Cancer Research Meeting Calendar  Telomeres
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zeng, Z.-Z.
Right arrow Articles by Livant, D. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zeng, Z.-Z.
Right arrow Articles by Livant, D. L.
[Cancer Research 66, 8091-8099, August 15, 2006]
© 2006 American Association for Cancer Research


Cell, Tumor, and Stem Cell Biology

Role of Focal Adhesion Kinase and Phosphatidylinositol 3'-Kinase in Integrin Fibronectin Receptor-Mediated, Matrix Metalloproteinase-1–Dependent Invasion by Metastatic Prostate Cancer Cells

Zhao-Zhu Zeng, Yifeng Jia, Nathan J. Hahn, Sonja M. Markwart, Korrene F. Rockwood and Donna L. Livant

Department of Radiation Oncology and Comprehensive Cancer Center, University of Michigan, Ann Arbor, Michigan

Requests for reprints: Donna L. Livant, Department of Radiation Oncology, University of Michigan, Room 3007, 1331 East Ann Street Building, Ann Arbor, MI 48109-0582. Phone: 734-764-0313; Fax: 734-763-1581; E-mail: dlivant{at}umich.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
{alpha}5ß1 Integrin interacts with the PHSRN sequence of plasma fibronectin, causing constitutive invasion by human prostate cancer cells. Inhibition of this process reduces tumorigenesis and prevents metastasis and recurrence. In this study, naturally serum-free basement membranes were used as in vitro invasion substrates. Immunoassays were employed to dissect the roles of focal adhesion kinase (FAK), phosphatidylinositol 3'-kinase (PI3K), and protein kinase C{delta} (PKC{delta}) in {alpha}5ß1-mediated, matrix metalloproteinase-1 (MMP-1)–dependent invasion by metastatic human DU 145 prostate cancer cells. We found that a peptide composed of the PHSRN sequence induced rapid FAK phosphorylation at Tyr397 (Y397), a site whose phosphorylation is associated with kinase activation. The technique of RNA silencing [small interfering RNA (siRNA)] confirmed the role of FAK in PHSRN-induced invasion. PHSRN also induced the association of the p85-regulatory subunit of PI3K with FAK at a time corresponding to FAK phosphorylation and activation, and maximal PI3K activity occurred at this same time. The necessity of PI3K activity in both PHSRN-induced invasion and MMP-1 expression was confirmed by using specific PI3K inhibitors. By employing a specific inhibitor, Rottlerin, and by using siRNA, we also found that PKC{delta}, a PI3K substrate found in focal adhesions, functions in PHSRN-induced invasion. In addition, the induction of MMP-1 in PHSRN-treated DU 145 cells was shown by immunoblotting, and the role of MMP-1 in PHSRN-induced invasion was confirmed by the use of blocking anti-MMP-1 monoclonal antibody. Finally, a close temporal correspondence was observed between PHSRN-induced invasion and PHSRN-induced MMP-1 activity in DU 145 cells. (Cancer Res 2006; 66(16): 8091-9)


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Integrins are heterodimeric receptors that transmit signals between extracellular matrix ligands and intracellular signal transduction pathways (1) to support adhesion, invasion, survival, and differentiation. The {alpha}5ß1 integrin interacts with the PHSRN sequence of fibronectin cell-binding domain fragments to stimulate invasion during wound healing (2). Because epithelial cells, fibroblasts, and endothelial cells express the invasion-inhibitory {alpha}4ß1 integrin as well as {alpha}5ß1, fibronectin fragmentation is required for invasion induction (3). Integrins are also very important in cancer progression (4). For example, the {alpha}5ß1 fibronectin receptor is specifically up-regulated in late-stage tumors as a consequence of epithelial to mesenchymal transition induction and establishment of the invasive phenotype (5), whereas {alpha}4ß1 may be down-regulated, resulting in constitutive, fibronectin-dependent invasion (6).

To evaluate the contribution of plasma fibronectin (pFn) in metastatic invasion, we used naturally serum-free, selectively permeable (7) basement membranes of sea urchin embryos (SU-ECM) as in vitro invasion substrates. SU-ECM have been shown to be free of background invasion by unstimulated normal cells (2, 6), which can be observed when reconstituted basement membranes are used (8). In addition, SU-ECM are structurally and functionally similar to mammalian basement membranes (9). Previously, we showed that the {alpha}5ß1/pFn interaction causes constitutive invasion by metastatic human prostate cancer cells and identified PHSRN as the invasion-inducing sequence (6). We have also found that matrix metalloproteinase 1 (MMP-1)–dependent invasion is caused by the interaction of the {alpha}5ß1 receptors of metastatic breast cancer cells with pFn (9, 10) because, like prostate cancer (11), these cells frequently lose {alpha}4ß1 from their cell surfaces, thereby becoming invasive in the presence of the pFn of all body fluids (10, 12). Hence, we explored the effects of the PHSRN sequence on intracellular signaling downstream of the {alpha}5ß1/pFn interaction in prostate cancer cells.

Focal adhesion kinase (FAK) is a critical mediator of integrin-mediated migration and signaling (13). It exhibits increased kinase activity (14) and Tyr397 (Y397) phosphorylation after integrin activation (14, 15). FAK is also up-regulated in prostate cancer cell lines and in lysates of prostate tissues from patients with metastatic disease but is not increased in normal prostate or in tissues from patients with localized prostate cancer (16). Furthermore, RNA interference (RNAi) has shown that FAK plays an important role in cancer cell invasion (17).

When FAK is activated and autophosphorylated at Y397, it has been shown to bind the SH2 domain of phosphatidylinositol 3'-kinase (PI3K; ref. 18), thereby bringing the catalytic subunit of PI3K to the membrane, where it catalyzes phosphorylation of inositol lipids at the D-3 position to form 3'-phosphorylated phosphoinositides, including phosphatidylinositol-3,4,5-trisphosphate (PIP3). Integrin activation-induced FAK/PI3K association has been shown in both platelets and fibroblasts (19). Furthermore, PI3K plays an important role in invasion by many types of cancer (2022). Moreover, we have shown that erbB-2 oncogene overexpression down-regulates {alpha}4ß1, thereby inducing PI3K-dependent invasion in transformed mammary epithelial cells and in human breast cancer, thus linking the {alpha}5ß1+{alpha}4ß1 integrin fibronectin receptor phenotype to constitutive, PI3K-dependent invasion (10, 23). However, the role of PI3K in {alpha}5ß1-mediated prostate cancer cell invasion has not yet been investigated.

Thus, we examined the effects of the PHSRN peptide on FAK Y397 phosphorylation, on the association of FAK with the PI3K p85 subunit, and on PI3K activity in metastatic DU 145 prostate cancer cells. By using RNAi (24) to reduce FAK expression and specific inhibitors of PI3K, we also determined the effects of FAK and PI3K on PHSRN-induced invasion and MMP-1 secretion. Because protein kinase C{delta} (PKC{delta}) is activated by the PI3K product, PIP3 (25), we also assessed its role in PHSRN-induced invasion and MMP-1 activity. Our results implicate a pathway involving FAK, PI3K, and PKC{delta} in {alpha}5ß1-mediated invasion by metastatic prostate cancer cells.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell culture. DU 145 cells, originally cultured from a human prostate adenocarcinoma brain metastasis (26), were obtained from the American Type Culture Collection (Manassas, VA) and cultured as recommended. For all assays in serum-free medium, DU 145 cells were first serum-starved overnight.

Peptide synthesis. NH2-terminal acetylated, COOH-terminal amidated PHSRN, HSPNR, and LDV peptides (Ac-PHSRN-NH2, Ac-HSPNR-NH2, and Ac-LHGPEILDVPST-NH2) were synthesized, and their purities were assessed as described previously (2, 6, 9). Peptide purities were found to be 97% for Ac-PHSRN-NH2, 93% for Ac-HSPNR-NH2, and 91% for Ac-LHGPEILDVPST-NH2 (data not shown). Peptide structures were confirmed, and peptides were desalted and stored as described previously (2, 6, 9).

