Cancer Research The Future of Cancer Research: Science and Patient Impact  Translational Medicine Conference in Israel
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Franovic, A.
Right arrow Articles by Lee, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Franovic, A.
Right arrow Articles by Lee, S.
[Cancer Research 66, 8083-8090, August 15, 2006]
© 2006 American Association for Cancer Research


Cell, Tumor, and Stem Cell Biology

Multiple Acquired Renal Carcinoma Tumor Capabilities Abolished upon Silencing of ADAM17

Aleksandra Franovic1, Isabelle Robert1, Karlene Smith1, Ghada Kurban2, Arnim Pause2, Lakshman Gunaratnam1 and Stephen Lee1

1 Department of Cellular and Molecular Medicine, Faculty of Medicine, University of Ottawa, Ottawa, Ontario, Canada and 2 McGill Cancer Center and Department of Biochemistry, McGill University, Montreal, Quebec, Canada

Requests for reprints: Stephen Lee, Department of Cellular and Molecular Medicine, Faculty of Medicine, University of Ottawa, 451 Smyth Road, Ottawa, Ontario, Canada K1H 8M5. Phone: 613-562-5800, ext. 8385; Fax: 613-562-5636; E-mail: slee{at}uottawa.ca.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Malignancy is a manifestation of acquired defects in regulatory circuits that direct normal cell proliferation and homeostasis. Most of these circuits operate through cell autonomous pathways, whereas others potentially involve the neighboring microenvironment. We report that the metalloprotease ADAM17 plays a pivotal role in several acquired tumor cell capabilities by mediating the availability of soluble transforming growth factor-{alpha}, an epidermal growth factor receptor (EGFR) ligand, and thus the establishment of a key autocrine signaling pathway. Silencing of ADAM17 in human renal carcinoma cell lines corrects critical features associated with cancer cells, including growth autonomy, tumor inflammation, and tissue invasion. Highly malignant renal carcinoma cancer cells fail to form in vivo tumors in the absence of ADAM17, confirming the essential function of this molecule in tumorigenesis. These data show that ligand shedding is a crucial step in endogenous EGFR activation and endorse prospective therapeutic strategies targeting ADAM17 in human cancer. (Cancer Res 2006; 66(16): 8083-90)


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cancer cells share numerous defects in distinct regulatory circuits that govern cell proliferation and homeostasis; these defects are often called hallmarks of cancer (1). Through successive genomic alterations, transformed cells develop intricate programs that drive tumor-associated phenotypes, including growth autonomy, resistance to apoptosis, and tissue invasion. These common, yet complex, acquired tumor cell capabilities are thought to define malignancy of the majority of neoplasia and have thus been exploited in anticancer therapeutic strategies. It is thought that these acquired capabilities arise from the alterations of functionally distinct genes and, as a consequence, unrelated regulatory circuits (2, 3). Whether these alterations occur during the earliest steps of transformation or follow a linear model of chronological events remains debatable. Certainly, an overwhelming number of independent pathways have been implicated in the process of tumorigenesis. Nonetheless, it is reasonable to speculate that self-sufficiency in growth signaling is the initial acquired capability during the process of cellular transformation and perhaps the most critical aspect of neoplasia. Normal cells require exogenous growth stimulatory cues to engage in cellular division. This is reflected by their ability to withdraw from the cell cycle and enter quiescence in the absence of exogenous growth factors (4). This tightly regulated growth control is lost in essentially all cancer cells, often as a consequence of the constitutive production of endogenous growth factors (1, 5, 6). Self-sufficiency in growth signaling can be triggered by the aberrant and constitutive production of growth factors in a process called an autocrine loop. A suitable example of acquired autocrine loop capacity is observed in clear cell renal carcinoma cells. Renal epithelia require exogenous growth factors to exit quiescence and enter the cell cycle (7, 8). In stark contrast, renal carcinoma cells are able to constitutively produce the soluble transforming growth factor-{alpha} (TGF-{alpha}), a mitogen of renal epithelial cells and a ligand of the epidermal growth factor receptor (EGFR; refs. 913). Inhibition of the TGF-{alpha}/EGFR growth stimulatory pathway is sufficient to prevent self-sufficiency in growth of renal carcinoma cells in culture and, as a result, tumor formation in vivo (9, 14, 15). In several systems, TGF-{alpha} undergoes ectodomain shedding by ADAM17, a metalloprotease also called TACE [tumor necrosis factor-{alpha} (TNF-{alpha}) converting enzyme; refs. 16, 17]. However, it remains unclear whether this process is a universal requirement for EGFR signaling and tumorigenesis (18, 19). ADAM17 is involved in the ectodomain shedding of a wide variety of membrane-bound ligands and cytokines that are implicated in diverse biological processes, including growth and inflammation (20). Recent preclinical studies have yielded encouraging results as to the potency of specific ADAM17 inhibitors in the treatment of inflammatory diseases, such as rheumatoid arthritis and ischemic stroke (21, 22). Given the number of anti-ADAM17 drugs that are currently in development and its prospective role in TGF-{alpha} processing and renal carcinoma tumorigenesis, we decided to examine the function of this specific sheddase in a model of human cancer for therapeutic purposes.

We report that blocking TGF-{alpha} shedding by stably silencing ADAM17 in two independent human renal carcinoma cell lines, 786-0 and KTCL, is sufficient to suppress EGFR activation and multiple unrelated acquired tumor cell capabilities. Silencing of ADAM17 restored dependence on exogenous growth factor signaling, suppressed acquired pathways involved in tissue invasion, and prevented in vivo tumor formation of highly malignant renal cancer cells. These data show that the frequently altered regulatory circuits implicated in the process of tumorigenesis intersect at ADAM17, providing compelling evidence to target this particular metalloprotease in anticancer therapy.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell culture and reagents. The human sporadic von Hippel-Lindau(–/–) [VHL(–/–)] renal carcinoma cell line 786-0 was obtained from the American Type Culture Collection (Rockville, MD). The 786-0 cells stably transfected with hemagglutinin-tagged VHL (786-0 + VHL) were a kind gift from Dr. W.G. Kaelin (Harvard University, Boston, MA). The KTCL cell line was a kind gift from Dr. Peter Ratcliffe (University of Oxford, Oxford, United Kingdom). Cell lines were incubated at 37°C under a 5% CO2 environment. Cell lines were maintained in serum-containing medium consisting of DMEM with 5% fetal bovine serum (FBS). Serum-free medium consisted of DMEM supplemented with 1% insulin-transferrin-selenium (ITS; Invitrogen, Burlington, Ontario, Canada).

