Cancer Research Cancer Epigenetics EMT and Cancer Progression and Treatment
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Acuff, H. B.
Right arrow Articles by Matrisian, L. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Acuff, H. B.
Right arrow Articles by Matrisian, L. M.
[Cancer Research 66, 7968-7975, August 15, 2006]
© 2006 American Association for Cancer Research

Cell, Tumor, and Stem Cell Biology

Analysis of Host- and Tumor-Derived Proteinases Using a Custom Dual Species Microarray Reveals a Protective Role for Stromal Matrix Metalloproteinase-12 in Non–Small Cell Lung Cancer

Heath B. Acuff1, Mark Sinnamon1, Barbara Fingleton1, Braden Boone1, Shawn E. Levy2, Xiwu Chen3, Ambra Pozzi1,3, David P. Carbone1,4, Donald R. Schwartz6, Kamiar Moin5,6, Bonnie F. Sloane5,6 and Lynn M. Matrisian1

1 Vanderbilt Ingram Cancer Center and Department of Cancer Biology, 2 Department of Biomedical Informatics, and Divisions of 3 Nephrology and 4 Hematology/Oncology, Department of Medicine, Vanderbilt University, Nashville, Tennessee; and 5 Department of Pharmacology and 6 Barbara Ann Karmanos Cancer Institute, Wayne State University, Detroit, Michigan

Requests for reprints: Lynn M. Matrisian, Department of Cancer Biology, Vanderbilt University, 771 PRB, 2220 Pierce Avenue, Nashville, TN 37232-6840. Phone: 615-322-0375; Fax: 615-963-2911; E-mail: Lynn.Matrisian{at}vanderbilt.edu.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We used a customized Affymetrix protease microarray (Hu/Mu ProtIn chip) designed to distinguish human and mouse genes to analyze the expression of proteases and protease inhibitors in lung cancer. Using an orthotopic lung cancer model, we showed that murine matrix metalloproteinase (MMP)-12, MMP-13, and cathepsin K were up-regulated in tumor tissue compared with normal mouse lung. To determine the relevance of stromal proteases detected using this model system, we compared the results to an analysis of human lung adenocarcinoma specimens using the U133 Plus 2.0 Affymetrix microarray. MMP-12, MMP-13, and cathepsin K showed an increase in expression in human tumors compared with normal lung similar to that seen in the orthotopic model. Immunohistochemical analysis confirmed MMP-12 expression in the stroma of human lung tumor samples. To determine the biological relevance of stromal MMP-12, murine Lewis lung carcinoma cells were injected into the tail vein of syngeneic wild-type (WT) and MMP-12-null mice. MMP-12-null and WT mice developed equivalent numbers of lung tumors; however, there was a 2-fold increase in the number of tumors that reached >2 mm in diameter in MMP-12-null mice compared with WT controls. The increase in tumor size correlated with an increase in CD31-positive blood vessels and a decrease in circulating levels of the K1-K4 species of angiostatin. These results show a protective role for stromal MMP-12 in lung tumor growth. The use of the Hu/Mu ProtIn chip allows us to distinguish tumor- and host-derived proteases and guides the further analysis of the significance of these genes in tumor progression. (Cancer Res 2006; 66(16): 7968-75)


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Proteases both from tumor cells and the surrounding host stroma play an important role in facilitating cell-cell and cell-matrix interactions in the tumor microenvironment (1). These interactions from tumor- or host-derived proteases contribute to remodeling of the extracellular matrix (ECM) and tumor invasion (2). It has been shown that protease expression specific for the tumor or the surrounding host stroma can influence recurrence and patient survival in many tumor types (3). In addition, whether proteases are produced by the stroma or the tumor cells can influence the behavior of the tumor in animal models (4–6).

To identify host- and tumor-derived proteases in models of cancer, we have used a customized Affymetrix protease microarray (Hu/Mu ProtIn chip).7 Traditional microarrays using RNA from whole tumors cannot distinguish if genes are expressed from tumor cells or surrounding host cells, such as fibroblasts, endothelial cells, or inflammatory cells. The Hu/Mu ProtIn chip was designed to distinguish mouse and human proteases and protease inhibitors by generating oligonucleotides specific for either mouse or human genes. By using a xenograft approach, in which human tumor cells are injected into a mouse, the Hu/Mu ProtIn chip allows the identification of genes transcribed by the tumor (human) and the host (mouse). The Hu/Mu ProtIn chip allows us to better understand the cross-talk between proteases in the tumor and the surrounding microenvironment. The Hu/Mu ProtIn chip contains many known families of proteases, including serine, cysteine, and metalloproteinases, as well as endogenous protease inhibitors, such as serpins, cystatins, and tissue inhibitor of metalloproteinases, allowing exploration of the balance between proteases and protease inhibitors that influence tumor progression (1).

To examine protease expression in the appropriate microenvironment in lung cancer, we developed an orthotopic model of lung cancer, where human lung cancer cells are injected directly into the mouse lung via the trachea. We have identified host-derived proteases that are differentially expressed in response to the tumor in our orthotopic model and tumor-derived proteases that are differentially expressed in response to the host. We did further studies to examine a functional role of host-derived matrix metalloproteinase (MMP)-12 and have shown that host MMP-12 exerts a protective influence on the growth of tumors in the lung.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Cells. Green fluorescent protein (GFP)–expressing A549 cells were obtained from Ambra Pozzi (Vanderbilt University, Nashville, TN; ref. 7). Cells were cultured in F-12 Nutrient Mixture (Kaighn's modification) with 2 mmol/L L-glutamine (Life Technologies, Long Island, NY) supplemented with 1.5 g/L sodium bicarbonate, 10% FCS, and 400 µg/mL G418 at 37°C, 5% CO2. Lewis lung carcinoma cells (LLC) were obtained from Dr. John Caterina (Bethel College, McKenzie, TN) from a stock at the NIH. LLCs were cultured in DMEM (Life Technologies) supplemented with 10% fetal bovine serum (Atlanta Biologicals, Norcross, GA) at 37°C, 5% CO2.