Invasion assays. Serum-free SU-ECM in vitro invasion substrates were prepared, and invasion assays were done as described previously (6, 9). For assays evaluating the effects of anti-MMP-1-blocking monoclonal antibody (mAb) on PHSRN-induced invasion, the concentration of Ac-PHSRN-NH2 in the serum-free assay medium was 1 µg/20,000 cells. Function-blocking anti-MMP-1 (COMY-4A2), anti-MMP-2 (CA-4001), and anti-MMP-9 (GE-213) mAb (Chemicon International, Temecula, CA; refs. 2729) were prebound to cells at concentrations ranging from 10 to 300 µg/ml, and invasion was assayed as described above. Isotype control antibodies, IgM (BD Biosciences PharMingen, San Diego, CA) and IgG1 and IgG3 (Sigma, St. Louis, MO), were prebound to cells for invasion assay controls as described above. For determining the effect of the PI3K inhibitor, LY294002, on PHSRN-induced invasion, serum-free DU 145 cells were treated with 25 µmol/L LY294002 (Sigma) for a day before suspension, addition of PHSRN peptide, and invasion assay on SU-ECM as described above. For determining the effect of the PI3K inhibitor, wortmannin (Calbiochem, San Diego, CA), on PHSRN-induced invasion, serum-free DU 145 cells were suspended, rinsed, and treated with 10 nmol/L wortmannin for 10 minutes at 37°C before the addition of the PHSRN peptide and placement on SU-ECM in serum-free medium. For assaying the effect of the PKC{delta} inhibitor, Rottlerin, on PHSRN-induced invasion, serum-free DU 145 cells were treated with 5 µmol/L Rottlerin (Calbiochem) for 15 minutes at 37°C before PHSRN peptide addition and inclusion in SU-ECM invasion assays. For determining the effect of the PKC{alpha} inhibitor, Safingol, on PHSRN-induced invasion, serum-free DU 145 cells were treated with 20 µmol/L Safingol (Calbiochem) for 15 minutes at 37°C before PHSRN treatment and invasion assay as described above.

Assay for PI3K activity. PI3K activity was determined using the PI3K ELISA kit (Echelon Biosciences, Inc., Salt Lake City, UT) according to the manufacturer's instructions and as described previously (30). This kit measures PI3K activity by quantifying the conversion of phosphatidylinositol-3,4-bisphosphate (PIP2) into PIP3. Serum-free DU 145 cells were treated with Ac-PHSRN-NH2 for various times as indicated. Cell lysates were incubated for 1 hour at 4°C with anti-PI3K p85 antibody (Upstate Biotechnology, Lake Placid, NY) followed by addition of protein G-agarose beads (Roche Applied Science, Indianapolis, IN) according to the manufacturer's instructions. In these assays, the colorimetric signal is inversely proportional to the amount of PIP3 produced by PI3K activity.

MMP-1 activity assay. MMP-1 activity in adherent DU 145 cells was measured as described previously (9). When appropriate, cells were treated with LY294002, Rottlerin, or Safingol inhibitors before treatment with the PHSRN peptide as described above. Results were analyzed using Student's t test.

Immunoprecipitation and immunoblotting. DU 145 cells were cultured, serum starved, peptide treated, and lysed as described previously (9). Lysates containing 500 µg protein were immunoprecipitated using anti-FAK antiserum (Upstate Biotechnology) according to the manufacturer's instructions. Protein G-agarose beads were mixed with lysates, washed, resuspended in SDS sample buffer, and boiled to release the bound immunocomplexes. The levels of phosphorylated FAK were measured by immunoblot analysis, as described previously (9), using anti-FAK (pY397) phosphospecific antibody (Biosource International, Inc., Camarillo, CA). The blots were stripped and reprobed with anti-PI3K p85 mAb to determine p85/FAK association. To assess total FAK levels, membranes were reprobed with anti-FAK mAb. Levels of pY861 FAK were evaluated by immunoblotting using an anti-FAK (pY861) antibody (Biosource International). The effects of PHSRN peptide treatment on PKC{delta} Thr505 (T505) phosphorylation levels in serum-free DU 145 cells were evaluated by immunoblotting using an activation-specific, anti-PKC{delta} (pT505) antibody (Santa Cruz Biotechnology, Santa Cruz, CA) and an antibody that detects total PKC{delta} protein (Cell Signaling Technology, Beverly, MA). The effects of PHSRN treatment on PKC{alpha} Ser657 (S657) phosphorylation levels were evaluated by immunoblotting using an activation-specific, anti-pS657 antibody (Upstate Biotechnology). The effects of peptide treatment on MMP-1 expression were analyzed by immunoblotting as described previously (9). The treatment groups were as follows: serum-free medium only, serum-free medium plus 1 µg/20,000 cells Ac-PHSRN-NH2 peptide, serum-free medium plus 1 µg/20,000 cells Ac-HSPNR-NH2 peptide, serum-free medium plus 2.5 µg/20,000 cells Ac-LHGPEILDVPST-NH2 peptide, and serum-free medium plus 1 µg/20,000 cells Ac-PHSRN-NH2 plus 2.5 µg/20,000 cells Ac-LHGPEILDVPST-NH2. Band densities were quantified using ImageJ software.1

Small interfering RNA. Two small interfering RNA (siRNA) oligonucleotides and a RNAi Starter kit were obtained from Qiagen, Inc. (Valencia, CA). The siRNA sequence used for targeting PKC{delta} was AAGGCTGAGTTCTGGCTGGAC (31), Genbank accession no. NM-006254 (Qiagen). The siRNA sequence for targeting FAK was from target regions 248 to 298, validated siRNA (32), Genbank accession no. NM-153831 (Qiagen). DU 145 cells were seeded, and transfections of siRNA were done according to the manufacturer's instructions. siRNA (1 µg) was transfected using 6 µL RNAiFect transfection reagent. Nonsilencing fluorescein-labeled control siRNA was used for monitoring transfection efficiency. At 24 to 72 hours after transfection, cells were switched to serum-free culture medium for 24 hours and then treated with Ac-PHSRN-NH2 or Ac-HSPNR-NH2 peptides as described above. FAK and PKC{delta} protein knockdown levels were assessed by immunoprecipitation and immunoblotting using anti-FAK (Upstate Biotechnology) or anti-PKC{delta} antibody (Sigma). The effects of FAK or PKC{delta} siRNA on PHSRN-induced MMP-1 expression were assessed using anti-MMP-1 polyclonal antibody (Chemicon International) with purified human MMP-1 (Chemicon International) as a positive control. Functional effects of FAK or PKC{delta} siRNA on PHSRN-induced DU 145 invasion were evaluated in serum-free SU-ECM invasion assays as described above.