ADAM17 RNA interference. For transient silencing of ADAM17, the VHL(–/–) renal carcinoma cell lines 786-0 and KTCL were transfected with commercially available double-stranded 21-nucleotide-long small interfering RNA (siRNA) targeting ADAM17 or a control siRNA (Ambion, Austin, TX). The cell lines were also stably transfected to express one of two independent short-hairpin RNA (shRNA) sequences targeting ADAM17 with Effectene reagent (Qiagen, Valencia, CA). For each sequence, two complimentary ssDNA oligonucleotides designed with overhangs encoding BamHI/HindIII restriction enzyme sites were synthesized and subsequently annealed with 1x DNA Annealing Solution according to the protocol of the manufacturer (Ambion). The annealed inserts were subsequently ligated into a pSilencer 3.1-H1 neo vector (Ambion). Sequence 1 (5'-3'): shRNA ADAM17-1 forward GGAUGUAAUUGAACGAUUU and ADAM17-1 reverse AAAUCGUUCAAUUACAUCC (Ambion, siRNA ID: 12917). Sequence 2 (5'-3'): shRNA ADAM17-2 forward AAGCTTGATTCTTTGCTCTCA and shRNA ADAM17-2 reverse AATGAGAGCAAAGAATCAAGC (23). All constructs were verified by standard DNA sequencing. A pSilencer 3.1-H1 neo vector encoding scramble shRNA was purchased and served as a negative control. Positive clones were selected and maintained in neomycin-containing medium. The 786-0 cell lines stably transfected with shRNA-targeting EGFR were generated by our group as previously described (15).

Measurement of TGF-{alpha} levels. An equal number of cells were plated and incubated for indicated times in DMEM supplemented with 5% FBS. In experiments involving matrix metalloprotease inhibitors, cells were treated with 10 to 100 µmol/L GM6001 (Calbiochem, San Diego, CA) or corresponding volumes of DMSO as a vehicle control. The cell lysates and conditioned medium were collected and TGF-{alpha} levels were analyzed according to ELISA kit instructions (Oncogene, Boston, MA).

Western blot analysis. Cells were washed with PBS and harvested in 4% SDS in PBS. Protein concentrations were quantified using a BCA protein assay kit and samples (50 µg protein) were separated on a denaturing polyacrylamide gel containing SDS and transferred to a methanol-activated polyvinylidene difluoride membrane (NEN, Boston, MA). Before immunodetection, membranes were blocked with 5% (w/v) skim milk powder in a 0.2% Tween-PBS solution. Membranes were then incubated with anti-actin (Sigma, St. Louis, MO), anti-HIF2{alpha} (Novus, Littleton, CO), anti-ADAM17 precursor (Santa Cruz Biotechnology, Santa Cruz, CA), anti-EGFR (LabVision, Fremont, CA), or anti-py-EGFR (Santa Cruz Biotechnology) primary antibody overnight at 4°C followed by incubation with horseradish peroxidase (HRP)–conjugated anti-mouse (Amersham Biosciences, Piscataway, NJ) or anti-rabbit (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA) secondary antibody for 1 hour at room temperature. The bands were detected by use of a chemiluminescent HRP substrate (Pierce, Rockford, IL).

Measurement of cell proliferation. Cells were plated at low density on glass coverslips and incubated overnight in DMEM supplemented with 5% FBS. At the start of experiments, cells were washed and supplemented with fresh serum-containing or serum-free medium. Following indicated time periods/treatments, cells were labeled with 5-bromo-2'-deoxyuridine (BrdUrd), fixed, and immunostained according to the protocol of the manufacturer (Roche Molecular Biochemicals, Indianapolis, IN). The coverslips were counterstained with Hoechst reagent (Hoechst 33258; Sigma) and the percentage of BrdUrd incorporation was assessed using a Zeiss Axiovert S100TV microscope (Thornwood, NY).

RNA isolation and reverse transcription-PCR analysis. Total RNA was collected using TriPure Isolation Reagent (Roche Molecular Biochemicals) according to the protocol of the manufacturer. Reverse transcription-PCR (RT-PCR) was done on 1 µg RNA using the One-Step Superscript RT Platinum TaqRT-PCR kit (Invitrogen) and 0.6 µmol/L of each primer. All primers and cycle details for RT-PCR analysis of vascular endothelial growth factor (VEGF), Glut-1, TGF-{alpha}, and actin mRNA levels were described elsewhere (14). Products were analyzed with gel electrophoresis and ethidium bromide staining, and visualized using a Kodak Digital Science IC440 system.

Immunofluorescence. Cells were plated at low density on glass coverslips and incubated for 6 days in DMEM supplemented with 8% FBS. Cells were fixed in 95% ethanol for 30 minutes at –20°C. The ethanol was aspirated and coverslips were allowed to air dry at 4°C. Cells were immunostained with antifibronectin antibody (Abcam, Inc., Cambridge, MA) and fibronectin deposition was assessed as previously described (24).

In vitro tumor spheroids. Multicellular spheroids were prepared as previously described (15, 25). Briefly, 24-well plates were coated with preheated 1% Seaplaque agarose (Cambrex, Rockland, ME) in serum-free medium. One hundred thousand of the indicated cells were plated per 1 mL of medium per well. To promote cell-to-cell adhesion, the plates were gently swirled 30 minutes after plating. Spheroids were grown for 6 days at 37°C under 5% CO2 in serum-containing medium. Spheroids were then collected and fixed in 10% formaldehyde, embedded in paraffin, sectioned, mounted on slides, and stained with H&E.