Animals. Rag-2-null mice in a C57BL/6 background were obtained from Taconic Laboratories (Germantown, NY) and maintained in pathogen-free conditions receiving autoclaved food and water. Rag-2 mice were selected for these studies due to their lack of mature B and T lymphocytes and suitability for transplantation studies. Remaining natural killer cells were eliminated by nonlethal irradiation with 400 rad/mouse using a cesium {gamma} source. MMP-12-null mice in a C57BL/6 background and C57BL/6 wild-type (WT) control mice were obtained from The Jackson Laboratory (Bar Harbor, ME). Mice were used at 6 weeks of age for the studies. The animals were maintained in accordance with the guidelines of the Committee for Protection of Animal Subjects at Vanderbilt University.

Orthotopic model. Six-week-old Rag-2-null mice were irradiated before injection of 1 x 106 GFP-labeled A549 cells into the lung via the trachea. The intratracheal injection, modified from McLemore et al. (8), is done using a 1-inch piece of Tygon microbore tubing (0.76 mm outer diameter) attached to a 2-inch 27-gauge blunt-end needle. A small incision is made in the neck of the mouse and in the trachea, and the tubing is carefully inserted. Tumor cells (1 x 106/100 µL PBS) are injected into the bronchus. The incision in the skin is closed by wound clips. A primary tumor in the right lung of the mouse is established after 6 weeks and confirmed by examining GFP expression under an Axioplan 2 imaging microscope (Zeiss, Thornwood, NY). Sham-operated mice injected with PBS alone were used as controls.

Lung colonization assay. At 6 weeks of age, 3 x 105 LLCs were injected into the tail vein of either MMP-12-null or C57BL/6 WT mice. After 2 weeks, the mice were sacrificed and surface lung tumors were counted and measured using digital calipers.

RNA extraction. Tumor and control lungs were extracted and submerged in RNA later for 24 hours. RNA was isolated using Trizol (Invitrogen, Carlsbad, CA) followed by cleaning using RNeasy Mini kit with the addition of DNase treatment according to the manufacturer's instructions (Qiagen, Valencia, CA).

Microarray experiments. RNA samples were assayed for integrity using Agilent Bioanalyzer microfluidic assay (Agilent Technologies, Palo Alto, CA). Spectrophotometry as well as fluorometry using the DNA-specific stain Hoechst 33258 were done to quantitate the nucleic acid samples and assess the amount of DNA that was contributing to the observed absorbance. This allowed a more rigorous assessment of the samples compared with spectrophotometry alone. Following quality control, the RNA was prepared for microarray analysis using the standard Affymetrix protocol (Affymetrix, Inc., Santa Clara, CA). Briefly, a total of 5 µg of total RNA were reverse transcribed to double-stranded cDNA using an oligo(dT) primer coupled to a T7 promoter. In vitro transcription from the double-stranded cDNA was carried out using T7 polymerase incorporating biotin-modified CTP and UTP ribonucleotides. The biotinylated cRNA (15 µg) was fragmented and hybridized to a customized Affymetrix protease microarray containing 979 human and mouse genes.7 Hybridized cRNA was detected using streptavidin coupled to phycoerythrin and visualized using a laser scanner. The image data were quantified to generate gene expression values and ratios of gene expression between the hybridized samples. CEL files were imported into GeneSpring 7.0 (Silicon Genetics, Redwood City, CA) and transformed by Robust Multichip Analysis (RMA; ref. 9). Data are presented using "absent," "marginal," and "present" calls or as relative values. Genes detected as ≥2-fold up-regulated or down-regulated in at least two of three samples were identified. In the analysis of genes that were present in our samples, we found ~2% cross-reactivity between human and mouse genes. Affymetrix data from analysis of 21 human lung adenocarcinoma samples obtained from David Carbone (Vanderbilt University) using the U133 Plus 2.0 Affymetrix microarray were also normalized by RMA and compared with an average baseline of 8 samples of apparently normal nontumor lung from lung cancer patients to obtain ratios of gene expression (10).

Real-time PCR. For quantitative analysis, total RNA extracted was reverse transcribed using an iScript cDNA Synthesis kit (Applied Biosystems, Foster City, CA). Resulting cDNA was subjected to real-time reverse transcription-PCR (RT-PCR) using an ABI iCycler iQ system (Applied Biosystems). MMP-12 and MMP-13 primers were purchased from SuperArray (Frederick, MD; proprietary primers, sequence not disclosed). Sequences of primers were as follows: cathepsin K, 5'-GACCGTGATAATGTGAACC-3' (forward) and 5'-CAGGCGTTGTTCTTATTCC-3' (reverse); cystatin SN, 5'-ATAACGCAGACCTCAATGATG-3' (forward) and 5'-TTGCCTGGCTCTTAGTACC-3' (reverse); cystatin C, 5'-CAACTGCCCCTTCCATGACC-3' (forward) and 5'-CGTCCTGACAGGTGGATTTCG-3' (reverse); serpin A1, 5'-AAGGCTTCCAGGAACTCC-3' (forward) and 5'-AACTTATCCACTAGCTTCAGG-3' (reverse); human glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 5'-CATGTTCCAATATGATTCCAC-3' (forward) and 5'-CCTGGAAGATGGTGATG-3' (reverse); and mouse GAPDH, 5'-GCCTTCCGTGTTCCTACC-3' (forward) and 5'-CCTGGTCCTCAGTGTAGC-3' (reverse). PCR was carried out in 12.5 µL reaction volume using iQ SYBR Green Supermix (Applied Biosystems) using a standard two-step amplification with an annealing temperature of 55°C. Melt curves and gradients were run to ensure optimal PCR conditions and specificity. All genes were quantitated based on a standard curve with an arbitrary copy number of 1,000,000 copies in undiluted sample. For these reactions, a tumor sample was used to create a standard curve. A ratio was calculated for the average copy number of experimental transcripts per average number of GAPDH transcripts for each sample. A ratio was then calculated of the degree of change between individual experimental samples and the average control sample. For human genes, the ratio was calculated as the ratio of tumor gene/tumor GAPDH to A549 cells gene/A549 cells GAPDH. For mouse transcripts, the ratio was calculated as the ratio of tumor gene/tumor GAPDH to control lung gene/control lung GAPDH.