3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay. 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), a commonly used method for measuring cellular viability by assaying mitochondrial dehydrogenase activity (33), was used to assess the viability of DU 145 cells expressing FAK or control siRNA. MTT assays were done using an in vitro toxicology assay kit (Sigma) according to the manufacturer's instructions. DU 145 cells were inoculated into 96-well plates at a density of 4,000 per well and cultured for 24 hours. Then, the cells were serum starved overnight and switched to medium without phenol red. DU 145 cells were exposed to 5 nmol/L FAK siRNA (Qiagen), 5 nmol/L nonspecific siRNA (Qiagen), or 20 µmol/L cisplatin (Sigma) for periods ranging from 24 to 72 hours. The absorbance of wells was measured using a microplate spectrophotometer (model SPECTRAmax PLUS384, Molecular Devices Corp., Sunnyvale, CA). The background absorbance at 690 nm was subtracted from the 570 nm signal.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Induction of FAK phosphorylation and PI3K p85 association by PHSRN. We have shown that the PHSRN peptide induces invasion by serum-free DU 145 human prostate carcinoma cells, as well as by various human breast cancer cell lines (6, 9). Furthermore, PI3K activity is required for {alpha}5ß1-mediated invasion by transformed mammary epithelial cells (23). Thus, we compared the effects of the PHSRN and scrambled HSPNR peptides on FAK Y397 phosphorylation and on FAK/PI3K association. As shown in a typical immunoblot of lysates from PHSRN- and HSPNR-treated DU 145 cells probed with anti-pY397 FAK antibody (Fig. 1A ), exposure to the PHSRN peptide induced a rapid, transient FAK phosphorylation at Y397. Significant phosphorylation occurred within 15 minutes, peaked at 30 to 60 minutes, and then began to decline. No changes in the total amounts of FAK protein were observed. In addition, FAK Y397 phosphorylation was not observed after treatment with the HSPNR control peptide, showing that PHSRN-induced FAK Y397 phosphorylation depends specifically on the PHSRN sequence. Moreover, the PHSRN peptide does not seem to induce FAK phosphorylation on Y861, a Src-dependent site, whose phosphorylation is independent of adhesion (34). Figure 1A also shows a histogram depicting the mean relative levels of pY397 FAK and total FAK, with their first SDs, which were obtained by densitometric analysis of the appropriate bands on multiple anti-FAK (pY397) immunoblots like the one shown above. Exposure to the PHSRN peptide induced rapid FAK phosphorylation at Y397, with levels peaking after 30 to 60 minutes of exposure and declining thereafter. No changes in the total amounts of FAK protein were observed. In addition, no detectable FAK phosphorylation at Y397 occurred after exposure to the scrambled peptide control. As expected from the fibronectin dependence of serum-induced invasion and the role of the fibronectin PHSRN sequence in invasion induction (2, 6, 9), similar time courses of FAK Y397 phosphorylation were induced in serum-starved DU 145 cells after exposure to serum-containing medium (data not shown).


Figure 1
View larger version (35K):
[in this window]
[in a new window]
 
Figure 1. Induction of FAK Y397 phosphorylation, PI3K p85 subunit association, and PI3K activity by the PHSRN peptide, Ac-PHSRN-NH2. A, induction of FAK Y397 phosphorylation by the PHSRN peptide. Anti-FAK immunoprecipitates from PHSRN peptide-treated DU 145 cells were electrophoresed, blotted, and probed with antibodies specific for pY397-FAK, pY861-FAK, or total FAK (to show equal loading). Top, a typical immunoblotting result; bottom, a histogram depicting the amounts of pY397-FAK and total FAK relative to amounts in duplicate lysates of untreated, serum-free DU 145 cells (as determined by measuring band densities on three immunoblots). In the immunoblot, top, peptides used to treat the cells; left, primary antibodies used. SF, a lysate from serum-starved DU 145 cells in serum-free medium; PHSRN, lysates from serum-free DU 145 cells treated with Ac-PHSRN-NH2 peptide for the various times indicated (15 minutes to 6 hours); HSPNR, lysates from serum-free DU 145 cells treated with Ac-HSPNR-NH2 scrambled peptide control for the times indicated. In the histogram, X axis, minutes of peptide treatment; Y axis, relative amounts of pFAK and total FAK. Black columns, amounts of pY397-FAK relative to duplicate untreated controls; gray columns, amounts of total FAK relative to duplicate untreated controls; arrow, relative amount of pY397-FAK or total FAK in lysates from duplicate untreated controls set to 1.0. Columns, mean; bars, first SD. B, induction of PI3K p85 association with FAK by the PHSRN peptide. Anti-FAK immunoprecipitates from PHSRN peptide-treated DU 145 cells were electrophoresed, blotted, and probed with anti-p85 antibody and with anti-FAK (to show equal loading). Duplicate lysates were probed with anti-p85. Top, a set of typical immunoblots; bottom, a histogram depicting the amounts of FAK-associated p85 and total FAK relative to the amounts in duplicate lysates of untreated, serum-free DU 145 cells (as determined by measuring band densities on immunoblots). In the immunoblot, top, peptides used to treat the cells; left, primary antibodies used. SF, a lysate from serum-starved DU 145 cells in serum-free medium; PHSRN, lysates from serum-free DU 145 cells treated with Ac-PHSRN-NH2 peptide for the various times indicated (15 minutes to 6 hours); HSPNR, lysates from serum-free DU 145 cells treated with Ac-HSPNR-NH2 scrambled peptide control for the times indicated. In the histogram, X axis, minutes of peptide treatment; Y axis, relative amounts of FAK-associated p85 and total FAK. Black columns, amounts of PI3K p85 in anti-FAK immunoprecipitates relative to duplicate untreated controls; gray columns, amounts of total FAK relative to duplicate untreated controls; arrow, relative amounts of p85 or total FAK in lysates from duplicate untreated controls were set to 1.0. Columns, mean; bars, first SD. C, induction of PI3K by PHSRN treatment. X axis, PHSRN treatment time (minutes); Y axis, absorbance at 450 nm. Colorimetric signal shown is inversely proportional to the amount of PIP3 produced by PI3K. Columns, mean; bars, first SD. D, inhibition of PHSRN-induced PI3K activity by the PI3K inhibitors LY294002 and wortmannin. X axis, treatments: Untr., untreated, serum-free DU 145 cells; PHSRN, PHSRN-treated, serum-free DU 145 cells; LY, LY294002-treated, serum-free DU 145 cells; LY + PHSRN, LY294002-treated, serum-free DU 145 cells exposed to the PHSRN peptide; Wort., wortmannin-treated, serum-free DU 145 cells; Wort. + PHSRN, wortmannin-treated, serum-free DU 145 cells exposed to the PHSRN peptide. Y axis, absorbance at 450 nm. Colorimetric signal shown is inversely proportional to the amount of PIP3 produced by PI3K. Columns, mean; bars, first SD.

 
To assess the effects of PHSRN peptide on FAK/p85 association, cultures of adherent, serum-free DU 145 cells were treated with the PHSRN or HSPNR peptides for various times. As shown in the sample blot of Fig. 1B, exposure to the PHSRN peptide induced a rapid, transient association of the PI3K p85 subunit with FAK, which peaked after 30 to 60 minutes, closely corresponding to the time of maximal FAK pY397 levels. No significant PI3K p85/FAK association was observed in response to HSPNR peptide treatment. The same time course of PHSRN-induced FAK/p85 association was also observed when anti-PI3K p85 immunoprecipitates were immunoblotted and probed with anti-FAK antibody (data not shown). Figure 1B also shows a histogram comparing the relative amounts of the FAK-associated p85 subunit of PI3K to total FAK protein in multiple anti-p85 immunoblots of anti-FAK immunoprecipitates. Multiple anti-FAK immunoprecipitates, each obtained at various times after exposure of serum-starved DU 145 cells to the PHSRN or HSPNR peptides, were analyzed on each immunoblot. Mean relative levels of FAK-associated PI3K p85 subunit, and total FAK protein, each obtained by densitometric analysis of the appropriate bands on several immunoblots, are shown with their first SDs. As in the example shown in Fig. 1A, Fig. 1B shows that exposure to the PHSRN peptide induced rapid association of the PI3K p85 subunit with FAK, which peaked after 30 to 60 minutes of exposure and declined thereafter. As indicated, no changes in the total amounts of FAK or p85 proteins were observed. Also like Fig. 1A, no detectable p85 association with FAK occurred after exposure to the scrambled peptide control. Similar time courses of FAK/PI3K p85 subunit association were induced in serum-starved DU 145 cells after exposure to serum-containing medium (data not shown).

The effect of the PHSRN peptide on PI3K activity was assayed by a competitive, colorimetric ELISA assay (30) in serum-free DU 145 cells at various times after exposure. The mean absorbances plotted in Fig. 1C are inversely proportional to the amount of PIP3 produced by DU 145 cells in response to PHSRN. Thus, PI3K activity was detectable after 15 minutes of PHSRN peptide treatment in adherent DU 145 cells. Moreover, activity peaked at ~30 minutes, corresponding to the time of maximal PHSRN-induced pFAK/PI3K p85 subunit association, as seen in Fig. 1B. In addition, PHSRN-induced PI3K activity was transient; it decreased after 60 minutes, later becoming undetectable. To verify the specificity of the ELISA assay used to detect PI3K activity, PHSRN-induced PI3K activity was assayed in the presence of the LY294002 or wortmannin PI3K inhibitors. As expected, exposure of DU 145 cells to either LY294002 or wortmannin reduced PHSRN-induced PI3K activity to background levels as shown in Fig. 1D.