Migration and invasion assays. Colorimetric cell migration assays (Chemicon, Temecula, CA) were done according to the protocol of the manufacturer. Briefly, 5.0 x 104 cells were plated in Boyden chambers. Cells were allowed to migrate for 16 hours toward serum-containing (10% FBS) or serum-free (5% bovine serum albumin) medium. The chambers were then removed and placed in staining reagent provided in the kit. The dye was solubilized and the absorbance was measured on a 96-well microplate reader at 574 nm. Colorimetric cell invasion assays were done on BD BioCoat Matrigel invasion chambers (BD Biosciences, San Jose, CA). Cells (1.5 x 105) were plated in the chambers in the presence (10% FBS) or absence (1% ITS) of serum and incubated for 48 hours. The chambers were removed and stained with crystal violet. The dye was solubilized with 10% acetic acid and its absorbance was read at 574 nm.

Nude mouse xenograft assays. Nude mouse xenograft assays were done as previously described (15, 26). Briefly, female nude mice (Charles River, Wilmington, MA) were injected in the flanks with 107 control (parental or scramble shRNA) and ADAM17 shRNA-expressing cells. Mice were sacrificed 7 to 9 weeks postinjection according to facility protocol (University of Ottawa). Tumor size was measured weekly and the tumors were excised and weighed at the time of sacrifice. Experiments were done double blinded.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
TGF-{alpha} ectodomain cleavage is required for efficient EGFR activation in renal carcinoma cell lines. Self-sufficiency in growth signaling requires activation of an autonomous program that constitutively drives cell proliferation. A model that precisely exhibits characteristics of acquired growth autonomy by production of soluble growth factors is renal carcinoma. Human renal carcinoma often harbor defective alleles of the VHL tumor suppressor and, as a consequence, overproduce hypoxia-inducible factor (HIF), a transcription factor that activates an array of genes involved in oxygen homeostasis (27, 28). One HIF target gene of particular interest with respect to tumor formation is TGF-{alpha}. We recently showed that renal carcinoma engage in a classic TGF-{alpha}/EGFR autocrine circuit required for autonomous proliferation and in vivo tumorigenesis (9, 14, 15). TGF-{alpha} is synthesized as a transmembrane precursor protein (pro-TGF-{alpha}) that undergoes ADAM17-mediated proteolytic cleavage to release the mature ligand (16). There have been conflicting accounts in the literature regarding the requirement for TGF-{alpha} shedding in EGFR activation. Although recent reports suggest that ADAM17-dependent shedding of EGFR ligands is a requirement for EGFR activation, it has also been reported that the proteolytic cleavage of TGF-{alpha} is defective in many cancer cells leading to the accumulation of membrane-bound forms and enhanced EGFR activation (18, 19). We therefore decided to examine the role of ADAM17 in a model system of human renal cancer where participant molecules in this pathway, including TGF-{alpha}, EGFR, and ADAM17, are produced endogenously. To determine whether TGF-{alpha} cleavage is necessary for EGFR activation, two independent sporadic renal carcinoma cell lines derived from human primary renal tumors with clear cell type histology and harboring loss of function mutations in the VHL tumor suppressor gene, 786-0 and KTCL, were treated for 48 hours with a general sheddase/matrix metalloprotease inhibitor, GM6001. The amount of TGF-{alpha} secreted into the medium by both renal carcinoma cell lines (Fig. 1A ), and corresponding phosphorylation of the EGFR, decreased in a dose-dependent manner (Fig. 1B) without affecting total levels of cellular TGF-{alpha} or EGFR (Fig. 1B and data not shown). To confirm that the observed effect of the drug on TGF-{alpha} shedding and EGFR phosphorylation was not a result of the inhibition of other matrix metalloproteases or alternative pathways, ADAM17 was transiently silenced using small-interfering RNA (siRNA) technology. ADAM17 knockdown was confirmed by Western blot analysis of cellular levels of the full-length ADAM17 precursor protein (Fig. 1C). Predictably, the transient silencing of ADAM17 inhibited TGF-{alpha} ectodomain cleavage (Fig. 1D) and resulted in reduced EGFR phosphorylation (Fig. 1C). The decrease in EGFR activation following transient silencing of ADAM17 only became evident after 96 hours, as it required additional time following the efficient silencing of ADAM17 to observe these downstream effects. Nonetheless, the data indicate that TGF-{alpha} shedding is required for maximal EGFR activation and that this process is most likely mediated by ADAM17.


Figure 1
View larger version (41K):
[in this window]
[in a new window]
 
Figure 1. TGF-{alpha} ectodomain cleavage is required for efficient EGFR activation. A, the effect of inhibiting TGF-{alpha} shedding with general matrix metalloprotease inhibitor, GM6001, on EGFR activation in renal carcinoma cell lines was examined. ELISA analysis of soluble TGF-{alpha} levels in serum-starved VHL(–/–) renal carcinoma 786-0 and KTCL cell line conditioned medium following a 48-hour treatment with GM6001 (10-100 µmol/L) or an equivalent volume of DMSO as a vehicle control. B, Western blot analysis of total (EGFR) and phosphorylated EGFR (phEGFR) levels in cell lysates from (A). Cell lines expressing shRNA directed against EGFR (shRNA EGFR) were used as negative controls. Actin Westerns were done as loading controls. C, the effect of transiently silencing ADAM17, the major TGF-{alpha} sheddase, on TGF-{alpha} shedding and EGFR activation in renal carcinoma cell lines was examined. Western blot analysis of ADAM17, phEGFR, and total EGFR levels in 786-0 and KTCL cell lines transiently transfected with 50 nmol/L siRNA against ADAM17, 50 nmol/L scramble siRNA (Control), or an equivalent volume of Effectene transfection reagent for 96 hours. D, ELISA analysis of TGF-{alpha} levels in conditioned medium of cell lines described in (C). Bars (A and D), SD of at least three independent experiments done in triplicate.