Northern blot. Total RNA was isolated as described above. Total RNA (10 µg) was loaded and separated in a 1% formaldehyde agarose gel and transferred to a nitrocellulose membrane. The membrane was hybridized with 32P-labeled cDNA probes labeled using Random Primed DNA Labeling kit (Roche, Basel, Switzerland). After washing, membranes were exposed to Kodak (Rochester, NY) autoradiography film. The mouse MMP-12 probe was generated using PCR primers TGAAGGGTGCTTGCTGGTTTT (sense) and TTACAGATAAACCAGTTGGCCTCTG (antisense).

Immunohistochemistry. Human tumor samples were obtained from the Vanderbilt Ingram Cancer Center's tissue core (Vanderbilt University). Mouse tissues were formalin fixed and paraffin embedded for immunohistochemical analysis. Sections were dewaxed in xylene and rehydrated in ethanol and TBS, and antigen retrieval was done using 100 mmol/L sodium citrate (pH 6.0). Rabbit anti-MMP-12 (1:1,000) was purchased from Triple Point Biologics (Forest Grove, OR). Rat monoclonal anti-F4/80 (1:100) was purchased from Serotec, Inc. (Raleigh, NC). Appropriate species specific IgG was used as a negative control. Sections were then incubated with appropriate secondary biotin-labeled IgG (Vector Laboratories, Burlingame, CA), and immunoreactivity was detected using avidin-biotin complex method Elite kit (Vector Laboratories) using 3,3'-diaminobenzidine as the substrate. Sections were counterstained with Mayer's hematoxylin. Freshly dissected tumors grown on the lung surface of WT and MMP-12-null mice were embedded in OCT compound and frozen at –80°C. Frozen tumor sections (5 µm) were stained with anti-mouse CD31 antibody (PharMingen, San Diego, CA) followed by rhodamine isothiocyanate–conjugated goat anti-rat antibody. Degree of vascularization, expressed as percentage of area occupied by CD31-positive structures/microscopic field, was evaluated using Scion Image software (Scion, Frederick, MD).

Western blot analysis. To analyze angiostatin levels, plasma from tumor-bearing mice was precleared with a mixture of protein A/G-Sepharose beads. Total plasma protein (50 µg) was loaded on 10% SDS-PAGE and run under nonreducing conditions. The gel was transferred onto a nitrocellulose membrane and incubated with a purified mouse monoclonal antibody recognizing mouse angiostatin (11). Angiostatin was visualized with a peroxidase-conjugated goat anti-mouse antibody and enhanced chemiluminescence kit (Pierce, Rockford, IL). The experiment was repeated twice, and densitometry was done using Alpha Imager 2000 (Alpha Innotech, San Leandro, CA).

Statistical analysis. Microarray data were analyzed using GeneSpring software. Tumor numbers and sizes from experimental metastasis assays were analyzed using an unpaired t test.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Host-derived MMP-12, MMP-13, and cathepsin K show increased expression in orthotopic model compared with control lung. An orthotopic model of lung cancer was established in immunodeficient Rag-2-null mice by injecting 1 x 106 GFP-labeled A549 cells/PBS into the mouse lung via the trachea (Fig. 1A ). After 6 weeks, a primary tumor develops in the right lung and metastasis to the mediastinal lymph nodes is also observed (Fig. 1B-D). RNA was collected from tumors established in the orthotopic model after 6 weeks in three separate mice and from the right lung of three sham control mice that were injected with PBS by the same method. RNA was also collected from the A549 cells in culture. RNA was applied to a customized Affymetrix protease microarray (Hu/Mu ProtIn chip). A distribution of gene expression from a comparison of all human and mouse genes present in the tumor versus the control lung is shown in Fig. 2A . Genes depicted in red are those genes that are ≥2-fold up-regulated in the tumor compared with the control lung. Genes depicted in blue are those genes that are ≥2-fold down-regulated in the tumor compared with the control lung. Genes depicted in yellow show no change >2-fold in the tumor compared with the control lung. The scatter plot illustrates an average of the three tumor samples versus an average of the three control samples. There are three mouse genes, MMP-12, MMP-13, and cathepsin K, which showed a ≥2-fold increase in expression in at least two of the three tumor samples compared with the control lung (highlighted in Fig. 2A). Because these genes are mouse derived, the expression of these genes originated from the host component of the tumor. The fold increase in expression of these genes in each of the three tumors examined relative to the average of the control lung samples is shown in Fig. 3 . These genes are either not detected (MMP-13) or present (cathepsin K and MMP-12) in the control lung but are significantly up-regulated by an average of 3.5-, 4.4-, and 24.3-fold, respectively, in the tumor.


Figure 1
View larger version (100K):
[in this window]
[in a new window]
  		Figure 1. Orthotopic model of NSCLC. A, illustration of the orthotopic model depicting intratracheal injection. Tumor cells are injected into the right lung via the trachea using a piece of Tygon microbore tubing attached to a 27-gauge blunt-end needle. B, arrow, tumor formed after 6 weeks in the right lung of a mouse from intratracheal injection of 1 x 106 A549 cells. C, histology of tumor in right lobe of mouse 6 weeks after intratracheal injection of 1 x 106 A549 cells (H&E). D, histology of metastasis of A549 cells to the mediastinal lymph nodes 6 weeks after intratracheal injection (H&E).