Prevention of PHSRN-induced invasion by overexpression of FAK siRNA. The functional role of FAK in PHSRN-induced invasion was assessed by overexpressing in DU 145 cells, an siRNA specific for FAK. The technique of siRNA overexpression is a well-known method for achieving specific, transient gene silencing in mammalian cells (24). An immunoblot, comparing FAK expression in DU 145 cells overexpressing either FAK siRNA or a nonspecific negative control siRNA for 2 days, is shown in Fig. 2A . Both siRNAs were present at a concentration of 1 nmol/L as indicated. In contrast to nonspecific siRNA, overexpression of FAK siRNA nearly eliminated detectable FAK expression in DU 145 cells. The effect of 24 to 72 hours of FAK siRNA overexpression on PHSRN-induced DU 145 invasion was then assessed using serum-free SU-ECM basement membranes (2, 6). Figure 2B shows the mean invasion percentages for PHSRN-treated, serum-free DU 145 cells. Two days after transfection, the percentage of invaded DU 145 cells, expressing nonspecific siRNA, was very similar to that obtained for untreated DU 145 cells, assayed in parallel, and to the value reported previously (6); however, invasion was completely prevented in DU 145 cells overexpressing FAK siRNA, suggesting that FAK activity is required for PHSRN-induced invasion. Very similar effects of FAK siRNA and nonspecific siRNA on invasion were also observed 1 and 3 days after transfection (data not shown). Because exposure to FAK siRNA has been shown to cause decreases in both viability and fibronectin-induced migration in several types of cancer cells, in addition to reducing FAK protein levels by ~70% (35), we evaluated the effect of FAK siRNA on DU 145 viability using the MTT assay for mitochondrial dehydrogenase activity (33). As shown in Fig. 2C, exposure to FAK siRNA for 2 days had no discernable effect on DU 145 viability, whereas exposure to cisplatin, a broad-activity antineoplastic agent, significantly decreased it. Very similar results were obtained 1 and 3 days after siRNA transfection. In addition, the results of trypan blue exclusion gave results fully consistent with the MTT assays (data not shown). Thus, FAK down-regulation seems to prevent PHSRN-induced invasion without significantly decreasing DU 145 viability.


Figure 2
View larger version (19K):
[in this window]
[in a new window]
 
Figure 2. Requirement for FAK and PI3K in PHSRN-induced invasion by DU 145 cells. A, an example of an immunoblot showing reduced FAK expression in DU 145 cells exposed to FAK siRNA (FAK) compared with nonspecific (NS) siRNA or in the absence of siRNA (none). The immunoblot was probed with anti-FAK antibody and anti-IgG antibody (to show equal loading). hc, immunoglobulin {gamma} heavy chain. B, histogram comparing the PHSRN-induced invasiveness of DU 145 cells exposed to 1 nmol/L FAK siRNA, nonspecific siRNA, or no siRNA. X axis, siRNA; Y axis, percentage of invaded cells. Columns, mean invasion percentages; bars, first SDs. C, histogram showing MTT assay results comparing the viabilities of untreated DU 145 cells, DU 145 cells exposed to transfection reagent (Transf.), DU 145 cells transfected with nonspecific siRNA, DU 145 cells transfected with FAK siRNA, and DU 145 cells treated with cisplatin. X axis, treatments; Y axis, viability relative to untreated control. Columns, mean; bars, first SD. D, PI3K requirement for PHSRN-induced invasion. X axis, treatments: SF, serum-free medium only; SF PHSRN, PHSRN peptide in serum-free medium; SF PHSRN LY, PHSRN peptide with LY294002 in serum-free medium; SF PHSRN Wort, PHSRN peptide with wortmannin in serum-free medium. Y axis, percentage of invaded cells. Columns, mean; bars, first SD.

 
Role of PI3K in PHSRN-induced invasion. Because PHSRN induces invasion by DU 145 cells (6) and because PI3K also functions in serum-induced invasion by transformed mammary epithelial cells (23), the role of PI3K in PHSRN-induced invasion was assessed. Serum-free DU 145 cells were treated with either LY294002 or wortmannin PI3K inhibitors; then invasion was induced with the PHSRN peptide and assayed on serum-free SU-ECM basement membrane-containing invasion substrates. As shown in Fig. 2D, both PI3K inhibitors completely prevented invasion, suggesting that PI3K activity is required for PHSRN-induced invasion in DU 145 cells.

Role of PKC{delta} in PHSRN-induced invasion. Because the lipid products of PI3K have been shown to activate PKC{delta} (25), its functional role in PHSRN-induced invasion was assessed by overexpression in DU 145 cells of an siRNA specific for PKC{delta}. An immunoblot, comparing PKC{delta} expression in DU 145 cells overexpressing either PKC{delta} siRNA or nonspecific siRNA, 65 hours after transfection, is shown in Fig. 3A . PKC{delta} siRNA, but not nonspecific siRNA, substantially reduced PKC{delta} expression in DU 145 cells. The effect of PKC{delta} siRNA overexpression on PHSRN-induced invasion was then assessed in these cells using serum-free SU-ECM. Figure 3B shows the mean invasion percentages for serum-free DU 145 cells treated with the PHSRN peptide to induce invasion 65 hours after siRNA transfection. The mean percentage of invaded DU 145 cells, expressing nonspecific siRNA, was very similar to that of untreated controls (data not shown) as well as to that reported for DU 145 cells (6); however, invasion was completely prevented in DU 145 cells overexpressing PKC{delta} siRNA, suggesting that PKC{delta} activity is required for PHSRN-induced invasion.


Figure 3
View larger version (26K):
[in this window]
[in a new window]
 
Figure 3. Prevention of PHSRN-induced invasion in DU 145 cells overexpressing PKC{delta} siRNA. A, an example of an immunoblot comparing levels of total PKC{delta} in anti-PKC{delta} immunoprecipitates from equal numbers of DU 145 cells exposed to PKC{delta} siRNA, siRNA, or no siRNA. The immunoblot was probed with anti-PKC{delta} mAb, stripped, and reprobed with anti-IgG light chain antibody to show equal loading. lc, immunoglobulin {kappa} light chain. B, histogram comparing the PHSRN-induced invasiveness of DU 145 cells exposed to 1 nmol/L PKC{delta} siRNA or 1 nmol/L nonspecific siRNA. X axis, siRNA treatment: PKC{delta} siRNA and nonspecific siRNA; Y axis, percentage of invaded cells. Columns, mean invasion percentages; bars, first SDs. C, histogram comparing the PHSRN-induced invasion of serum-free DU 145 cells exposed to Rottlerin or Safingol or not treated with a PKC inhibitor. X axis, treatment; Y axis, percentages of invaded cells. Columns, mean; bars, first SDs. D, an example of an immunoblot comparing levels of pT505 PKC{delta}, total PCK{delta}, and pS657 PKC{alpha} in untreated (C), PHSRN-treated (PHSRN), and PHSRN- and wortmannin-treated (PHSRN + Wort.) DU 145 cells.

 
To verify the requirement for PKC{delta} activity in invasion, serum-free DU 145 cells were treated with Rottlerin, a specific inhibitor of PKC{delta}, or with Safingol, a selective inhibitor of PKC{alpha} (36, 37). As shown in Fig. 3C, 5 µmol/L Rottlerin prevented PHSRN-induced invasion by DU 145 cells, whereas 20 µmol/L Safingol had no effect. These results suggest that PKC{delta} functions in PHSRN-induced invasion, whereas PKC{alpha} may not play an appreciable role. They also imply that exposure to the PHSRN peptide should result in PKC{delta} activation, as indicated by T505 phosphorylation in its activation loop (38), but not in the activation of PKC{alpha}, as indicated by S657 phosphorylation (39). To ascertain whether the PHSRN peptide specifically induces PI3K-dependent T505 phosphorylation of PKC{delta}, serum-free DU 145 cells were treated with the PHSRN peptide in the absence or presence of the PI3K inhibitor wortmannin, and levels of PKC{delta} pT505 and PKC{alpha} pS657 phosphorylation were evaluated by immunoblotting. As shown in Fig. 3D, PHSRN treatment of DU 145 cells significantly increases the amount of activated PKC{delta}, as shown by phosphorylation on T505, without affecting the amount of activated PKC{alpha} phosphorylated on S657. Furthermore, PHSRN-induced PCK{delta} phosphorylation on T505 seems to require PI3K, as shown by its sensitivity to wortmannin.