 
Stable inhibition of ADAM17 inhibits TGF-{alpha} shedding and EGFR activation in renal carcinoma cell lines. To further examine the specific role of ADAM17 in the establishment of the TGF-{alpha}/EGFR autocrine signaling loop, we generated renal carcinoma cell lines with stably inactivated ADAM17 using a shRNA strategy. Two independent shRNA sequences targeting ADAM17, called shRNA ADAM17-1 and ADAM17-2, were used to silence ADAM17 protein expression in the 786-0 and KTCL cell lines. Renal carcinoma stably expressing either of the shRNA sequences against ADAM17 exhibited a significant decrease in ADAM17 protein levels compared with parental cells and cells stably expressing control scrambled shRNA (Fig. 2A ). Stable expression of shRNA against ADAM17 inhibited the secretion of TGF-{alpha} by 786-0 and KTCL cells compared with parental and control cell lines suggesting that ADAM17 is the major TGF-{alpha} ectodomain sheddase in renal carcinoma (Fig. 2B). The observed decrease in secreted TGF-{alpha} was not accompanied by a measurable increase in cellular TGF-{alpha} levels (Figs. 2C and 4B). The parental renal carcinoma cell lines shed low levels of TGF-{alpha} over time, such that any resulting increases in cell-associated TGF-{alpha} were not detectable at steady state in the cell lines where ADAM17 was silenced. Importantly, there was a concomitant reduction in phosphorylated EGFR levels, but not total EGFR levels, in shRNA-expressing cells (Fig. 2A). Addition of exogenous TGF-{alpha} rescued EGFR phosphorylation, indicating that silencing ADAM17 did not affect the ability of the receptor to become activated in response to ligand stimulation (Fig. 2D). These data show that ADAM17-mediated TGF-{alpha} ectodomain shedding is a prerequisite for efficient EGFR activation in cells that produce endogenous ligand and receptor.


Figure 2
View larger version (39K):
[in this window]
[in a new window]
 
Figure 2. Stable inhibition of ADAM17 inhibits TGF-{alpha} shedding and EGFR activation. A, shRNA directed against ADAM17 mRNA suppresses ADAM17 protein levels. Western blot analysis of ADAM17, phEGFR, and total EGFR levels in VHL(–/–) renal carcinoma, 786-0 and KTCL, cell lines stably transfected with pSilencer expressing scramble shRNA (Control), or expressing one of two shRNA sequences directed against ADAM17 (shRNA ADAM17-1 or shRNA ADAM17-2). Cell lines expressing wild-type VHL (VHL) or shRNA directed against EGFR (shRNA EGFR1) were used as controls. Actin Westerns were done to ensure equal loading. B, stable silencing of ADAM17 inhibits shedding of soluble TGF-{alpha}. ELISA analysis of TGF-{alpha} levels in conditioned medium of cell lines described in (A) following a 48-hour incubation period. C, stable silencing of ADAM17 does not alter total cellular TGF-{alpha} levels. ELISA analysis of TGF-{alpha} levels in cellular lysates of cell lines described in (A). Bars (B and C), SD of at least three independent experiments done in triplicate. D, stable silencing of ADAM17 does not disrupt the ability of the EGFR to be activated upon addition of exogenous ligand. Western blot analysis of phEGFR and total EGFR levels following a 15-minute stimulation with 20 ng/mL recombinant TGF-{alpha}.

 

Figure 4
View larger version (40K):
[in this window]
[in a new window]
 
Figure 4. Silencing ADAM17 does not affect proangiogenic phenotypes characteristic of VHL-loss renal carcinoma. Expression of proangiogenic factors associated with the highly vascular nature of VHL-loss renal carcinoma was examined in VHL(–/–)renal carcinoma 786-0 cells, VHL(+)renal carcinoma cells (VHL), and 786-0 cells stably expressing shRNA (Control, EGFR, and ADAM17). A, stable silencing of ADAM17 does not affect HIF2{alpha} expression. Western blot analysis of HIF2{alpha} levels in various cell lines. Actin was used as a loading control. B, stable silencing of ADAM17 does not affect expression of hypoxia-inducible mRNAs. RT-PCR analysis of mRNA levels of HIF target genes, GLUT1, TGF-{alpha}, and VEGF, in various cell lines. C, stable silencing of ADAM17 does not restore the ability of VHL(–/–) renal carcinoma to deposit extracellular fibronectin matrix. Immunofluorescence detection of fibronectin matrix deposition was visualized at a magnification of x400.

 
Inhibition of ADAM17-mediated TGF-{alpha} shedding abolishes the ability of renal carcinoma to engage in autonomous growth. Based on the data shown in Fig. 2, we decided to examine the effect of preventing TGF-{alpha} cleavage on the ability of renal carcinoma to engage in autonomous proliferation upon serum withdrawal (29). Stable silencing of ADAM17 was sufficient to abrogate the ability of both 786-0 and KTCL cells to incorporate BrdUrd in serum-free medium (Fig. 3A ) to levels similar to those observed in renal carcinoma cells upon stable silencing of EGFR (15). After the cells had been cultured for 72 hours in the absence of serum, addition of exogenous TGF-{alpha} activated the EGFR (Fig. 2D) and reinitiated cell proliferation demonstrating that loss of growth autonomy observed in shRNA-expressing cells was not due to a dominant effect on the cell cycle (Fig. 3A). Similar data were also obtained with transient silencing of ADAM17 (Fig. 3B) and the treatment of cells with GM6001 (Fig. 3C), indicating that the results obtained with stable silencing of ADAM17 are not a consequence of fortuitous effects of shRNA expression or single cell clonal effects. These data suggest that ADAM17-mediated processing of pro-TGF-{alpha} into its soluble form is essential for EGFR phosphorylation and critical for the establishment of the TGF-{alpha}/EGFR autonomous growth circuit observed in renal carcinoma cells.