 

Figure 2
View larger version (18K):
[in this window]
[in a new window]
  		Figure 2. A, average change in expression of all human and mouse genes from three tumor samples from the orthotopic model on the Y axis versus an average of three control lung samples on the X axis. All the genes shown ≥2-fold up-regulated (red) represent human genes, except the three mouse genes highlighted. All genes ≥2-fold down-regulated (blue) are mouse genes. Yellow, genes that do not change expression by >2-fold. B, average change in expression of all mouse and human genes from three separate tumors in the orthotopic model on the Y axis versus the average of two samples of A549 cells in culture on the X axis. All genes ≥2-fold up-regulated (red) are mouse genes, except the four human genes highlighted. All genes ≥2-fold down-regulated (blue) are human genes. Yellow, genes that do not change expression by >2-fold. C, quantitative real-time PCR analysis of genes highlighted in (A) and (B). Up-regulation of expression levels of genes in two tumor samples compared with an average of three normal lung samples (MMP-12, MMP-13, and cathepsin K) and up-regulation of expression levels of genes in two tumor samples compared with an average of two A549 cell samples in culture (cystatin SN, cystatin C, and serpin A1). The average of the baseline samples (three normal lung or two A549 cell samples) is set to 1. Y axis, {Delta}{Delta}Ct, method used to calculate gene expression.

 

Figure 3
View larger version (8K):
[in this window]
[in a new window]
  		Figure 3. Correlation between mouse MMP-12, MMP-13, and cathepsin K expression in the orthotopic model and human MMP-12, MMP-13, and cathepsin K expression in human samples of NSCLC. Fold increase in expression of the mouse genes MMP-12, MMP-13, and cathepsin K in the orthotopic model compared with control lung versus the fold increase in expression of these genes from microarray analysis of human lung adenocarcinomas compared with normal lung. Human, expression from human lung tumors using the U133 Plus 2.0 Affymetrix array; mouse, expression from the lung tumor established in the orthotopic model using the Hu/Mu ProtIn chip. {lozenge}, MMP-12; {Delta}, MMP-13; {circ}, cathepsin K.

 
Most of the cells isolated from the tumors of the orthotopic model seem to be human tumor cells by histology (Fig. 1C); therefore, there are fewer mouse cells in the tumor sample compared with the mouse lung control sample. It would be difficult to confirm that the down-regulation of mouse genes that we also detected in the tumor compared with the control lung is real or a reflection of less mouse cells in the tumor sample. However, mouse genes that are up-regulated in the tumor sample would be a true up-regulation because there are fewer mouse cells in the tumor sample compared with the control lung.

Tumor-derived cystatin SN, cystatin C, serpin A1, and adipsin show increased expression in the tumor from the orthotopic model compared with A549 cells in culture. A distribution of gene expression from a comparison of all human and mouse genes present in the tumor versus the A549 cells in culture is shown in Fig. 2B. Genes depicted in red are those genes that are ≥2-fold up-regulated in the tumor compared with the A549 cells in culture. Genes depicted in blue are those genes that are ≥2-fold down-regulated in the tumor compared with the A549 cells in culture. Genes depicted in yellow show no change >2-fold in the tumor compared with the A549 cells in culture. The scatter plot illustrates an average of the three tumor samples versus an average of the two control samples. The majority of the genes that are up-regulated are mouse genes because the A549 cells contain no mouse genes and were compared with the tumor that contains both host-derived mouse genes and tumor-derived human genes. The human genes that are up-regulated in the tumor are highlighted in the plot. The human cysteine protease inhibitors cystatin SN and cystatin C, the serine protease inhibitor serpin A1 ({alpha}-1-antitrypsin), and the serine protease adipsin (complement factor D, EC3.4.21.46) were up-regulated ≥2-fold in at least two of three tumor samples compared with the A549 cells in culture. Cystatin SN and serpin A1 are absent in the A549 cells in culture and up-regulated an average of 37.1- and 2.6-fold, respectively, in the tumor. Cystatin C and adipsin are present in the A549 cells in culture but are up-regulated an average of 2.0- and 3.2-fold, respectively, in the tumor.

There was ~2% cross-reactivity among the samples; therefore, a few human genes were found to be present in the mouse lung and a few mouse genes were found to be present in the human tumor cells. Importantly, none of the genes mentioned as differentially expressed cross-reacted in our samples (i.e., no human samples analyzed with this chip showed expression of MMP-12, MMP-13, or cathepsin K).

Real-time PCR analysis confirms up-regulation of genes identified by microarray. Real-time quantitative PCR analysis confirmed the up-regulation of mouse genes MMP-12, MMP-13, and cathepsin K in the tumor samples compared with control lung with levels ranging from a 5-fold to >100-fold increase (Fig. 2C). The up-regulation of the human genes cystatin SN, cystatin C, and serpin A1 in the tumor samples compared with the A549 cells in culture was also confirmed using real-time PCR analysis with levels ranging from 5-fold to >1,000-fold increase (Fig. 2C). Adequate primers to distinguish mouse versus human adipsin could not be generated.

Correlation of increased expression of MMP-12, MMP-13, and cathepsin K in orthotopic model and human lung adenocarcinoma samples. RNA from 21 human lung adenocarcinoma samples was previously analyzed using the Affymetrix U133 Plus 2.0 chip (10). Mining of this data indicated that MMP-12, MMP-13, and cathepsin K were overexpressed in at least a subset of human samples, consistent with the results obtained with the orthotopic model (Fig. 3).

In the human samples, all 21 of the lung adenocarcinomas showed an increase in MMP-12 expression compared with normal lung ranging from a 24-fold to a 106-fold increase in expression. The orthotopic model showed 13.6-, 28.0-, and 37.6-fold increase in expression for MMP-12 in the three tumors examined compared with the average values for the control lung. MMP-13 was overexpressed in a subset of 6 of 21 human lung tumor samples ~20-fold, with the remaining samples having no significant change in expression. The orthotopic model showed a similar distribution, with 1.4-, 4.7-, and 6.4-fold increase in expression compared with control lung. Cathepsin K was increased from 1.3- to 5-fold in the human lung tumors and 3.1-, 4.9-, and 5.8-fold in the orthotopic model.