Role of MMP-1 in PHSRN-induced invasion by DU 145 cells. MMP-1, but neither MMP-2 nor MMP-9, is necessary for PHSRN-induced invasion by breast cancer cells and mammary epithelial cells (9). Thus, the role of MMP-1 was assessed in suspended DU 145 cells, treated with PHSRN peptide, and placed on SU-ECM invasion substrates. As shown in Fig. 4A , pretreatment with increasing concentrations of function-blocking anti-MMP-1 progressively blocked PHSRN-induced invasion by DU 145 cells, whereas the isotype control as well as elevated concentrations of blocking anti-MMP-2 or anti-MMP-9 had no effect. Thus, MMP-1 activity seems to be required specifically for {alpha}5ß1-mediated, PHSRN-induced invasion by DU 145 cells.


Figure 4
View larger version (33K):
[in this window]
[in a new window]
 
Figure 4. Specific requirement for MMP-1 in PHSRN-induced invasion. A, dependence of PHSRN-induced invasion on MMP-1. X axis, log antibody concentration (µg/mL); Y axis, percentage of cells invaded relative to appropriate isotype control antibody. bullet, COMY-4A2-blocking anti-MMP-1 mAb; {blacksquare}, IgG2a isotype control for anti-MMP-1; {circ}, CA-4001-blocking anti-MMP-2 mAb; {square}, GE-213-blocking anti-MMP-9 mAb. Points, mean; bars, first SD. B, correspondence of PHSRN-induced invasion and MMP-1 induction time courses. X axis, hours; Y axis, percentage of invaded cells. bullet, percentages of invaded DU 145 cells, treated with PHSRN peptide; {circ}, percentages of invaded DU 145 cells in the absence of added peptide; {blacktriangleup}, percentage of invaded DU 145 cells treated with the HSPNR scrambled peptide. Points, mean; bars, first SD for all treatments. Y axis, MMP-1 concentration (ng/mL). {blacksquare}, concentrations of secreted MMP-1. Points, mean; bars, first SD. C, example of an anti-MMP-1 immunoblot of DU 145 cell lysates after treatment with peptides: RN, Ac-PHSRN-NH2; LDV, Ac-LHGPEILDVPST-NH2; MMP-1, purified MMP-1 standard. Blot was reprobed with anti-actin antibody to show equal loading (actin).

 
The effect of the PHSRN peptide on MMP-1 activity, secreted into the medium by adherent DU 145 cells, was assessed by using a quantitative, colorimetric assay (40). As shown in Fig. 4B, secreted MMP-1 activity rapidly increased in the medium of DU 145 cultures in response to treatment with PHSRN peptide. Statistical analysis of the differences in MMP-1 activity between PHSRN-treated cells and untreated cells incubated in parallel cultures for the same periods of time showed P0 to be <0.0001 (data not shown). Moreover, the kinetics of MMP-1 secretion corresponded well with the time course of PHSRN-induced invasion also shown in Fig. 4B. The percentage of invaded cells was half-maximal in 1 hour and reached 80% of the maximal, 24-hour level in 4 hours. In addition, a 4-hour incubation of DU 145 cells on SU-ECM invasion substrates in the presence of an identical concentration of the scrambled HSPNR peptide control resulted in no detectable invasion. Thus, the time courses of PHSRN-induced invasion and PHSRN-induced MMP-1 secretion into the medium seem to correspond closely. This temporal correlation is consistent with the functioning of secreted MMP-1 in invasion by DU 145 cells.

Because active MMP-1 has been shown to associate with surface {alpha}2ß1 integrin collagen receptors during cell migration (41), these results suggest that exposure to the PHSRN peptide should also increase levels of MMP-1 in cell lysates. As reported previously for breast cancer cells (9), PHSRN peptide treatment also increased the levels of MMP-1 found in DU 145 cell lysates as shown in Fig. 4C. In contrast, exposure to an equimolar concentration of the LDV peptide ligand of the {alpha}4ß1 fibronectin receptor neither induced nor decreased MMP-1 expression, nor did it affect PHSRN-induced levels of MMP-1 despite its demonstrated role in regulating {alpha}5ß1-mediated MMP-1 expression in {alpha}5ß1+{alpha}4ß1+ cells (42). These results are consistent with the known lack of {alpha}4ß1 integrin fibronectin receptors on the surfaces of {alpha}5ß1+ DU 145 cells (11).

Role of FAK, PI3K, and PKC{delta} in PHSRN-induced MMP-1 expression. The functional roles of FAK and PKC{delta} in PHSRN-induced MMP-1 expression in cell lysates were assessed by overexpressing FAK, PKC{delta}, or nonspecific siRNA in DU 145 cells. As indicated by the immunoblot shown in Fig. 5A , PHSRN peptide treatment increased the levels of MMP-1 associated with DU 145 cells and in DU 145 cells expressing nonspecific siRNA. However, no PHSRN-induced increase in MMP-1 was observed in DU 145 cells expressing either FAK or PKC{delta} siRNA. Figure 5B presents the results of multiple immunoblots similar to the example shown in Fig. 5A. This histogram depicts the mean levels of MMP-1 in lysates of DU 145 cells relative to the serum-free control. As in the example above, PHSRN-induced MMP-1 expression occurred only in DU 145 cells and in the DU 145 cells overexpressing nonspecific siRNA; no MMP-1 induction was observed in DU 145 cells overexpressing FAK or PKC{delta} siRNA. Thus, consistent with the results for PHSRN-induced invasion, both FAK and PKC{delta} activities also seem to be required for PHSRN-induced MMP-1 expression.


Figure 5
View larger version (23K):
[in this window]
[in a new window]
 
Figure 5. Necessity of PI3K and PKC{delta} activities for MMP-1 induction by PHSRN. A, an example of an immunoblot comparing levels of MMP-1 in PHSRN-treated cells exposed to 1 nmol/L nonspecific, FAK, or PKC{delta} siRNA. The immunoblot was probed with anti-MMP-1 antibody, stripped, and reprobed with anti-actin antibody to show equal loading. Treatments: lane a, Ac-HSPNR-NH2-treated cells; lane b, Ac-PHSRN-NH2-treated cells; lane c, nonspecific RNA-expressing cells; lane d, nonspecific RNA-expressing cells treated with Ac-PHSRN-NH2; lane e, PKC{delta} siRNA-expressing cells; lane f, PKC{delta} siRNA-expressing cells treated with Ac-PHSRN-NH2; lane g, FAK siRNA-expressing cells; lane h, FAK siRNA-expressing cells treated with Ac-PHSRN-NH2. B, histogram comparing the relative levels of MMP-1 in PHSRN-treated cells exposed to 1 nmol/L nonspecific, FAK, or PKC{delta} siRNA and assayed by band density measurements on immunoblots. Treatments are as described in (A). Columns, mean; bars, first SD. Arrow, relative amounts of MMP-1 in lysates from duplicate untreated controls set to 1.0. C, prevention of PHSRN-induced MMP-1 activity by inhibitors of PI3K or PKC{delta}. X axis, treatment of cells: a, serum-free medium only; b, serum-free medium with PHSRN peptide; c, serum-free medium with PHSRN peptide and LY 294002; d, serum-free medium with PHSRN peptide and wortmannin; e, serum-free medium with PHSRN peptide and Rottlerin; f, serum-free medium with PHSRN peptide and Safingol. Y axis, total (active + latent) MMP-1 (ng/mL). Columns, mean; bars, first SD.