Figure 3
View larger version (26K):
[in this window]
[in a new window]
 
Figure 3. Inhibition of ADAM17-mediated TGF-{alpha} shedding abolishes the ability of renal carcinoma to engage in autonomous growth. The ability of VHL(–/–) renal carcinoma, 786-0 and KTCL, cell lines to engage in autonomous proliferation in the absence of serum growth factors was assessed as a function of their ability to incorporate BrdUrd. A, stable silencing of ADAM17 prevents the autonomous growth of renal carcinoma. 786-0 and KTCL cell lines stably transfected with shRNA against ADAM17 or scramble shRNA (Control) were cultured in 5% FBS or serum-free medium for 72 hours followed by addition of 20 ng/mL recombinant TGF-{alpha} (+TGF-{alpha}) for 24 hours. B, transient silencing of ADAM17 prevents the autonomous growth of renal carcinoma. 786-0 and KTCL cell lines were transiently transfected with 50 nmol/L siRNA targeting ADAM17, 50 nmol/L scramble siRNA (Control), or an equivalent volume of Effectene transfection reagent, in DMEM supplemented with 5% FBS or serum-free medium for 72 hours. C, inhibition of TGF-{alpha} shedding with a general matrix metalloprotease inhibitor prevents the autonomous growth of renal carcinoma. 786-0 and KTCL cell lines were treated with 100 µmol/L GM6001 or an equivalent volume of DMSO, in DMEM supplemented with 5% FBS or serum-free medium for 72 hours. Bars, SD of at least three independent experiments done in triplicate.

 
Silencing ADAM17 does not affect proangiogenic phenotypes characteristic of VHL-loss renal carcinoma. Secretion of proangiogenic factors, such as the VEGF, in conjunction with disruption of extracellular matrix deposition has been shown to promote and maintain renal carcinoma tumor angiogenesis (30). To assess whether ADAM17 has functions unrelated to TGF-{alpha} processing that may affect the well-established pathways involved in renal carcinoma tumorigenesis, we examined the effect of ADAM17 knockdown on other defects associated with VHL-loss. Silencing ADAM17 did not alter the expression of HIF2{alpha} protein (Fig. 4A ) nor the expression of classic hypoxia-inducible mRNAs, such as glucose transporter-1 (GLUT1) or VEGF (Fig. 4B). Additionally, silencing ADAM17 did not restore the ability of renal carcinoma cells to deposit extracellular fibronectin matrix (Fig. 4C), a process that can be corrected by reintroduction of VHL (31). Thus, ADAM17 function is unrelated to the major proangiogenic characteristics associated with VHL-loss.

Inhibition of ADAM17 abolishes multiple acquired tumor capabilities in vitro. Although the self-sufficiency in growth is likely to be a critical initial step in cellular transformation, cancer cells must also acquire several other characteristics for malignancy. Silencing of ADAM17 prevented the formation of highly dense spheroids (Fig. 5A ) in an avascular in vitro tumor assay that measures the tumorigenic potential of cancer cells (25). No difference in the number of apoptotic cells, as determined by propidium iodide exclusion and nuclear morphology assays, was observed in renal carcinoma cells expressing shRNA against ADAM17 or EGFR compared with parental renal carcinoma (data not shown). However, the migratory ability of renal carcinoma cells expressing shRNA against ADAM17 or EGFR was severely compromised compared with parental and control cells (Fig. 5B), and hence they failed to invade basement membrane in vitro (Fig. 5C). Taken together, these results show that ADAM17 mediates multiple acquired tumor capabilities required for overt malignancy.


Figure 5
View larger version (77K):
[in this window]
[in a new window]
 
Figure 5. Inhibition of ADAM17 abolishes multiple acquired tumor capabilities in vitro. The ability of VHL(–/–) renal carcinoma 786-0 cells, VHL(+) renal carcinoma cells (VHL), and 786-0 cells stably expressing shRNA (Control, EGFR, and ADAM17) to grow in an anchorage-independent manner, migrate toward chemoattractant, and invade basement membrane was assessed in vitro. A, stable silencing of ADAM17 hinders the ability of renal carcinoma to grow as tumor spheroids. Cells were grown as three-dimensional tumor spheroids for 6 days in vitro. Histology from spheroids is visualized at a magnification of x400. Spheroid density was measured at a magnification of x100 in at least three independent spheroid sections and reported as nuclei/field. B, stable silencing of ADAM17 abolishes the ability of renal carcinoma to migrate. Cells were plated in Boyden chambers to assess their ability to migrate through a porous membrane in the presence or absence of chemoattractant (serum) over a 16-hour period. Photographs depict migration in a serum-free environment (x200). C, stable silencing of ADAM17 abolishes the ability of renal carcinoma to invade basement membrane. Invasion of Matrigel in the presence or absence of serum over a 48-hour incubation period. Photographs depict invasion in a serum-free environment (x200). Absorbance readings were taken at 574 nm. Bars, SD of at least three independent experiments done in triplicate.

 
Silencing of ADAM17 is sufficient to suppress renal carcinoma tumor formation in vivo. Finally, we examined the consequence of silencing ADAM17 on renal carcinoma tumor formation in vivo. Parental and control VHL-defective 786-0 renal carcinoma cells formed large tumors detectable 4 to 5 weeks after injection. Reintroduction of a functional copy of VHL was sufficient to prevent tumor formation of VHL-defective renal carcinoma cells, as expected (26). 786-0 cells expressing shRNA ADAM17-1 or ADAM17-2 failed to form tumors in the xenograft mouse assay (Fig. 6A and B ). Similar data were obtained with the VHL-defective KTCL cell line expressing shRNA directed against ADAM17 mRNA although the size of the control tumors was smaller compared with 786-0 renal carcinoma (Fig. 6B). Prolonged incubation time resulted in the formation of very small tumors in only two of the 786-0 renal carcinoma cell lines expressing shRNA ADAM17-2, indicating that abolishing ADAM17 function efficiently abrogated the tumorigenic potential of highly malignant renal carcinoma cells. Interestingly, analysis of H&E-stained sections of these small tumors revealed that the typical leukocyte infiltration, observed as darkly stained nuclei, in parental and control renal carcinoma tumors, was significantly less evident when ADAM17 was silenced (Fig. 6C). This effect is likely due to the involvement of ADAM17 in the cleavage of the proinflammatory cytokine TNF-{alpha} (32). Thus, in addition to its role in suppressing cell proliferation and tumorigenesis, silencing ADAM17 may reduce tumor inflammation, a negative prognostic factor in renal carcinoma (33). Therefore, silencing of ADAM17 is sufficient to abolish in vivo tumor formation of highly malignant cell lines derived from human primary renal tumors.


