Cancer Research Meeting Calendar  Telomeres
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gupta, A.
Right arrow Articles by Rawwas, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gupta, A.
Right arrow Articles by Rawwas, J.
[Cancer Research 66, 8100-8108, August 15, 2006]
© 2006 American Association for Cancer Research


Cell, Tumor, and Stem Cell Biology

Cellular Retinoic Acid–Binding Protein II Is a Direct Transcriptional Target of MycN in Neuroblastoma

Anu Gupta1, Bryan R.G. Williams1, Samir M. Hanash2 and Jawhar Rawwas1

1 Department of Cancer Biology, Lerner Research Institute, Cleveland Clinic, Cleveland, Ohio and 2 Fred Hutchinson Cancer Research Center, Seattle, Washington

Requests for reprints: Jawhar Rawwas, Pediatric Hematology and Oncology, Children's Hospitals and Clinics of Minnesota, Mail Stop 32-4150, 2525 Chicago Avenue South, Minneapolis, MN 55404. Phone: 612-813-6772; Fax: 612-813-6325; E-mail: Jawhar.Rawwas{at}childrensmn.org.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Neuroblastoma is a heterogeneous disease in which 22% of tumors show MycN oncogene amplification and are associated with poor clinical outcome. MycN is a transcription factor that regulates the expression of a number of proteins that affect the clinical behavior of neuroblastoma. We report here that cellular retinoic acid–binding protein II (CRABP-II) is a novel MycN target, expressed at significantly higher levels in primary neuroblastoma tumors with mycN oncogene amplification as compared with non–MycN-amplified tumors. Moreover, regulated induction and repression of MycN in a neuroblastoma-derived cell line resulted in temporal and proportionate expression of CRABP-II. CRABP-II is expressed in several cancers, but its role in tumorigenesis has not been elucidated. We show that MycN binds to the promoter of CRABP-II and induces CRABP-II transcription directly. In addition, CRABP-II-transfected neuroblastoma cell lines show an increase in MycN protein levels resulting in increased cell motility. Gene expression profiling of CRABP-II-expressing cell lines uncovered increased expression of the HuB (Hel N1) gene. Hu proteins have been implicated in regulating the stability of MycN mRNA and other mRNAs by binding to their 3' untranslated regions. We did not, however, observe any change in MycN mRNA stability or protein half-life in response to CRABP-II expression. In contrast, de novo MycN protein synthesis was increased in CRABP-II-expressing neuroblastoma cells, thereby suggesting an autoregulatory loop that might exacerbate the effects of MycN gene amplification and affect the clinical outcome. Our findings also suggest that CRABP-II may be a potential therapeutic target for neuroblastoma. (Cancer Res 2006; 66(16): 8100-8)


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Neuroblastoma is a childhood malignancy of neuroectodermal origin. Tumors of limited stage that contain a nonamplified MycN gene may undergo differentiation and spontaneous regression. In contrast, tumors diagnosed beyond infancy and that contain an amplified MycN gene are aggressive and undergo rapid progression (1, 2). Approximately 40% of neuroblastoma tumors from advanced stage patients show genomic amplification of the MycN oncogene, usually accompanied by an increase in MycN protein expression (3, 4). The MycN oncogene clearly plays an important role in the development of neuroblastoma as it was shown to induce neuroblastoma tumors in a transgenic mouse model (5). Thus, the mechanism by which amplification and/or overexpression of the MycN gene alters tumor cell behavior has considerable relevance to our understanding of the biology of this tumor. In previous studies of protein expression in neuroblastoma using two-dimensional PAGE, we identified a number of proteins, including nucleoside diphosphate kinase A (6), proliferating cell nuclear antigen (7), oncoprotein 18 (8), and the heat shock protein, Hsp27 (9), whose expression correlated with MycN oncogene amplification. In this study, using two-dimensional PAGE, we identified cellular retinoic acid–binding protein II (CRABP-II) as one of the proteins expressed in MycN-amplified tumors. CRABP-II is one of the two cellular retinoic acid (RA)–binding proteins that have been identified to date, and is implicated in the retinoid-signaling pathway. The CRABP-I and CRABP-II proteins are encoded by different genes, and although they exhibit a high degree of homology, their predicted isoelectric points, and tissue distributions during embryonic development are different (10, 11).