 
The requirements for PI3K and PKC{delta} activities in {alpha}5ß1-mediated invasion also suggested that they would be required for PHSRN-induced MMP-1 secretion. Thus, serum-free, adherent DU 145 cells were treated with either the LY294002 PI3K or the Rottlerin PKC{delta} inhibitors; then, MMP-1 secretion was induced with the PHSRN peptide. Duplicate wells of cells were treated with Safingol (37) before PHSRN treatment. As shown in Fig. 5C, PHSRN-induced MMP-1 secretion was reduced by ~6-fold, to background levels, by both PI3K and PKC{delta} inhibitors. However, the PKC{alpha} inhibitor had little effect on PHSRN-induced MMP-1 secretion. These results suggest that, consistent with their roles in PHSRN-induced invasion, PI3K and PKC{delta} also function in PHSRN-induced MMP-1 secretion.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We report that exposure of adherent, serum-starved DU 145 cells to the PHSRN peptide induces rapid phosphorylation of the FAK Y397 residue and FAK/PI3K p85 subunit association. Because FAK exhibits increased kinase activity and Y397 autophosphorylation after integrin activation (18), we evaluated the ability of the PHSRN peptide to induce PI3K activity. We found that PHSRN induces a burst of PI3K activity in DU 145 cells, which temporally corresponds to FAK Y397 phosphorylation and PI3K/FAK association. We tested the requirement for FAK in PHSRN-induced invasion by using the technique of RNAi (24) to down-regulate FAK expression specifically. We found that FAK siRNA treatment prevents PHSRN-induced DU 145 invasion, whereas nonspecific siRNA has no effect. We also found that, in addition to FAK, PI3K activity is required for PHSRN-induced invasion. Because the products of PI3K (PIP2 and PIP3) activate PKC{delta} directly (25), we assessed the role of PKC{delta} in PHSRN-induced invasion. By using siRNA and a specific inhibitor, we found that PKC{delta} also functions in PHSRN-induced invasion.

In addition, we found that, as observed previously for human breast cancer (9), MMP-1 activity is required for PHSRN-induced invasion by DU 145 cells, whereas gelatinases MMP-2 and MMP-9 do not seem to be involved. This is consistent with the abundant, native type I collagen found in SU-ECM (9). In addition, the time courses of PHSRN-induced invasion, FAK Y397 phosphorylation, FAK/PI3K p85 association, and MMP-1 secretion closely correspond. In addition, we found that PHSRN treatment up-regulates MMP-1 levels in the lysates of DU 145 cells as well as in their medium. Consistent with the roles of PI3K and PKC{delta} in {alpha}5ß1-mediated DU 145 invasion, their specific inhibitors, LY 294002 and Rottlerin, prevent PHSRN-induced MMP-1 secretion. We also observed that FAK and PKC{delta} siRNA prevent the accumulation of MMP-1 in lysates of PHSRN-treated DU 145 cells, whereas nonspecific siRNA has no effect. Thus, our results show the requirement for FAK, PI3K, and PKC{delta} activities in PHSRN-induced MMP-1 secretion as well as for invasion. Consistent with our results, the involvement of PI3K in {alpha}5ß1-mediated invasion has been observed for transformed mammary epithelial cells (10, 23). PI3K has also been shown to function in MMP-1-dependent invasion by Caco-2 colonic cancer epithelial cells (43).

These results suggest the intracellular signaling pathway for the induction of {alpha}5ß1-mediated invasion shown in Fig. 6 . PHSRN binding by {alpha}5ß1, in the absence of the {alpha}4ß1/pFn interaction, activates {alpha}5ß1 to induce FAK phosphorylation at Y397 and promote the FAK/PI3K p85 interaction. This brings the catalytic p110 subunit to the membrane, where it phosphorylates PIP2 to form PIP3, which then activates PKC{delta} (25). Interestingly, PKC{delta} has been shown to play an important role in regulating transcriptional activation of proinflammatory nuclear factor-{kappa}B (NF-{kappa}B)–dependent genes, such as the VCAM-1 gene in endothelial cells (44). Moreover, NF-{kappa}B can also activate MMP-1 gene expression (45); thus, we speculate that PKC{delta} activation by PI3K-generated PIP3 may function to stimulate MMP-1 expression in prostate cancer cells.


Figure 6
View larger version (22K):
[in this window]
[in a new window]
 
Figure 6. Intracellular signaling pathway for {alpha}5ß1-mediated invasion. Prostate cancer cell surface {alpha}5ß1 integrin is shown interacting with the PHSRN sequence of the pFn homodimer. As indicated, this interaction stimulates FAK phosphorylation on Y397, PI3K p85 association with FAK, and PI3K p110-mediated phosphorylation of PIP2 to form PIP3, which activates PKC{delta}. PKC{delta} activation then results in increased secretion of activated MMP-1 to facilitate invasion.

 
The model shown in Fig. 6 is also consistent with the requirements for FAK and PI3K in migration on a fibronectin substratum. Many studies suggest that FAK promotes cell migration on fibronectin. Furthermore, expression of various mutants in FAK knockout cells suggests that both the kinase activity of FAK and its Y397 PI3K p85-binding site are individually required for cell migration to fibronectin. Moreover, FAK pY397 is necessary for the association of FAK with PI3K in vivo (18). It has also been shown that PI3K binding is required for FAK to promote cell migration on fibronectin, whereas Src binding is not sufficient. Moreover, inhibition of PI3K was found to decrease cell migration significantly (46).

Integrins are crucial to prostate cancer progression and metastasis, especially because they can induce cancer cell migration and invasion. Our previous research has focused on the importance of {alpha}5ß1 in mediating the constitutive invasiveness of metastatic prostate and breast cancer cells. We have shown that {alpha}5ß1 interacts with the PHSRN sequence of the fibronectin cell-binding domain (2, 6, 9) to induce invasion. Many lines of metastatic prostate and breast cancer cells are constitutively invasive because they lack cell surface {alpha}4ß1 integrin (10, 11), which interacts with a distinct site on fibronectin to repress {alpha}5ß1-mediated MMP-1 expression (42) and invasion (9). Several studies have also shown increased {alpha}5ß1 integrin on cell surfaces in sectioned human and rat prostate cancer tumors relative to normal prostate tissue and observed that {alpha}5ß1 integrin increases with loss of tumor cell differentiation, increased Gleason score, local progression, or metastasis (47, 48).

MMP-1 expression is a marker for tumor progression in many other types of cancer (49), and high levels of MMP-1 expression correlate with a poor prognosis (50). Moreover, increased MMP-1 expression in tumor cells is significantly correlated with the depth of tumor invasion, angiogenesis, lymphangiogenesis, and presence of local and distant metastases (51).

Sectioned primary tumors from radical prostatectomies exhibit reduced MMP-1 levels, consistent with the limited tissue destruction observed in many primary prostate tumors (52). In contrast, sections from prostatic bone marrow metastases exhibit strong immunostaining for MMP-1, and patient-derived, metastatic prostate cancer cells, cocultured with bone marrow stroma, also strongly stain for MMP-1. Based on these results, it was suggested that up-regulation of MMP-1 secretion may be an important factor in the formation of prostate cancer metastases (53). Consistent with the potentially causal relationship between MMP-1 expression and malignancy, MMP-1 expression is also significantly higher in the more aggressive prostate cancer cell lines and sublines (54). Interestingly, MMP-1 also cleaves entactin, thus contributing directly to the degradation of basement membrane and hence potentially to the transiting of epithelial barriers by tumor cells (55), in addition to stromal proteolysis. Thus, although many MMPs contribute to tumor angiogenesis and metastasis, MMP-1 may be critical for the development of the invasive phenotype during cancer progression. Our results suggest that the interaction of {alpha}5ß1 integrin with the fibronectin PHSRN sequence and the resulting activation of FAK, PI3K, and PKC{delta} are very important steps in the intracellular signaling pathway leading to MMP-1-dependent invasion by metastatic human prostate cancer cells.


    Acknowledgments
 
Grant support: Attenuon L.L.C. (San Diego, CA) research grant (D.L. Livant) and University of Michigan summer research fellowship for medical students (N.J. Hahn).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Drs. Andrew Mazar and Graham Parry (Attenuon) for many helpful discussions and for peptide preparations, Dr. R.K. Brabec for assistance in the analyses of MMP-1 activities, and the laboratory of Dr. Theodore Lawrence for the use of their microplate spectrophotometer and their fluorescence microscope.