Of the human genes up-regulated in the tumor from the orthotopic model versus the A549 cells in culture (Fig. 2B), cystatin SN was also increased ≥2-fold in 15 of 21 human lung adenocarcinomas compared with control lung. Cystatin SN showed the most increase in expression in the model of up to 45-fold. Only 2 of 21 human lung adenocarcinomas showed a 2-fold increase in expression of cystatin C compared with normal lung. Serpin A1 and adipsin showed no change in expression or a decrease in expression in the human lung adenocarcinoma tumors compared with normal lung. Thus, we did not observe a strong correlation between the human genes identified in the model as up-regulated in the tumor compared with the A549 cells in culture and human lung adenocarcinoma samples. The changes in gene expression in the tumor compared with cells in culture may be an artifact of tissue culture conditions or a change due to growth in a three-dimensional environment.

From the analysis of the human lung adenocarcinomas using the Affymetrix U133 2.0 Plus array, we also found other proteases, including members of the MMP and cysteine cathepsin families, which were up-regulated in the human tumors compared with normal lung but which we did not observe in our xenograft model. These genes may be expressed by the tumor cells and not the surrounding stroma and would not be identified by examining mouse genes up-regulated in the model. The protease array identified some mouse MMPs that were detected as being present in the tumor but were not up-regulated compared with normal lung. For example, MMP-1, MMP-7, MMP-9, MMP-10, MMP-11, and MMP-14 were up-regulated in the human tumors, and of these, murine MMP-9, MMP-11, and MMP-14 were also identified as being present in the tumor samples from the model. The model therefore identified a specific subset of stromally up-regulated genes and did not recapitulate all aspects of human lung adenocarcinoma samples.

Expression and role of MMP-12 in lung adenocarcinomas. To determine if the Hu/Mu ProtIn chip provided information relevant to the biology of tumors, we focused on one of the induced host genes, MMP-12. Increased expression of MMP-12 mRNA is a predictor of good outcome in human colorectal cancer (12) and hepatocellular carcinoma (13). However, in non–small cell lung cancer (NSCLC), MMP-12 expression is associated with local recurrence and metastatic disease (14).

The same RNA samples used in the microarray analysis were first analyzed by Northern blot for MMP-12 expression. Northern blot analysis confirms increased RNA expression of MMP-12 in the tumor compared with normal lung (Fig. 4A ). Increased levels of mouse MMP-12 are shown at 1.8 kb in two of the tumor samples with very low levels of MMP-12 in the control lungs. The Northern blot analysis validates the results from the array, in which mouse RNA levels of MMP-12 are increased in the lungs with tumor compared with the control lungs.


Figure 4
View larger version (75K):
[in this window]
[in a new window]
  		Figure 4. Northern and immunohistochemistry analysis of MMP-12. A, RNA samples applied to the protease array were analyzed by Northern blotting. Lanes 1 and 2, RNA from two control lungs; lanes 3 and 4, RNA from two lung tumors after intratracheal injection of A549 cells. MMP-12 is shown at 1.8 kb. N, normal lung; T, tumor. The 28S rRNA is the loading control. B, immunohistochemical analysis of MMP-12 in human adenocarcinoma lung tumors from patients. Arrowheads, stromal expression of MMP-12 in normal lung adjacent to tumor. C, arrows, MMP-12 expression in the tumor stroma.

 
We analyzed 10 human lung adenocarcinoma samples from patients at Vanderbilt Medical Center for MMP-12 expression by immunohistochemistry. Eight of 10 of the samples showed stromal staining of MMP-12 (see Fig. 4B and C for example). Figure 4B shows MMP-12 staining in infiltrating cells, possibly macrophages, in an area of normal lung adjacent to tumor. Figure 4C shows MMP-12 staining in the tumor stroma. Negative controls using a rabbit IgG as the primary antibody showed no immunoreactivity (data not shown). Stromal expression of MMP-12 in human samples validates the orthotopic model as a tool to identify host-derived genes for further analysis in human lung tumors.

To determine if host-derived MMP-12 has a functional role in lung tumor formation, we did experimental metastasis assays in MMP-12-null and WT mice. LLCs (3 x 105) were injected into the tail vein of either control or MMP-12-null mice. After 2 weeks, surface lung tumors were counted and measured. Two independent experiments were done revealing similar results. There was no difference in tumor number in control and MMP-12-null mice (data not shown). However, MMP-12-null mice showed a 2- to 3-fold increase in the number of tumors that were ≥2 mm compared with control mice for both experiments (P = 0.047 and 0.001; Fig. 5A ). This observation is consistent with a reference to unpublished results suggesting MMP-12 limits lung metastasis growth in a LLC model (15). MMP-12-null mice have shown an impairment of macrophage infiltration into basement membrane in vivo (16). However, we found a similar number of macrophages in control and MMP-12-null mice in tumor-bearing lungs (data not shown), suggesting that macrophage infiltration is not impaired in our model.


Figure 5
View larger version (35K):
[in this window]
[in a new window]
  		Figure 5. Host MMP-12 contributes to lung tumor size and angiogenesis. A, results from two independent experiments of the analysis of tumor size in control and MMP-12-null mice 2 weeks after injection of 3 x 105 LLCs i.v. Experiment 1, control mice (n = 8) and MMP-12-null mice (n = 9); experiment 2, control mice (n = 5) and MMP-12-null mice (n = 5). B, CD31 staining in WT and MMP-12-null mice. C, % area of CD31-positive structures in control and MMP-12-null mice (P = 0.001). Two tumors analyzed/lung in four WT and four MMP-12-null mice.