CRABP-II is induced by RA in RA-responsive cell types and can associate with the RA receptors retinoic acid receptor-{alpha} or retinoid X receptor-{alpha} in a ligand-dependent manner. This association leads to the translocation of CRABP-II to the nucleus where it acts as a transcriptional regulator in RA-mediated signaling (12).

CRABP-II expression has been reported in a wide variety of human cancers. CRABP-II is overexpressed in breast cancer cell lines and primary breast tumors as compared with normal breast tissues (13). In addition, both CRABP-I and CRABP-II were differentially expressed in primary ovarian carcinomas as compared with normal ovary (14). In addition, overexpression of CRABP-II has been observed in uterine leiomyoma (15) and promyelocytic leukemia (16, 17). In Wilms tumors, CRABP-II overexpression has been correlated with poor clinical outcome (18). In head and neck squamous cell carcinoma, CRABP-II antisense treatment led to a decrease in cell invasion (19). Overexpression of CRABP-II in melphalan-resistant MCF7 (20) and phorbol ester–resistant keratinocytes has also been reported, suggesting its role in drug resistance (21). Taken together, these studies suggest that CRABP-II may play an important role in cancer development (1319, 22), however, the nature of that role remains unclear.

In this study, we show that CRABP-II is directly regulated by MycN and that CRABP-II induces the Hu proteins Hel-N1 (HuB) and HuD. Hel-N1 and HuD are human neuron–specific RNA-binding proteins that share significant homology with Drosophila ELAV and are involved in mRNA stability or translation. Hel-N1 binds in vitro to the 3' untranslated regions (UTR) of several AU-rich mRNAs, including c-Myc, c-Fos, G/Mcsf, and the transcriptional repressor Id leading to enhanced mRNA stability (23). Both HuD and Hel-N1 bind to the 3'-UTR of the MycN mRNA and increase its stability in neuroblastoma (24, 25). In other systems, HuB and HuD stabilize RNAs associated with polysomes, thereby increasing their translation (26, 27). In our study, we observed that increased Hu protein levels do not stabilize MycN mRNA, but do promote its translation. Moreover, we identify a feedback loop in which MycN amplification leads to CRABP-II up-regulation and subsequent Hu overexpression. The increased levels of Hu result in still higher levels of MycN protein, leading to an increase in cell migration, thereby exacerbating the effect of MycN gene amplification.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Neuroblastoma tumors. Fifty primary neuroblastoma tumors were obtained at the time of diagnosis (prior to any therapy) and represented all clinical stages of the disease from localized stages I and II (n = 15) to advanced stages III and IV [MycN amplified (n = 14), MycN nonamplified (n = 17) and stage 4S (n = 4)]. MycN gene copy number was determined by Southern blot analysis and quantitative densitometry as previously described (1).

Two-dimensional PAGE and quantitation of protein. Two-dimensional PAGE for all the tumors was done as previously described (28). In most cases, 20 to 30 µL aliquots containing ~70 µg of protein were immediately applied onto isofocusing gels. Protein spots in gels were visualized using a silver staining technique (29) and quantified as described previously (30). The identification of CRABP-II in MycN-amplified tumors was done as previously described in our two-dimensional analysis of neuroblastoma proteins (31).

Cell cultures. Four MycN-amplified cell lines, SMS-KCNR, NUB6, LAN5, and IMR-32, and four MYCN single copy cell lines SK-N-SH, SK-N-AS, SH-EP, and SH-SY5Y were grown in either DMEM supplemented with 10% FCS.

Chromatin immunoprecipitation. SH-EP tet-21 cells were grown in RPMI with 1% SERUM in the presence or absence of tetracycline for 3 days. The chromatin immunoprecipitation procedure was done essentially as described by Boyd and Farnham (32). The IMR-32 cell line, which expresses both MycN and CRABP-II, was used as a positive control. Immunoprecipitation was done with antibodies specific to MycN and with an isotype-matched IgG control. Twenty microliters of each chromatin sample was reserved as the total input DNA. The immunoprecipitated chromatin fragments were purified and used as the template for standard PCR reactions using primers complimentary to the promoter region –1139 to –1361: 5'-CTGGGACCAGATGTAGGGTT-3' and 5'-CGGAAACCGCAGAGGAGCG 3'.