    Footnotes
 
Note: Z-Z. Zeng and Y. Jia contributed equally to this work.

Current address for Y. Jia: Laboratory of Pathology, Center for Cancer Research, National Cancer Institute, NIH, Building 10, Room 2A29, Bethesda, MD 20892-1500.

1 http://rsb.info.nih.gov/ij/. Back

Received 12/21/05. Revised 5/ 1/06. Accepted 6/13/06.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Hynes RO. Integrins: bidirectional, allosteric signaling machines. Cell 2002;110:673–87.[CrossRef][Medline]
  2. Livant DL, Brabec RK, Kurachi K, et al. The PHSRN sequence induces extracellular matrix invasion and accelerates wound healing in obese diabetic mice. J Clin Invest 2000;105:1537–45.[Medline]
  3. Livant DL. Targeting invasion induction as a therapeutic strategy for the treatment of cancer. Curr Cancer Drug Targets 2005;5:489–503.[CrossRef][Medline]
  4. Brakebusch C, Bouvard D, Stanchi F, Sakai T, Fassler R. Integrins in invasive growth. J Clin Invest 2002;109:999–1006.[CrossRef][Medline]
  5. Maschler S, Wirl G, Spring H, et al. Tumor cell invasiveness correlates with changes in integrin expression and localization. Oncogene 2005;24:2032–41.[CrossRef][Medline]
  6. Livant DL, Brabec RK, Pienta KJ, et al. Anti-invasive, antitumorigenic, and anti-metastatic activities of the PHSCN sequence in prostate carcinoma. Cancer Res 2000;60:309–20.[Abstract/Free Full Text]
  7. Gibson AW, Burke RD. Migratory and invasive behavior of pigment cells in normal and animalized sea urchin embryos. Exp Cell Res 1987;173:546–57.[CrossRef][Medline]
  8. Noel AC, Calle A, Emonard HP, et al. Invasion of reconstituted basement membrane matrix is not correlated to the malignant metastatic cell phenotype. Cancer Res 1991;51:405–14.[Abstract/Free Full Text]
  9. Jia Y, Zeng ZZ, Markwart SM, et al. Integrin fibronectin receptors in matrix metalloproteinase-1-dependent invasion by breast cancer and mammary epithelial cells. Cancer Res 2004;64:8674–81.[Abstract/Free Full Text]
  10. Woods Ignatoski KM, Grewal NK, Markwart SM, Livant DL, Ethier SP. p38 MAPK induces cell surface {alpha}4 integrin downregulation to facilitate erbB-2 mediated invasion. Neoplasia 2003;5:128–34.[Medline]
  11. Rokhlin OW, Cohen MB. Expression of cellular adhesion molecules on human prostate tumor cell lines. Prostate 1995;26:205–12.[Medline]
  12. Mosher DF. Physiology of fibronectin. Annu Rev Med 1984;35:561–75.[CrossRef][Medline]
  13. Schaller MD, Borgman CA, Cobb BS, Vines RR, Reynolds AB, Parsons JT. pp125FAK, a structurally distinctive protein-tyrosine kinase associated with focal adhesions. Proc Natl Acad Sci U S A 1992;89:5192–6.[Abstract/Free Full Text]
  14. Lipfert L, Haimovich B, Schaller MD, Cobb BS, Parsons JT, Brugge JS. Integrin-dependent phosphorylation and activation of the protein tyrosine kinase pp125FAK in platelets. J Cell Biol 1992;119:905–12.[Abstract/Free Full Text]
  15. Chan PY, Kanner SB, Whitney G, Aruffo A. A transmembrane-anchored chimeric focal adhesion kinase is constitutively activated and phosphorylated at tyrosine residues identical to pp125FAK. J Biol Chem 1994;269:20567–74.[Abstract/Free Full Text]
  16. Tremblay L, Hauck W, Aprikian AG, Begin LR, Chapdelaine A, Chevalier S. Focal adhesion kinase (pp125FAK) expression, activation and association with paxillin and p50CSK in human metastatic prostate carcinoma. Int J Cancer 1996;68:164–71.[Medline]
  17. Huang YT, Lee LT, Lee PP, Lin YS, Lee MT. Targeting of focal adhesion kinase by flavonoids and small-interfering RNAs reduces tumor cell migration ability. Anticancer Res 2005;25:2017–25.[Abstract/Free Full Text]
  18. Chen HC, Appeddu PA, Isoda H, Guan JL. Phosphorylation of tyrosine 397 in focal adhesion kinase is required for binding phosphatidylinositol 3-kinase. J Biol Chem 1996;271:26329–34.[Abstract/Free Full Text]
  19. Cary LA, Guan JL. Focal adhesion kinase in integrin-mediated signaling. Front Biosci 1999;4:D102–13.[Medline]
  20. Shaw LM, Rabinovitz I, Wang HH, Toker A, Mercurio AM. Activation of phosphoinositide 3-OH kinase by the {alpha}6ß4 integrin promotes carcinoma invasion. Cell 1997;91:949–60.[CrossRef][Medline]
  21. Veit C, Genze F, Menke A, et al. Activation of phosphatidylinositol 3-kinase and extracellular signal-regulated kinase is required for glial cell line-derived neurotrophic factor-induced migration and invasion of pancreatic cancinoma cells. Cancer Res 2004;64:5291–300.[Abstract/Free Full Text]
  22. Samuels Y, Diaz LA, Jr., Schmidt-Kittler O, et al. Mutant PIK3CA promotes cell growth and invasion of human cancer cells. Cancer Cell 2005;7:561–73.[CrossRef][Medline]
  23. Woods Ignatoski KM, Livant DL, Markwart S, Grewal NK, Ethier SP. The role of phosphatidylinositol 3'-kinase and its downstream signals in erbB-2-mediated transformation. Mol Cancer Res 2003;1:551–60.[Abstract/Free Full Text]
  24. Caplen NJ, Mousses S. Short interfering RNA (siRNA)-mediated RNA interference (RNAi) in human cells. Ann N Y Acad Sci 2003;1002:56–62.[CrossRef][Medline]
  25. Toker A, Meyer M, Reddy KK, et al. Activation of protein kinase C family members by the novel polyphosphoinositides PtdIns-3,4-P2 and PtdIns-3,4,5-P3. J Biol Chem 1994;269:32358–67.[Abstract/Free Full Text]
  26. Stone KR, Mickey DD, Wunderli H, Mickey GH, Paulson DF. Isolation of a human prostate carcinoma cell line (DU 145). Int J Cancer 1978;21:274–81.[Medline]
  27. Birkedal-Hansen B, Moore WG, Taylor RE, Bhown AS, Birkedal-Hansen H. Monoclonal antibodies to human fibroblast procollagenase. Inhibition of enzymatic activity, affinity purification of the enzyme, and evidence for clustering of epitopes in the NH2-terminal end of the activated enzyme. Biochemistry 1988;27:6751–8.[CrossRef][Medline]
  28. Fridman R, Fuerst TR, Bird RE, et al. Domain structure of human 72-kDa gelatinase/type IV collagenase. Characterization of proteolytic activity and identification of the tissue inhibitor of metalloproteinase-2 (TIMP-2) binding regions. J Biol Chem 1992;267:15398–405.[Abstract/Free Full Text]
  29. Schnaper HW, Grant DS, Stetler-Stevenson WG, et al. Type IV collagenase(s) and TIMPs modulate endothelial cell morphogenesis in vitro. J Cell Physiol 1993;156:235–46.[CrossRef][Medline]
  30. Hutchinson DS, Bengtsson T. {alpha}1A-Adrenoceptors activate glucose uptake in L6 muscle cells through a phospholipase C-, phosphatidylinositol-3 kinase-, and atypical protein kinase C-dependent pathway. Endocrinology 2005;146:901–12.[Abstract/Free Full Text]
  31. Yoshida K, Wang HG, Miki Y, Kufe D. Protein kinase C{delta} is responsible for constitutive and DNA damage-induced phosphorylation of Rad9. EMBO J 2003;22:1431–41.[CrossRef][Medline]