 
In the experimental metastasis model, once the tumors reach 2 mm in diameter, they start to grow rapidly, suggesting that tumors have undergone an angiogenic switch and developed their own blood supply (17). To determine if MMP-12 altered tumor angiogenesis, endothelial cells on newly formed vessels were stained with CD31 and quantitated morphometrically. There was significantly more CD31-positive cells in the MMP-12-null mice compared with the controls (P = 0.001; Fig. 5B and C), confirming a correlation between the number of large tumors and an increase in tumor angiogenesis. MMP-12 has been shown to generate the endogenous angiogenesis inhibitor angiostatin from circulating plasminogen (18). Examination of angiostatin levels in the plasma of tumor-bearing control and MMP-12-null mice showed a significant loss of the higher molecular weight band representing kringle domains 1 to 4 of angiostatin, with no significant difference in the smaller K1-K3 species (Fig. 6A and B ). Both K1-K3 and K1-K4 forms of angiostatin induce endothelial cell death, although K1-K3 has been found to be more potent (19). MMP-12 can generate the K1-K3 species (18), and although MMP-7 and MMP-9 generate the K1-K4 species (19), a difference in the antibody used for angiostatin detection makes it unclear if MMP-12 directly generates the K1-K4 product. We suggest that the loss of MMP-12 prevents the generation of the K1-K4 species, and this reduction in the levels of the K1-K4 species results in less inhibition of angiogenesis and subsequently larger tumors in the MMP-12-null mice.


Figure 6
View larger version (28K):
[in this window]
[in a new window]
  		Figure 6. Kringle domains 1 to 4 of angiostatin is reduced in the absence of MMP-12. A, representative Western blot analysis of angiostatin levels in the plasma of tumor-bearing control and MMP-12-null mice. B, densitometry measurements of bands representing kringle domains 1 to 4 of angiostatin in control and MMP-12-null mice. Results represent two independent experiments.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
We have examined the expression of both human and mouse proteases in an orthotopic model of lung cancer using the Hu/Mu ProtIn chip to distinguish tumor- and host-derived gene expression. When comparing a lung tumor established in the orthotopic model to control lung, we found that host-derived proteases MMP-12, MMP-13, and cathepsin K were ≥2-fold up-regulated in the tumor. These same genes were similarly up-regulated in human tumors compared with normal lung. By immunohistochemical analysis, we confirmed stromal expression of MMP-12 in samples of human lung adenocarcinomas. These results suggest that the application of the Hu/Mu ProtIn chip in a xenograft model is useful to identify host proteases that are induced in response to a tumor and guide further experimentation to determine the contribution of these enzymes to tumor progression.

Based on the robust up-regulation of stromal MMP-12 in the orthotopic model of lung cancer and the confirmation that MMP-12 is significantly overexpressed in human lung adenocarcinomas, we undertook studies to examine the effect of stromal MMP-12 on lung tumor development and growth using the experimental metastasis assay. In contrast to the prevailing view that MMPs contribute to tumor progression, the absence of host MMP-12 caused an increase in tumor size compared with control lung, indicating that MMP-12 has a protective role in lung tumor formation. These results are consistent with reports that MMP-12 expression correlates with better overall survival in colorectal (12) and hepatocellular (13) carcinomas. However, recently, Hofmann et al. (14) reported that MMP-12 expression correlates with local recurrence and metastatic disease in NSCLC patients. The protumorigenic versus antitumorigenic effect of MMP-12 on tumor progression may be tumor type specific. However, it may also be important to distinguish between the expression of MMP-12 in tumor versus stromal cells. In squamous cell carcinoma of the vulva, MMP-12 expression in macrophages was shown to correlate with well-differentiated tumors, whereas MMP-12 expression in tumor cells correlated with a more aggressive histology (20). The distinction between tumor expression and host response to tumor seems to be critical in evaluating the effect of proteases on tumor progression and supports the development of tools, such as the Hu/Mu ProtIn microarray to assist in making this distinction.

The absence of stromal MMP-12 resulted in the development of larger lung tumors (>2 mm diameter), although there was no difference in the number of nodules in MMP-12-null and control mice. These results suggested that MMP-12 may influence the angiogenic switch that is necessary to allow the growth of tumors to a size that can no longer be supported by the diffusion of nutrients from existing vasculature. We observed more CD31-positive blood vessels in the MMP-12-null mice compared with WT, suggesting that, in the absence of MMP-12, angiogenesis supports the formation of larger tumors at this time point in our model. We also observed a decrease in the levels of the K1-K4 form of angiostatin, an endogenous angiogenesis inhibitor that is generated by the cleavage of plasminogen by a variety of proteases, including MMP-12 (18). In hepatocellular carcinoma, MMP-12 expression correlated with better overall survival and was associated with the generation of angiostatin (13). Our results suggest that MMP-12 may generate the K1-K4 species of angiostatin, which may contribute to its antiangiogenic function similar to the K1-K3 species of angiostatin. We also found an up-regulation of host-derived MMP-13 in tumors from the orthotopic model compared with control lung. MMP-13 has shown to be expressed in the stroma of 87% of human NSCLC samples (21). The functional significance of the overexpression of MMP-13 in lung tumors remains unknown. In vitro studies have shown that MMP-13 induces migration of alveolar epithelium on type I collagen and impairs attachment, suggesting that MMP-13 may play a role in alveolar epithelial repair or possibly lung tumor cell invasion or migration (22).

Little is known about the role of the cysteine protease cathepsin K in lung cancer, which we also found to be up-regulated in lung tumors compared with normal lung both in the orthotopic model and in human lung tumors by microarray analysis. Cathepsin K RNA levels have been reported to be higher in human lung tumors compared with normal lung by RT-PCR analysis (23). Cathepsin K is capable of degrading components of the ECM, including collagen type I, II, and IV, as well as elastin at neutral pH (24). Cathepsin K expression is found in the fibroblasts of patients with fibrotic lungs, and experiments in cathepsin K–null mice revealed that cathepsin K can prevent lung fibrosis in bleomycin-treated mice by contributing to ECM turnover (25). Future studies to determine if the increased host expression of cathepsin K that we observed in our model is also contributing to lung tumor formation would be of interest.