CRABP-II transfection. The full-length CRABP-II was amplified from IMR-32 using primers 5'-CGGATTCCGCGCCGCCACCATGCCCAACTT-3' forward and 5'-CGGTCTAGATCATCACTCTCGGACGTAGAC-3' reverse and cloned into the EcoRI and XbaI sites of the pcDNA3 expression vector (Invitrogen, Carlsbad, CA). This construct was transfected into the SH-EP, SK-N-SH, and NUB-6 cell lines and a stably transfected pool of cells was selected in medium containing 400 µg/mL of G418.

Wound healing assay. Cells were grown in 60 mm dishes to form confluent monolayers and wounds were made with a pipette tip. The cell debris was removed and the cultures were incubated in DMEM containing FCS. After 24 and 48 hours, healing was evaluated under a phase contrast microscope and photographed at x200 magnification. The percentage of wound filling was calculated by measuring the remaining gap space on the pictures.

Cell migration assay. Migration assays were done in Costar Transwell cell culture inserts (8 µm size; Costar Corning Incorporation, Cambridge, MA). Cells (1 x 105) were seeded in transwells in triplicates under serum-free conditions and DMEM with serum was added to the bottom well. The cells were allowed to migrate for 16 hours and stained with 1% crystal violet. For short interfering RNA (siRNA) experiments, 50 nmol/L of the control and CRABP-II siRNA (Santa Cruz Biotechnology, Santa Cruz, CA) were transfected into IMR-32 cells, and after 48 hours, 105 cells were seeded in each well (in triplicate).

cDNA microarrays. Array construction, RNA labeling, and acquisition and normalization of data were as described and the microarray comprised of IFN-stimulated genes and AU-rich genes was used for Table 1A (33). A tumor array was used to generate data for Table 1B. Total RNA was isolated with TRIzol reagent (Invitrogen) from SH-EP mock transfectants and SH-EP CRABP-II transfectants. Subsequent to RNA reverse transcription and cohybridization with labeled cDNA, slides were washed and scanned on a GenePix 4000A scanner (Axon). Raw fluorescence data were acquired with the GenePix 4000B laser scanner and Geneprix pro 5.1 software as described (34).


View this table:
[in this window]
[in a new window]
 
Table 1. Gene expression in CRABP-II overexpressing cells

 
Measurement of mRNA half-life. NUB-6 mock transfectants and CRABP-II-transfected cells were treated with 10 µg/mL of actinomycin D and the cells were harvested at the indicated time points for total RNA isolation. After reverse transcription, the cDNA obtained was used for quantitative RT-PCR using SYBR green reagent (Bio-Rad, Hercules, CA). The primers used for MycN were 5'-CGACCACAAGGCCCTCAGTA-3' and 5'-CAGCCTTGGTGTTGGAGGAG-3'and for glyceraldehyde-3-phosphate dehydrogenase (GAPDH): 5'-GAAACTGTGGCGTGATGGC-3' and 5'-CACCACTGACACGTTGGCAG-3' with an initial denaturation at 94°C for 3 minutes and subsequently at 94°C for 30 seconds and 60°C for 30 seconds. The calculated threshold values were determined by maximum curvature approach and {Delta}Ct was calculated as Ct GAPDH minus Ct MYCN. The values were plotted as a percentage of the control.