  32. MacKeigan JP, Murphy LO, Blenis J. Sensitized RNAi screen of human kinases and phosphatases identifies new regulators of apoptosis and chemoresistance. Nat Cell Biol 2005;7:591–600.[CrossRef][Medline]
  33. Denizot F, Lang R. Rapid colorimetric assay for cell growth and survival. Modifications to the tetrazolium dye procedure giving improved sensitivity and reliability. J Immunol Methods 1986;89:271–7.[CrossRef][Medline]
  34. Slack JK, Adams RB, Rovin JD, et al. Alterations in the focal adhesion kinase/Src signal transduction pathway correlate with increased migratory capacity of prostate carcinoma cells. Oncogene 2001;20:1152–63.[CrossRef][Medline]
  35. Han EK, Mcgonigal T, Wang J, Giranda VL, Luo Y. Functional analysis of focal adhesion kinase (FAK) reduction by small inhibitory RNAs. Anticancer Res 2004;24:3899–905.[Abstract/Free Full Text]
  36. Gschwendt M, Muller HJ, Kielbassa K, et al. Rottlerin, a novel protein kinase inhibitor. Biochem Biophys Res Commun 1994;199:93–8.[CrossRef][Medline]
  37. Martiny-Baron G, Kazanietz MG, Mischak H, et al. Selective inhibition of protein kinase C isozymes by the indolocarbazole Gö 6976. J Biol Chem 1993;268:9194–7.[Abstract/Free Full Text]
  38. Le Good JA, Ziegler WH, Parekh DB, Alessi DR, Cohen P, Parker PJ. Protein kinase C isotypes controlled by phosphoinositide 3-kinase through the protein kinase PDK 1. Science 1998;281:2042–5.[Abstract/Free Full Text]
  39. Gysin S, Imber R. Replacement of Ser657 of protein kinase C-{alpha} by alanine leads to premature down regulation after phorbol-ester-induced translocation to the membrane. Eur J Biochem 1996;240:747–50.[Medline]
  40. Verheijen JH, Nieuwenbroek NM, Beekman B, et al. Modified proenzymes as artificial substrates for proteolytic enzymes: colorimetric assay of bacterial collagenase and matrix metalloproteinase activity using modified pro-urokinase. Biochem J 1997;323:603–9.[Medline]
  41. Dumin JA, Dickeson SK, Stricker TP, et al. Pro-collagenase-1 (matrix metalloproteinase-1) binds the {alpha}(2)ß(1) integrin upon release from keratinocytes migrating on type I collagen. J Biol Chem 2001;276:29368–74.[Abstract/Free Full Text]
  42. Huhtala P, Humphries MJ, McCarthy JB, Tremble PM, Werb Z, Damsky CH. Cooperative signaling by {alpha}5ß1 and {alpha}4ß1 integrins regulates metalloproteinase gene expression in fibroblasts adhering to fibronectin. J Cell Biol 1995;129:867–79.[Abstract/Free Full Text]
  43. Kermorgant S, Aparicio T, Dessirier V, Lewin MJ, Lehy T. Hepatocyte growth factor induces colonic cancer cell invasiveness via enhanced motility and protease overproduction. Evidence for PI3 kinase and PKC involvement. Carcinogenesis 2001;22:1035–42.[Abstract/Free Full Text]
  44. Minami T, Abid MR, Zhang J, King G, Kodama T, Aird WC. Thrombin stimulation of vascular adhesion molecule-1 in endothelial cells is mediated by protein kinase C (PKC)-{delta}-NF-{kappa}B and PKC-{zeta}-GATA signaling pathways. J Biol Chem 2003;278:6976–84.[Abstract/Free Full Text]
  45. Barchowsky A, Frleta D, Vincenti MP. Integration of the NF-{kappa}B and mitogen-activated protein kinase-AP-1 pathways at the collagenase-1 promoter: divergence of IL-1 and TNF-dependent signal transduction in rabbit primary synovial fibroblasts. Cytokine 2000;12:1469–79.[CrossRef][Medline]
  46. Reiske HR, Kao SC, Cary LA, Guan JL, Lai JF, Chen HC. Requirement of phosphatidylinositol 3-kinase in focal adhesion kinase-promoted cell migration. J Biol Chem 1999;274:12361–6.[Abstract/Free Full Text]
  47. MacCalman CD, Brodt P, Doublet JD, et al. The loss of E-cadherin mRNA transcripts in rat prostatic tumors is accompanied by increased expression of mRNA transcripts encoding fibronectin and its receptor. Clin Exp Metastasis 1994;12:101–7.[CrossRef][Medline]
  48. Murant SJ, Handley J, Stower M, Reid N, Cussenot O, Maitland NJ. Co-ordinated changes in expression of cell adhesion molecules in prostate cancer. Eur J Cancer 1997;33:263–71.[CrossRef][Medline]
  49. Brinckerhoff CE, Rutter JL, Benbow U. Interstitial collagenases as markers of tumor progression. Clin Cancer Res 2000;6:4823–30.[Abstract/Free Full Text]
  50. Murray GI, Duncan ME, O'Neil P, Melvin WT, Fothergill JE. Matrix metalloproteinase-1 is associated with poor prognosis in colorectal cancer. Nat Med 1996;2:461–2.[CrossRef][Medline]
  51. Shiozawa J, Ito M, Nakayama T, Nakashima M, Kohno S, Sekine I. Expression of matrix metalloproteinase-1 in human colorectal carcinoma. Mod Pathol 2000;13:925–33.[CrossRef][Medline]
  52. Varani J, Hattori Y, Dame MK, et al. Matrix metalloproteinases (MMPs) in fresh human prostate tumour tissue and organ-cultured prostate tissue: levels of collagenolytic and gelatinolytic MMPs are low, variable and different in fresh tissue versus organ-cultured tissue. Br J Cancer 2001;84:1076–83.[CrossRef][Medline]
  53. Hart CA, Scott LJ, Bagley S, Bryden AA, Clarke NW, Lang SH. Role of proteolytic enzymes in human prostate bone metastasis formation: in vivo and in vitro studies. Br J Cancer 2002;86:1136–42.[CrossRef][Medline]
  54. Daja MM, Niu X, Zhao Z, Brown JM, Russell PJ. Characterization of expression of matrix metalloproteinases and tissue inhibitors of metalloproteinases in prostate cancer cell lines. Prostate Cancer Prostatic Dis 2003;6:15–26.[CrossRef][Medline]
  55. Sires UI, Griffin GL, Broekelmann TJ, et al. Degradation of entactin by matrix metalloproteinases. Susceptibility to matrilysin and identification of cleavage sites. J Biol Chem 1993;268:2069–74.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
CarcinogenesisHome page
L. Peng, Y.-L. Ran, H. Hu, L. Yu, Q. Liu, Z. Zhou, Y.-M. Sun, L.-C. Sun, J. Pan, L.-X. Sun, et al.
Secreted LOXL2 is a novel therapeutic target that promotes gastric cancer metastasis via the Src/FAK pathway
Carcinogenesis, October 1, 2009; 30(10): 1660 - 1669.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Ohta, M. Hayashi, T. Kanemaru, K. Abe, Y. Ito, and M. Oike
Dual Modulation of Airway Smooth Muscle Contraction by Th2 Cytokines via Matrix Metalloproteinase-1 Production
J. Immunol., March 15, 2008; 180(6): 4191 - 4199.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. Villar, M. I. Arenas, C. M. MacCarthy, M. J. Blanquez, O. M. Tirado, and V. Notario
PCPH/ENTPD5 Expression Enhances the Invasiveness of Human Prostate Cancer Cells by a Protein Kinase C{delta} Dependent Mechanism
Cancer Res., November 15, 2007; 67(22): 10859 - 10868.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zeng, Z.-Z.
Right arrow Articles by Livant, D. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zeng, Z.-Z.
Right arrow Articles by Livant, D. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online