An imbalance between proteases and their inhibitors has been thought to contribute to cancer (1). Therefore, it was not surprising to also find differential expression of protease inhibitors in the lung tumors from the orthotopic model. However, of the four genes identified as overexpressed in the orthotopic model compared with A549 cells in culture, cystatin SA was the only one that was consistently up-regulated in the human tumor samples. The role of cystatin SA in lung cancer has not been examined, but other cystatins have been reported to be expressed in lung cancer (26). It is likely that the lack of predictability in identifying proteases or inhibitors that are overexpressed in the tumor is, at least in part, the result of comparing the genes expressed in the tumor with the profile of tumor cells in culture rather than with the normal human lung. In addition, only one cell line was used in the mouse model, which is not representative of the heterogeneity of human adenocarcinomas. The use of a variety of NSCLC cell lines may result in a more representative protease/inhibitor expression profile.

We showed that the Hu/Mu ProtIn chip, which distinguishes human- and mouse-derived proteases and protease inhibitors, is a useful tool to identify tumor- and host-derived molecules important to tumor growth and progression. We have added stromal MMP-12 to the growing list of metalloproteinases that have now been shown to exert a protective role on tumor progression (27–30). With the development of a variety of protease inhibitors to treat clinical diseases, studies, such as these, are necessary to narrow down the specificity required for inhibition of tumor progression.


   Acknowledgments
 
Grant support: NIH National Cancer Institute grant P50 CA90949 and predoctoral trainee grant T32 CA009385 (H. Acuff). All microarray experiments were done in the Vanderbilt Microarray Shared Resource, which is supported by the Vanderbilt Ingram Cancer Center grant P30 CA68485, the Vanderbilt Diabetes Research and Training Center grant P60 DK20593, the Vanderbilt Digestive Disease Center grant P30 DK58404, and the Genomics of Inflammation Program Project grant 1 P01 HL6744-01. The Hu/Mu ProtIn chips were provided by the Department of Defense Breast Cancer Center of Excellence grant DAMD-17-02-1-0693 (B.F. Sloane).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


   Footnotes
 
7 D.R. Schwartz et al., manuscript submitted. Back

Received 11/30/05. Revised 6/ 6/06. Accepted 6/21/06.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. DeClerk YA, Mercurio AM, Stack MS, et al. Proteases, extracellular matrix, and cancer. A workshop of the Path B study section. Am J Pathol 2004;164:1131–9.[Abstract/Free Full Text]
  2. Liotta LA, Kohn EC. The microenvironment of the tumour-host interface. Nature 2001;411:375–9.[CrossRef][Medline]
  3. Martin MD, Matrisian LM. Matrix metalloproteinases as prognostic factors for cancer. Clin Lab Invest 2004;28:16–8.
  4. Coussens LM, Tinkle CL, Hanahan D, Werb Z. MMP9 supplied by bone marrow-derived cells contributes to skin carcinogenesis. Cell 2000;103:481–90.[CrossRef][Medline]
  5. Yang L, Debusk LM, Fukada K, et al. Expansion of myeloid immune suppressor Gr+CD11b+ cells in tumor-bearing host directly promotes tumor angiogenesis. Cancer Cell 2004;6:409–21.[CrossRef][Medline]
  6. Sehgal G, Hua J, Bernhard EJ, Sehgal I, Thompson TC, Muschel RJ. Requirement for matrix metalloproteinase-9 (gelatinase B) expression in metastasis by murine prostate carcinoma. Am J Pathol 1998;152:591–6.[Abstract]
  7. Chen X, Su Y, Fingleton B, et al. An orthotopic model of lung cancer to analyze primary and metastatic NSCLC growth in integrin {alpha}1-null mice. Clin Exp Metastasis 2005;22:185–93.[CrossRef][Medline]
  8. McLemore T, Liu M, Blacker P, et al. Novel intrapulmonary model for orthotopic propagation of human lung cancers in athymic nude mice. Cancer Res 1987;47:5132–40.[Abstract/Free Full Text]
  9. Irizarry RA, Hobbs B, Collin F, et al. Exploration, normalization, and summaries of high density oligonucleotide array probe level data. Biostatistics 2003;4:249–64.[Abstract]
  10. Yamagata N, Shyr Y, Yanagisawa K, et al. A training-testing approach to the molecular classification of resected non-small cell lung cancer. Clin Cancer Res 2003;9:4695–704.[Abstract/Free Full Text]
  11. Pozzi A, Moberg PE, Miles LA, Wagner S, Soloway P, Gardner HA. Elevated matrix metalloprotease and angiostatin levels in integrin {alpha}1 knockout mice cause reduced tumor vascularization. Proc Natl Acad Sci U S A 2000;97:2202–7.[Abstract/Free Full Text]
  12. Yang W, Arii S, Gorrin-Rivas MJ, Mori A, Onodera H, Imamura M. Human macrophage metalloelastase gene expression in colorectal carcinoma and its clinicopathologic significance. Cancer 2000;91:1277–83.
  13. Gorrin-Rivas MJ, Arii S, Furutani M, et al. Expression of human macrophage metalloelastase gene in hepactocellular carcinoma: correlation with angiostatin generation and its clinical significance. Hepatology 1998;28:986–93.[CrossRef][Medline]
  14. Hofmann H, Hansen G, Richter G, et al. Matrix metalloproteinase-12 expression correlates with local recurrence and metastatic disease in non-small cell lung cancer patients. Clin Cancer Res 2005;11:1086–92.[Abstract/Free Full Text]
  15. Shapiro SD. Diverse roles of macrophage matrix metalloproteinase in tissue destruction and tumor growth. Thromb Haemost 1999;82:846–9.[Medline]
  16. Shipley JM, Wesselschmidt RL, Kobayashi DK, Ley TJ, Shapiro SD. Metalloelastase is required for macrophage-mediated proteolysis and matrix invasion in mice. Proc Natl Acad Sci U S A 1996;93:3942–6.[Abstract/Free Full Text]
  17. Folkman J. The role of angiogenesis in tumor growth. Semin Cancer Biol 1992;3:65–71.[Medline]
  18. Dong Z, Kumar R, Yang X, Fidler IJ. Macrophage-derived metalloelastase is responsible for the generation of angiostatin in Lewis lung carcinoma. Cell 1997;88:801–10.[CrossRef][Medline]
  19. Cao Y, Xue L. Angiostatin. Semin Thromb Hemost 2004;30:83–93.[CrossRef][Medline]
  20. Kerkelä E, Ala-aho R, Klemi P, et al. Metalloelastase (MMP-12) expression by tumour cells in squamous cell carcinoma of the vulva correlates with invasiveness, while that by macrophages predicts better outcome. J Pathol 2002;198:258–69.[CrossRef][Medline]
  21. Thomas P, Khokha R, Shepard FA, Feld R, Tsao M. Differential expression of matrix metalloproteinases and their inhibitors in non-small cell lung cancer. J Pathol 2000;190:150–6.[CrossRef][Medline]
  22. Planus E, Galiacy S, Matthay M, et al. Role of collagenase in mediating in vitro alveolar epithelial wound repair. J Cell Sci 1999;112:243–52.[Abstract]
  23. Bühling F, Waldburg N, Gerber A. Cathepsin K expression in human lung. Adv Exp Med Biol 2000;477:281–6.[Medline]
  24. Bühling F, Gerber A, Häckel C. Expression of cathepsin K in lung epithelial cells. Am J Respir Cell Mol Biol 1999;20:612–9.[Abstract/Free Full Text]
  25. Bühling F, Röcken C, Brasch F, et al. Pivotal role of cathepsin K in lung fibrosis. Am J Pathol 2004;164:2203–16.[Abstract/Free Full Text]
  26. Shridhar R, Sloane BF, Keppler D. Inhibitors of papain-like cysteine peptidases in cancer. Handbook Exptl Pharmacol 2000;140:301–28.
  27. Balbin M, Fueyo A, Tester AM, et al. Loss of collagenase-2 confers increased skin tumor susceptibility to male mice. Nat Genet 2003;35:252–7.[CrossRef][Medline]
  28. McCawley LJ, Crawford HC, King LE, Mudgett J, Matrisian LM. A protective role for matrix metalloproteinase-3 in squamous cell carcinoma. Cancer Res 2004;64:6965–72.[Abstract/Free Full Text]
  29. Pozzi A, Lefine WF, Gardner HA. Low plasma levels of matrix metalloproteinase 9 permit increased tumor angiogenesis. Oncogene 2002;21:272–81.[CrossRef][Medline]
  30. Hamano Y, Zeisberg M, Sugimoto H, et al. Physiological levels of tumstatin, a fragment of collagen IV {alpha}3 chain, are generated by MMP9 proteolysis and suppress angiogenesis via {alpha}Vß3 integrin. Cancer Cell 2003;3:589–601.[CrossRef][Medline]