Determination of half life of protein and de novo protein synthesis. The NUB-6 mock and CRABP-II-transfected cells were plated in equal numbers a day before the experiment, and cycloheximide was added to the cells at a concentration of 10 µg/mL. Cells were harvested at the indicated time points. For metabolic labeling, 100 µCi/mL of 35S methionine was added for 45 minutes and harvested at various time points. Three hundred micrograms of the total protein for each sample was precleared with isotype-matched antibody followed by immunoprecipitation with anti-MycN antibody. The immunoprecipitated samples were run on SDS-PAGE and amplified (Amersham Bioscience, Piscataway, NJ) and exposed to X-ray film.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CRABP-II is overexpressed in neuroblastoma tumors with MycN amplification. In two-dimensional gel analysis of a set of neuroblastoma tumors, we noted a 15 kDa polypeptide differentially expressed in MycN-amplified tumors and MycN single copy (Fig. 1A ). The protein was identified as CRABP-II, as previously described (31, 35). The identity of the differentially expressed polypeptide as CRABP-II was also confirmed by Western blot analysis as previously described (36). Among 31 advanced stage tumors, CRABP-II expression was observed in only 5 of the 17 tumors with a single copy MycN (29%). In contrast, 9 of the 14 MycN-amplified tumors showed high CRABP-II expression (64%). The mean integrated intensity of the CRABP-II polypeptide spot on two-dimensional gels was 5-fold greater in the tumors with amplified MycN than in the single copy tumors (P = 0.003; Fig. 1B). The difference in mean integrated intensity between the two groups corresponded approximately to a 10-fold difference in protein amounts, based on previous quantitative studies of proteins visualized in silver stained two-dimensional gels (30).


Figure 1
View larger version (21K):
[in this window]
[in a new window]
 
Figure 1. Expression of CRABP-II in neuroblastoma. A, representative two-dimensional SDS-PAGE of neuroblastoma tumors with or without MycN amplification. A total of 31 advanced stage tumors were analyzed by two-dimensional SDS-PAGE, of which 17 were MycN single copy and 14 were MycN amplified. Arrows, three differentially expressed proteins including CRABP-II, which shows significantly higher expression in MycN-amplified tumors. B, mean integrated intensity of CRABP-II spot visualized on silver-stained two-dimensional SDS-PAGE gels is plotted for 17 MycN single copy and 14 MycN amplified tumors (P = 0.003). The spot intensity was normalized to the intensities of all spots on the gel to control for differences in protein loading. The lines represent the medians for each group. C, Western blot showing expression of MycN and CRABP-II proteins in a panel of neuroblastoma cell lines. NUB6, LAN5, SMS-KCNR, and IMR-32 are MycN-amplified cell lines whereas SK-N-SH, SH-EP, and SK-N-AS have a single copy of MycN. SK-N-AS, overexpresses c-myc. The same blot was stripped and probed with ß-actin antibody.

 
Correlation between CRABP-II levels and MycN in cell lines. Several neuroblastoma cell lines (SK-N-SH, SK-N-AS, SH-EP, NUB-6, LAN-5, KCNR, and IMR-32) were analyzed by Western blotting for MycN and CRABP-II protein expression (Fig. 1C). A positive correlation was observed between MycN and CRABP-II levels in five out of seven cell lines. SK-N-SH and SH-EP do not express MycN and do not show CRABP-II expression. LAN-5 and IMR-32 have MycN gene amplification and express high levels of MycN protein. These two cell lines also express CRABP-II. SK-N-AS, which shows high levels of CRABP-II in the absence of MycN expression, is known to express high levels of c-myc, which substitutes for MycN functionally (37). NUB-6 and SMS-KCNR do not express CRABP-II because of CRABP-II promoter methylation in these cell lines.3

MycN expression regulates CRABP-II levels. To directly examine the effect of MycN expression on CRABP-II levels, we used a tetracycline-regulated expression system. SHEP tet-21 cells express MycN upon removal of tetracycline from the growth medium. When SHEP tet-21 cells were cultured in 10% serum, we observed a gradual increase in CRABP-II levels with respect to the number of days in culture, irrespective of MycN expression (data not shown). To reduce CRABP-II regulation by other factors present in the serum, the cells were cultured in 1% serum, which resulted in modest basal levels of CRABP-II. Although CRABP-II levels increased from day 0 to day 1, they remained stable thereafter. Under these conditions, and following MycN induction by tetracycline withdrawal, CRABP-II was significantly induced at day 3 (Fig. 2A ). Re-addition of tetracycline shut off MycN expression and was accompanied by a coordinated decrease in CRABP-II levels (Fig. 2A). CRABP-II levels decreased as early as 4 hours after tetracycline re-addition, suggesting that the regulation of CRABP-II by MycN is likely direct. The experiment was also done with 10% charcoal dextran–treated serum to reduce the effect of other growth factors on the expression of CRABP-II (Fig. 2B). Again, when cells were grown in the presence of tetracycline to shut off MycN expression, no CRABP-II expression was detected. However, upon removal of tetracycline from the medium, a gradual increase in MycN level was observed from days 1 to 5, and this was accompanied by the induction of CRABP-II expression.