Figure 6
View larger version (49K):
[in this window]
[in a new window]
 
Figure 6. Silencing of ADAM17 is sufficient to suppress renal carcinoma tumor formation in vivo. VHL(–/–) renal carcinoma 786-0 and KTCL cells expressing scramble shRNA or one of two shRNA sequences targeting ADAM17 were injected in the flanks of female nude mice. A, renal carcinoma stably expressing shRNA targeting ADAM17 fail to form tumors in nude mouse xenograft assays. Representative nude mice injected with parental 786-0, 786-0 expressing wild-type VHL (VHL), scramble shRNA (shRNA Control), or shRNA against ADAM17 (shRNA ADAM17) 7 to 9 weeks postinjection. B, average size of tumors observed after 7 to 9 weeks. Number of injections per cell line is indicated. Columns, mean; bars, SE. C, renal carcinoma tumors stably expressing shRNA against ADAM17 exhibit reduced leukocyte infiltration compared with control tumors. Histology from 786-0 tumors is visualized at a magnification of x400. Arrows, leukocytes, which appear as darkly stained nuclei. Experiments were done double-blinded.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The primary event leading up to the development of cancer is the establishment of an actively proliferating population of cells. This inappropriate initiation of cell division hinges upon the ability of cancer cells to engage in autonomous proliferation through self-induced signaling cascades, such as the TGF-{alpha}/EGFR growth stimulatory circuit (6). Uncontrolled cellular proliferation alone is not sufficient, however, for the progression and persistence of a malignancy. Tumors would not survive without the oxygen and nutrients supplied by the circulatory system (34), nor would they metastasize to distal organs, the major cause of cancer-associated death, without the means to compromise and invade the extracellular matrix (35). The endurance of tumor cells is dependent on five additional acquired traits that bestow them with fundamental growth and survival advantages. In contrast to their normal counterparts, cancer cells are able to resist growth-inhibiting signals and programmed cell death, induce angiogenesis, migrate and invade surrounding tissues, and replicate limitlessly (1).

Together, the results of this study show that silencing one biologically relevant enzyme, ADAM17, is sufficient to abrogate cancer cell growth autonomy, migration and invasion, and likely tumor inflammation. ADAM17 function was analyzed in a model system with endogenous participants, eliminating the possibility of interference due to overproduction of molecules. In this setting, ADAM17-mediated shedding of membrane-bound TGF-{alpha} is required for EGFR activation and its ability to drive autonomous proliferation. The ability of TGF-{alpha} to promote cell migration has been shown in a multitude of cell types, ranging from mammary epithelial cells to ovarian cancer cell lines (3638). Furthermore, inhibition of EGFR signaling with receptor tyrosine kinase inhibitors is sufficient to prevent migration of glioblastomas in an orthotopic nude mouse model (39). Although it is likely that the well-characterized role of ADAM17 as an EGFR ligand sheddase is at the root of the observed phenotypes, further investigation of alternative functions of ADAM17 is required. ADAM17 has previously been linked to the regulation cell-matrix interactions through adhesion molecules such as CD44 and L1, and is known to modulate cell migration by its interaction with various integrins through its disintegrin domain (4043). Notably, the integrin signaling pathway has also been implicated in focal adhesion kinase–mediated cell migration (44). Although a full-scale study of ADAM17-associated integrins has not yet been conducted, ADAM17 has an emerging role as a modulator of integrin-mediated migration that warrants additional examination (42, 43).

Although silencing of ADAM17 was sufficient to block tumor formation in vivo by eradicating at least three of the acquired capabilities characteristic of cancer cells, the angiogenic potential and resistance to apoptosis of the cells seemed to be unaffected by the knockdown. Our results suggest that there is no correlation between ADAM17 expression and HIF2{alpha} activation and resistance to cell detachment–induced apoptosis. Based on our observations, inhibition of cell proliferation, rather than enhancement of cell death or blockade of angiogenesis, is sufficient to prevent in vivo renal carcinoma tumor formation.

The results shown here argue that ADAM17-mediated shedding of TGF-{alpha} is required for renal carcinoma growth autonomy and in vivo tumor formation. The data support the notion that ADAM17-mediated ectodomain cleavage of TGF-{alpha} is required for EGFR activation and tumor formation in a biologically relevant human cancer model system that expresses endogenous ADAM17, ligand, and receptor. The central role of EGFR signaling in the development of human cancer is well documented and therapeutic agents directed at inhibiting ligand-dependent receptor activation, such as monoclonal antibodies targeting the EGFR and receptor tyrosine kinase inhibitors, have been in clinical trials for a number of years. However, such therapeutic strategies have yielded poor response rates in patients and effective therapies remain elusive (4548). In light of the fact that ADAM17 plays a central role in acquired tumor cell capabilities, such as tumor cell growth autonomy, inflammation, migration, and invasion, we suggest that ADAM17 is an ideal therapeutic target in the treatment of VHL-defective renal carcinoma and other EGFR autocrine signaling-dependent human cancers.


