hofmann et al. (14) reported that MMP-12 expression correlates with local recurrence and metastatic disease in NSCLC patients. The protumorigenic versus antitumorigenic effect of MMP-12 on tumor progression may be tumor type specific. However, it may also be important to distinguish between the expression of MMP-12 in tumor versus stromal cells. In squamous cell carcinoma of the vulva, MMP-12 expression in macrophages was shown to correlate with well-differentiated tumors, whereas MMP-12 expression in tumor cells correlated with a more aggressive histology (20). The distinction between tumor expression and host response to tumor seems to be critical in evaluating the effect of proteases on tumor progression and supports the development of tools, such as the Hu/Mu ProtIn microarray to assist in making this distinction.
The absence of stromal MMP-12 resulted in the development of larger lung tumors (>2 mm diameter), although there was no difference in the number of nodules in MMP-12-null and control mice. These results suggested that MMP-12 may influence the angiogenic switch that is necessary to allow the growth of tumors to a size that can no longer be supported by the diffusion of nutrients from existing vasculature. We observed more CD31-positive blood vessels in the MMP-12-null mice compared with WT, suggesting that, in the absence of MMP-12, angiogenesis supports the formation of larger tumors at this time point in our model. We also observed a decrease in the levels of the K1-K4 form of angiostatin, an endogenous angiogenesis inhibitor that is generated by the cleavage of plasminogen by a variety of proteases, including MMP-12 (18). In hepatocellular carcinoma, MMP-12 expression correlated with better overall survival and was associated with the generation of angiostatin (13). Our results suggest that MMP-12 may generate the K1-K4 species of angiostatin, which may contribute to its antiangiogenic function similar to the K1-K3 species of angiostatin. We also found an up-regulation of host-derived MMP-13 in tumors from the orthotopic model compared with control lung. MMP-13 has shown to be expressed in the stroma of 87% of human NSCLC samples (21). The functional significance of the overexpression of MMP-13 in lung tumors remains unknown. In vitro studies have shown that MMP-13 induces migration of alveolar epithelium on type I collagen and impairs attachment, suggesting that MMP-13 may play a role in alveolar epithelial repair or possibly lung tumor cell invasion or migration (22).
Little is known about the role of the cysteine protease cathepsin K in lung cancer, which we also found to be up-regulated in lung tumors compared with normal lung both in the orthotopic model and in human lung tumors by microarray analysis. Cathepsin K RNA levels have been reported to be higher in human lung tumors compared with normal lung by RT-PCR analysis (23). Cathepsin K is capable of degrading components of the ECM, including collagen type I, II, and IV, as well as elastin at neutral pH (24). Cathepsin K expression is found in the fibroblasts of patients with fibrotic lungs, and experiments in cathepsin K–null mice revealed that cathepsin K can prevent lung fibrosis in bleomycin-treated mice by contributing to ECM turnover (25). Future studies to determine if the increased host expression of cathepsin K that we observed in our model is also contributing to lung tumor formation would be of interest.
An imbalance between proteases and their inhibitors has been thought to contribute to cancer (1). Therefore, it was not surprising to also find differential expression of protease inhibitors in the lung tumors from the orthotopic model. However, of the four genes identified as overexpressed in the orthotopic model compared with A549 cells in culture, cystatin SA was the only one that was consistently up-regulated in the human tumor samples. The role of cystatin SA in lung cancer has not been examined, but other cystatins have been reported to be expressed in lung cancer (26). It is likely that the lack of predictability in identifying proteases or inhibitors that are overexpressed in the tumor is, at least in part, the result of comparing the genes expressed in the tumor with the profile of tumor cells in culture rather than with the normal human lung. In addition, only one cell line was used in the mouse model, which is not representative of the heterogeneity of human adenocarcinomas. The use of a variety of NSCLC cell lines may result in a more representative protease/inhibitor expression profile.
We showed that the Hu/Mu ProtIn chip, which distinguishes human- and mouse-derived proteases and protease inhibitors, is a useful tool to identify tumor- and host-derived molecules important to tumor growth and progression. We have added stromal MMP-12 to the growing list of metalloproteinases that have now been shown to exert a protective role on tumor progression (27–30). With the development of a variety of protease inhibitors to treat clinical diseases, studies, such as these, are necessary to narrow down the specificity required for inhibition of tumor progression.
|
Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
|
Footnotes |
|---|
Received 11/30/05. Revised 6/ 6/06. Accepted 6/21/06.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1-null mice. Clin Exp Metastasis 2005;22:185–93.[CrossRef][Medline]1 knockout mice cause reduced tumor vascularization. Proc Natl Acad Sci U S A 2000;97:2202–7.3 chain, are generated by MMP9 proteolysis and suppress angiogenesis via Vß3 integrin. Cancer Cell 2003;3:589–601.[CrossRef][Medline]This article has been cited by other articles:
|
|
 |
|
  R. Roy, J. Yang, and M. A. Moses Matrix Metalloproteinases As Novel Biomarkers and Potential Therapeutic Targets in Human Cancer J. Clin. Oncol., November 1, 2009; 27(31): 5287 - 5297. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Podgorski, B. E. Linebaugh, J. E. Koblinski, D. L. Rudy, M. K. Herroon, M. B. Olive, and B. F. Sloane Bone Marrow-Derived Cathepsin K Cleaves SPARC in Bone Metastasis Am. J. Pathol., September 1, 2009; 175(3): 1255 - 1269. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. M. McGowan and M. J. Duffy Matrix metalloproteinase expression and outcome in patients with breast cancer: analysis of a published database Ann. Onc., September 1, 2008; 19(9): 1566 - 1572. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. L. Hull, C. R. Escareno, J. M. Godsland, J. R. Doig, C. M. Johnson, S. C. Phillips, S. K. Smith, S. Tavare, C. G. Print, and D. S. Charnock-Jones Endometrial-Peritoneal Interactions during Endometriotic Lesion Establishment Am. J. Pathol., September 1, 2008; 173(3): 700 - 715. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Gutierrez-Fernandez, A. Fueyo, A. R. Folgueras, C. Garabaya, C. J. Pennington, S. Pilgrim, D. R. Edwards, D. L. Holliday, J. L. Jones, P. N. Span, et al. Matrix Metalloproteinase-8 Functions as a Metastasis Suppressor through Modulation of Tumor Cell Adhesion and Invasion Cancer Res., April 15, 2008; 68(8): 2755 - 2763. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Llamazares, A. J. Obaya, A. Moncada-Pazos, R. Heljasvaara, J. Espada, C. Lopez-Otin, and S. Cal The ADAMTS12 metalloproteinase exhibits anti-tumorigenic properties through modulation of the Ras-dependent ERK signalling pathway J. Cell Sci., October 15, 2007; 120(20): 3544 - 3552. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. R. Schwartz, K. Moin, B. Yao, L. M. Matrisian, L. M. Coussens, T. H. Bugge, B. Fingleton, H. B. Acuff, M. Sinnamon, H. Nassar, et al. Hu/Mu ProtIn Oligonucleotide Microarray: Dual-Species Array for Profiling Protease and Protease Inhibitor Gene Expression in Tumors and Their Microenvironment Mol. Cancer Res., May 1, 2007; 5(5): 443 - 454. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
, MMP-12; 
, cathepsin K.