Figure 2
View larger version (16K):
[in this window]
[in a new window]
 
Figure 2. Regulation of CRABP-II expression by MycN. A, SH-EP tet-21 cells were grown in RPMI with 1% serum with or without tetracycline (1 µg/mL) and samples were harvested after 1 or 3 days as indicated. Tetracycline was added back to the cells after they were cultured without tetracycline for 3 days. Cells were harvested at 4 and 8 hours and the expression of MycN, CRABP-II, and ß-actin was determined by Western blot. B, SH-EP tet-21 cells were grown in RPMI with 10% charcoal dextran–treated serum with or without tetracycline (1 µg/mL), and samples were harvested after 1, 3, and 5 days as indicated, and protein expression was analyzed by Western blot. C, chromatin immunoprecipitation shows binding of MycN to the CRABP-II promoter. SH-EP tet-21 cells were cultured in RPMI containing 1% serum with or without tetracycline for 3 days. Chromatin from these cells was immunoprecipitated using anti-MycN antibody or IgG control. The immunoprecipitates were used as a template to amplify a 228-bp fragment using primers from –1139 to –1361 of the CRABP-II promoter region containing a predicted MycN binding site. IMR-32, which expresses both CRABP-II and MycN, was used as a positive control. The PCR products were separated on a 2% agarose gel. Input, the starting material before immunoprecipitation. D, chromatin immunoprecipitation shows that binding of MYCN to the CRABP-II promoter is specific. Immunoprecipitate obtained from IMR-32 with IgG or MYCN antibody were amplified using primers from –454 to –340 (E box I) and primers from –1139 to –1361 (E box II) to show the specificity of MYCN binding to E-box II.

 
The CRABP-II promoter is a target for MycN binding. A putative MycN binding site GGCCACGTGCAT at position –1263 to–1252 (E-box II) was identified in the CRABP-II promoter using the Transfac program. To test whether MycN binds to this site in CRABP-II promoter, chromatin immunoprecipitation assays were done on SHEP tet-21 cells using primers designed to amplify the flanking region from –1361 to –1139. In the absence of MycN expression, no binding of MycN to the CRABP-II promoter was observed. With MycN expression upon withdrawal of tetracycline, the CRABP-II promoter was enriched in anti-MycN immunoprecipitation by 4-fold. This site was not significantly immunoprecipitated by a control IgG antibody, indicating the specificity of the MycN promoter interaction (Fig. 2C). The IMR-32 cell line, which expresses endogenous MycN and CRABP-II, was used as a positive control. Here also, immunoprecipitation with MycN antibody led to CRABP-II promoter amplification using specific primers for the MycN binding region, showing evidence of MycN binding to the CRABP-II promoter (Fig. 2C). Besides these, we also used another set of primers amplifying the region between –454 and –340 (E box I) with a set of primers 5'ggatccagttcagggttcaa3' from –454 to –434 and from –340 to –360 5'ggtgcattcaactccttggt3' amplifying a fragment of 114 bp. This site also included a CAGGTG site which could be a putative MYCN binding site. However, with these sets of primers, we could not amplify CRABP-II, further showing the specificity of MYCN binding to CRABP-II promoter (Fig. 2D).