This article has been cited by other articles:


Home page
 JCOHome page
R. Roy, J. Yang, and M. A. Moses
Matrix Metalloproteinases As Novel Biomarkers and Potential Therapeutic Targets in Human Cancer
J. Clin. Oncol., November 1, 2009; 27(31): 5287 - 5297.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
I. Podgorski, B. E. Linebaugh, J. E. Koblinski, D. L. Rudy, M. K. Herroon, M. B. Olive, and B. F. Sloane
Bone Marrow-Derived Cathepsin K Cleaves SPARC in Bone Metastasis
Am. J. Pathol., September 1, 2009; 175(3): 1255 - 1269.
[Abstract] [Full Text] [PDF]

Home page
 Ann OncolHome page
P. M. McGowan and M. J. Duffy
Matrix metalloproteinase expression and outcome in patients with breast cancer: analysis of a published database
Ann. Onc., September 1, 2008; 19(9): 1566 - 1572.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
M. L. Hull, C. R. Escareno, J. M. Godsland, J. R. Doig, C. M. Johnson, S. C. Phillips, S. K. Smith, S. Tavare, C. G. Print, and D. S. Charnock-Jones
Endometrial-Peritoneal Interactions during Endometriotic Lesion Establishment
Am. J. Pathol., September 1, 2008; 173(3): 700 - 715.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
A. Gutierrez-Fernandez, A. Fueyo, A. R. Folgueras, C. Garabaya, C. J. Pennington, S. Pilgrim, D. R. Edwards, D. L. Holliday, J. L. Jones, P. N. Span, et al.
Matrix Metalloproteinase-8 Functions as a Metastasis Suppressor through Modulation of Tumor Cell Adhesion and Invasion
Cancer Res., April 15, 2008; 68(8): 2755 - 2763.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Sci.Home page
M. Llamazares, A. J. Obaya, A. Moncada-Pazos, R. Heljasvaara, J. Espada, C. Lopez-Otin, and S. Cal
The ADAMTS12 metalloproteinase exhibits anti-tumorigenic properties through modulation of the Ras-dependent ERK signalling pathway
J. Cell Sci., October 15, 2007; 120(20): 3544 - 3552.
[Abstract] [Full Text] [PDF]

Home page
 Mol Cancer ResHome page
D. R. Schwartz, K. Moin, B. Yao, L. M. Matrisian, L. M. Coussens, T. H. Bugge, B. Fingleton, H. B. Acuff, M. Sinnamon, H. Nassar, et al.
Hu/Mu ProtIn Oligonucleotide Microarray: Dual-Species Array for Profiling Protease and Protease Inhibitor Gene Expression in Tumors and Their Microenvironment
Mol. Cancer Res., May 1, 2007; 5(5): 443 - 454.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Acuff, H. B.
Right arrow Articles by Matrisian, L. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Acuff, H. B.
Right arrow Articles by Matrisian, L. M.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online