    Acknowledgments
 
Grant support: National Cancer Institute of Canada (S. Lee), National Cancer Institute of Canada Harold E. Johns Award (S. Lee), Kidney Foundation of Canada (A. Pause), Canada Research Chair in Molecular Oncology (A. Pause), Natural Science and Engineering Research Council of Canada Studentship (A. Franovic), and Ontario Graduate Scholarship (K. Smith).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 5/ 1/06. Revised 6/ 6/06. Accepted 6/20/06.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Hanahan D, Weinberg RA. The hallmarks of cancer. Cell 2000;100:57–70.[CrossRef][Medline]
  2. Bernards R, Weinberg RA. Metastasis genes: a progression puzzle. Nature 2002;418:823.[CrossRef][Medline]
  3. Vogelstein B, Kinzler KW. Cancer genes and the pathways they control. Nat Med 2004;10:789–99.[CrossRef][Medline]
  4. Brattain MG, Howell G, Sun LZ, Willson JK. Growth factor balance and tumor progression. Curr Opin Oncol 1994;6:77–81.[Medline]
  5. Pardee AB. G1 events and regulation of cell proliferation. Science 1989;246:603–8.[Abstract/Free Full Text]
  6. Sporn MB, Roberts AB. Autocrine growth factors and cancer. Nature 1985;313:745–7.[CrossRef][Medline]
  7. Humes HD, Beals TF, Cieslinski DA, Sanchez IO, Page TP. Effects of transforming growth factor-ß, transforming growth factor-{alpha}, and other growth factors on renal proximal tubule cells. Lab Invest 1991;64:538–45.[Medline]
  8. Gomella LG, Sargent ER, Wade TP, Anglard P, Linehan WM, Kasid A. Expression of transforming growth factor {alpha} in normal human adult kidney and enhanced expression of transforming growth factors {alpha} and ß1 in renal cell carcinoma. Cancer Res 1989;49:6972–5.[Medline]
  9. de Paulsen N, Brychzy A, Fournier MC, et al. Role of transforming growth factor-{alpha} in von Hippel-Lindau (VHL)(–/–) clear cell renal carcinoma cell proliferation: a possible mechanism coupling VHL tumor suppressor inactivation and tumorigenesis. Proc Natl Acad Sci U S A 2001;98:1387–92.[Abstract/Free Full Text]
  10. Knebelmann B, Ananth S, Cohen HT, Sukhatme VP. Transforming growth factor {alpha} is a target for the von Hippel-Lindau tumor suppressor. Cancer Res 1998;58:226–31.[Abstract/Free Full Text]
  11. Atlas I, Mendelsohn J, Baselga J, Fair WR, Masui H, Kumar R. Growth regulation of human renal carcinoma cells: role of transforming growth factor {alpha}. Cancer Res 1992;52:3335–9.[Abstract/Free Full Text]
  12. Mydlo JH, Michaeli J, Cordon-Cardo C, Goldenberg AS, Heston WD, Fair WR. Expression of transforming growth factor {alpha} and epidermal growth factor receptor messenger RNA in neoplastic and nonneoplastic human kidney tissue. Cancer Res 1989;49:3407–11.[Abstract/Free Full Text]
  13. Petrides PE, Bock S, Bovens J, Hofmann R, Jakse G. Modulation of pro-epidermal growth factor, pro-transforming growth factor {alpha} and epidermal growth factor receptor gene expression in human renal carcinomas. Cancer Res 1990;50:3934–9.[Abstract/Free Full Text]
  14. Gunaratnam L, Morley M, Franovic A, et al. Hypoxia inducible factor activates the transforming growth factor-{{alpha}}/epidermal growth factor receptor growth stimulatory pathway in VHL–/– renal cell carcinoma cells. J Biol Chem 2003;278:44966–74.[Abstract/Free Full Text]
  15. Smith K, Gunaratnam L, Morley M, Franovic A, Mekhail K, Lee S. Silencing of epidermal growth factor receptor suppresses hypoxia-inducible factor-2-driven VHL–/– renal cancer. Cancer Res 2005;65:5221–30.[Abstract/Free Full Text]
  16. Peschon JJ, Slack JL, Reddy P, et al. An essential role for ectodomain shedding in mammalian development. Science 1998;282:1281–4.[Abstract/Free Full Text]
  17. Sunnarborg SW, Hinkle CL, Stevenson M, et al. Tumor necrosis factor-{alpha} converting enzyme (TACE) regulates epidermal growth factor receptor ligand availability. J Biol Chem 2002;277:12838–45.[Abstract/Free Full Text]
  18. Borrell-Pages M, Rojo F, Albanell J, Baselga J, Arribas J. TACE is required for the activation of the EGFR by TGF-{alpha} in tumors. EMBO J 2003;22:1114–24.[CrossRef][Medline]
  19. Yang H, Jiang D, Li W, Liang J, Gentry LE, Brattain MG. Defective cleavage of membrane bound TGF leads to enhanced activation of the EGF receptor in malignant cells. Oncogene 2000;19:1901–14.[CrossRef][Medline]
  20. Seals DF, Courtneidge SA. The ADAMs family of metalloproteases: multidomain proteins with multiple functions. Genes Dev 2003;17:7–30.[Free Full Text]
  21. Lovering F, Zhang Y. Therapeutic potential of TACE inhibitors in stroke. Curr Drug Targets CNS Neurol Disord 2005;4:161–8.[CrossRef][Medline]
  22. Doggrell SA. TACE inhibition: a new approach to treating inflammation. Expert Opin Investig Drugs 2002;11:1003–6.[CrossRef][Medline]
  23. Shao MX, Ueki IF, Nadel JA. Tumor necrosis factor {alpha}-converting enzyme mediates MUC5AC mucin expression in cultured human airway epithelial cells. Proc Natl Acad Sci U S A 2003;100:11618–23.[Abstract/Free Full Text]
  24. Bonicalzi M-E, Groulx I, de Paulsen N, Lee S. Role of exon 2-encoded ß-domain of the von Hippel-Lindau tumor suppressor protein. J Biol Chem 2001;276:1407–16.[Abstract/Free Full Text]
  25. Lieubeau-Teillet B, Rak J, Jothy S, Iliopoulos O, Kaelin W, Kerbel RS. von Hippel-Lindau gene-mediated growth suppression and induction of differentiation in renal cell carcinoma cells grown as multicellular tumor spheroids. Cancer Res 1998;58:4957–62.[Abstract/Free Full Text]