Effect of CRABP-II expression on gene expression profiles in neuroblastoma cells. To understand the biological role of CRABP-II in neuroblastoma, we generated neuroblastoma/CRABP-II stable transfectants in several cell lines that lack endogenous CRABP-II expression: SH-EP, SK-N-SH, and NUB-6. All of the transfected cell lines expressed CRABP-II constitutively from the CMV promoter-driven construct as determined by Western blotting (Fig. 3A ). The effect of exogenous CRABP-II expression on gene expression profiles was examined using cDNA microarray analysis. RNA from SH-EP mock transfectants and SH-EP CRABP-II transfectants was compared by hybridization to a custom array of IFN-stimulated genes and AU-rich genes (Table 1A; ref. 33), and custom tumor array (Table 1B). Several of the genes found to be up-regulated in CRABP-II-overexpressing SH-EP cells, such as osteopontin and Ras-GTPase (Table 1A), have been previously shown to be overexpressed in various cancers (38, 39). The gene that was most significantly up-regulated in the CRABP-II transfectants was HuB, also known as Hel-N1. Hel-N1 is a member of Hu family of proteins, consisting of HuD, HuB, HuR, and HuC, which are 80% homologous to each other. Although HuR is ubiquitously present, the expression of the three other proteins is specific to neuronal tissues. Our unpublished data and other reports have shown that Hel-N1 is overexpressed in MYC-amplified cell lines. Increased expression of Hel-N1 in CRABP-II transfectants was confirmed in SHEP and SK-N-SH transfectants by RT-PCR (Fig. 3B) and in NUB-6 transfectants using Western blotting (Fig. 3C). The expression of HuD protein, which is very homologous to Hel-N1 in structure, function, and tissue-specific expression, was also increased in CRABP-II-overexpressing NUB6 compared with mock transfectants. Because Hu proteins have been shown to bind and stabilize MycN mRNA, we examined the relationship between Hu and MycN protein levels. The results showed an increase in MycN levels in CRABP-II-overexpressing NUB-6 cells in comparison with controls (Fig. 3C).


Figure 3
View larger version (29K):
[in this window]
[in a new window]
 
Figure 3. Stable expression of CRABP-II in neuroblastoma cell lines and its effect on cell motility and expression of cellular Hu protein levels. A, SH-EP, SK-N-SH, and NUB-6 cell lines that do not express endogenous CRABP-II were stably transfected with either pcDNA3 (control) or pCDNA3-CRABP-II and maintained in medium containing 400 µg/mL of G418. The expression of CRABP-II was determined by Western blot. B, expression of Hel-N1, CRABP-II, and GAPDH was determined by RT-PCR in SH-EP and SK-N-SH in stable CRABP-II transfectants. C, expression of various proteins in NUB-6 stably transfected with CRABP-II. D, representative data for cells expressing CRABP-II or vector alone. Photomicrographs of the scratch wounds were taken immediately after their formation (0 hours) and again at 24 and 48 hours after incubation. Columns, average number of cells which migrated as a percentage of controls in transwell assays (representative of four different experiments).

 
Effect of increased CRABP-II levels on cell growth and migration. To study whether increased MycN expression in the CRABP-II-overexpressing cells affects any of the functions attributed to MycN, such as cellular proliferation and migration, cell cycle analysis using flow cytometry was done to ascertain the rate of cell proliferation. No difference was observed in the rate of cell proliferation as well as cell cycle distribution in control versus CRABP-II-transfected cells (data not shown). Cell motility of control and CRABP-II-expressing cells was assessed by wound-healing and cell migration assays. In a wound-healing assay (Fig. 3D), we showed that after 24 hours of incubation, CRABP-II-expressing cells filled 52% of the scratched area compared with 30% by control cells. After 48 hours, CRABP-II-expressing cells closed 99% of the wound compared with 72% by control cells. The number of cells that migrated through transwells was also 2.3-fold higher in CRABP-II-expressing NUB6 cells compared with mock-transfected cells (Fig. 3D, columns). The expression of several genes involved in cell proliferation and migration were altered on microarray (Table 1B). The SHEP cell line, which does not express MYCN or CRABP-II transfection did not lead to an increase in cell proliferation, cell cycle distribution, or cell migration, suggesting that CRABP-II only enhances MycN action and does not substitute for it.

Temporal correlation between induction of MycN and CRABP-II and Hu protein levels. To determine if increased MycN and CRABP-II protein levels correlate with the expression of Hu proteins, the SHEP tet-21 cell line was analyzed in the presence and absence of tetracycline. In the presence of tetracycline, there was no MycN expression and CRABP-II was expressed only at basal levels (Fig. 4A ). In addition, the basal levels of HuD and Hel-N1 observed under these conditions were quite low. When tetracycline was removed from the medium, MycN levels gradually increased from days 1 to 4, with a 4-fold increase on day 1, 6-fold increase on day 2, and 13-fold increase on days 3 and 4. CRABP-II, HuD, and Hel-N1 all followed this same pattern of increase following tetracycline removal. With the increase in MycN, CRABP-II expression increased along with HuD and Hel-N1. When the tetracycline was added back to the cell cultures, both MycN and CRABP-II levels decreased significantly within 2 hours. A decrease in HuD and Hel-N1 proteins was also observed after 4 hours of adding tetracycline (Fig. 4A).