  26. Iliopoulos O, Kibel A, Gray S, Kaelin WG, Jr. Tumour suppression by the human von Hippel-Lindau gene product. Nat Med 1995;1:822–6.[CrossRef][Medline]
  27. Linehan WM, Lerman MI, Zbar B. Identification of the von Hippel-Lindau (VHL) gene. Its role in renal cancer. JAMA 1995;273:564–70.[CrossRef][Medline]
  28. Kaelin WG, Jr., Iliopoulos O, Lonergan KM, Ohh M. Functions of the von Hippel-Lindau tumour suppressor protein. J Intern Med 1998;243:535–9.[CrossRef][Medline]
  29. Pause A, Lee S, Lonergan KM, Klausner RD. The von Hippel-Lindau tumor suppressor gene is required for cell cycle exit upon serum withdrawal. Proc Natl Acad Sci U S A 1998;95:993–8.[Abstract/Free Full Text]
  30. Kurban G, Hudon V, Duplan E, Ohh M, Pause A. Characterization of a von Hippel Lindau pathway involved in extracellular matrix remodeling, cell invasion, and angiogenesis. Cancer Res 2006;66:1313–9.[Abstract/Free Full Text]
  31. Ohh M, Yauch RL, Lonergan KM, et al. The von Hippel-Lindau tumor suppressor protein is required for proper assembly of an extracellular fibronectin matrix. Mol Cell 1998;1:959–68.[CrossRef][Medline]
  32. Black RA. Tumor necrosis factor-[{alpha}] converting enzyme. Int J Biochem Cell Biol 2002;34:1–5.[CrossRef][Medline]
  33. Ikemoto S, Yoshida N, Narita K, et al. Role of tumor-associated macrophages in renal cell carcinoma. Oncol Rep 2003;10:1843–9.[Medline]
  34. Hanahan D, Folkman J. Patterns and emerging mechanisms of the angiogenic switch during tumorigenesis. Cell 1996;86:353–64.[CrossRef][Medline]
  35. Chambers AF, Groom AC, MacDonald IC. Dissemination and growth of cancer cells in metastatic sites. Nat Rev Cancer 2002;2:563–72.[CrossRef][Medline]
  36. Barrandon Y, Green H. Cell migration is essential for sustained growth of keratinocyte colonies: the roles of transforming growth factor-[{alpha}] and epidermal growth factor. Cell 1987;50:1131–7.[CrossRef][Medline]
  37. Maheshwari G, Wiley HS, Lauffenburger DA. Autocrine epidermal growth factor signaling stimulates directionally persistent mammary epithelial cell migration. J Cell Biol 2001;155:1123–8.[Abstract/Free Full Text]
  38. Sewell JM, Smyth JF, Langdon SP. Role of TGF[{alpha}] stimulation of the ERK, PI3 kinase and PLC[{gamma}] pathways in ovarian cancer growth and migration. Exp Cell Res 2005;304:305–16.[CrossRef][Medline]
  39. Lamszus K, Brockmann MA, Eckerich C, et al. Inhibition of glioblastoma angiogenesis and invasion by combined treatments directed against vascular endothelial growth factor receptor-2, epidermal growth factor receptor, and vascular endothelial-cadherin. Clin Cancer Res 2005;11:4934–40.[Abstract/Free Full Text]
  40. Nagano O, Murakami D, Hartmann D, et al. Cell-matrix interaction via CD44 is independently regulated by different metalloproteinases activated in response to extracellular Ca2+ influx and PKC activation. J Cell Biol 2004;165:893–902.[Abstract/Free Full Text]
  41. Beer S, Oleszewski M, Gutwein P, Geiger C, Altevogt P. Metalloproteinase-mediated release of the ectodomain of L1 adhesion molecule. J Cell Sci 1999;112:2667–75.[Abstract]
  42. Huang J, Bridges LC, White JM. Selective modulation of integrin-mediated cell migration by distinct ADAM family members. Mol Biol Cell 2005;16:4982–91.[Abstract/Free Full Text]
  43. Bax DV, Messent AJ, Tart J, et al. Integrin {{alpha}}5{ß}1 and ADAM-17 interact in vitro and co-localize in migrating HeLa cells. J Biol Chem 2004;279:22377–86.[Abstract/Free Full Text]
  44. Sieg DJ, Hauck CR, Ilic D, et al. FAK integrates growth-factor and integrin signals to promote cell migration. Nat Cell Biol 2000;2:249–56.[CrossRef][Medline]
  45. Motzer RJ, Amato R, Todd M, et al. Phase II trial of antiepidermal growth factor receptor antibody C225 in patients with advanced renal cell carcinoma. Invest New Drugs 2003;21:99–101.[CrossRef][Medline]
  46. Drucker B, Bacik J, Ginsberg M, et al. Phase II trial of ZD1839 (IRESSA) in patients with advanced renal cell carcinoma. Invest New Drugs 2003;21:341–50.[CrossRef][Medline]
  47. Perera AD, Kleymenova EV, Walker CL. Requirement for the von Hippel-Lindau tumor suppressor gene for functional epidermal growth factor receptor blockade by monoclonal antibody C225 in renal cell carcinoma. Clin Cancer Res 2000;6:1518–23.[Abstract/Free Full Text]
  48. Dancey JE. Epidermal growth factor receptor and epidermal growth factor receptor therapies in renal cell carcinoma: do we need a better mouse trap? J Clin Oncol 2004;22:2975–7.[Free Full Text]



This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
M. Khacho, K. Mekhail, K. Pilon-Larose, J. Payette, and S. Lee
Cancer-Causing Mutations in a Novel Transcription-Dependent Nuclear Export Motif of VHL Abrogate Oxygen-Dependent Degradation of Hypoxia-Inducible Factor
Mol. Cell. Biol., January 1, 2008; 28(1): 302 - 314.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Franovic, L. Gunaratnam, K. Smith, I. Robert, D. Patten, and S. Lee
Translational up-regulation of the EGFR by tumor hypoxia provides a nonmutational explanation for its overexpression in human cancer
PNAS, August 7, 2007; 104(32): 13092 - 13097.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Franovic, A.
Right arrow Articles by Lee, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Franovic, A.
Right arrow Articles by Lee, S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online