Figure 4
View larger version (17K):
[in this window]
[in a new window]
 
Figure 4. Correlation between MycN, CRABP-II, and Hu protein expression. A, SH-EP tet-21 cells were grown in RPMI with 1% serum with or without tetracycline (1 µg/mL) and samples were harvested as indicated. Tetracycline was added back to the cells after 4 days of culture without tetracycline and harvested after the indicated times. Protein (30 µg) was loaded on the gel and expression of various proteins was determined by Western blotting. The normalized values of each lane with respect to actin are expressed as fold change relative to day1 (+tet). B, siRNA-mediated down-regulation of CRABP-II leads to decreased levels of MycN protein in IMR-32 cells. The indicated concentrations of control or CRABP-II-specific siRNA were transfected into the cells with OligofectAMINE. The cells were harvested after 48 hours after transfection and CRABP-II, MycN, HuD, and ß-actin expression was determined by Western blotting. C, CRABP-II siRNA transfection leads to decrease in cell migration. The IMR-32 cells were transfected with 50 nmol/L of control and CRABP-II siRNA for 48 hours, and set-up for cell migration assay using transwells. Columns, average cell number per four fields, representative of three different experiments.

 
SiRNA-mediated reduction in CRABP-II results in decreased MycN levels. Because an increase in MycN expression was observed in NUB6-CRABP-II transfectants, we wanted to determine whether a reduction in endogenous CRABP-II levels would alter MycN expression. IMR-32 cells, which express endogenous MycN and CRABP-II, were transfected with control siRNA and siRNA specific for CRABP-II. Although control siRNA had no effect on CRABP-II levels, a dose-dependent decrease in CRABP-II expression was observed following transfection with siRNA specific to CRABP-II (Fig. 4B). Interestingly, MycN and Hel-N1 protein levels also decreased upon siRNA-mediated CRABP-II reduction. Reduced expression of CRABP-II did not affect ß-actin levels, indicating that its effect on MycN and Hel-N1 is specific. These findings support the hypothesis that induction of Hel-N1 may be responsible for the increase in MycN protein levels seen in NUB-6 CRABP-II transfectants. Furthermore, the cells transfected with CRABP-II siRNA showed a 60% decrease in cell migration in comparison with controls, as determined by transwell assays (Fig. 4C).

CRABP-II expression does not change the half-life of MycN mRNA. Because HuD has been shown to bind to the 3'-UTR of MycN mRNA, leading to increased RNA stability (25), CRABP-II transfectants and vector control transfectants were treated with actinomycin D and MycN mRNA levels were examined by quantitative RT-PCR at different time points after transcriptional inhibition as a way of assessing MycN mRNA stability. The results showed no significant increase in MycN mRNA stability in CRABP-II transfectants compared with control transfectants (Fig. 5A ). Even at 0 hours (i.e., without any actinomycin D treatment), there was no difference in MycN RNA levels between control and CRABP-II-transfected cells. This suggested that basal MycN mRNA levels are not affected by CRABP-II expression.


Figure 5
View larger version (20K):
[in this window]
[in a new window]
 
Figure 5. Effect of CRABP-II on the half-life and rate of synthesis of MycN. A, control or CRABP-II-expressing NUB-6 cells were treated with Act D (10 µg/mL) and harvested at the indicated time intervals. Total RNA was isolated, reverse-transcribed, and cDNA was used for quantitative PCR analysis of MycN and GAPDH. As described in Materials and Methods, the relative threshold values were calculated after normalization with GAPDH and plotted. B, control and CRABP-II-expressing NUB-6 cells were treated with cycloheximide (CHX; 10 µg/mL) and harvested after incubation for the indicated times. Western blot analysis of MycN and actin (top) and densitometric quantitation of each band (bottom, lanes). C, cells were cultured in methionine-free medium for 2 hours and were pulse-labeled in 35S labeling mix followed by a chase for the indicated times with unlabeled media (top). The samples were immunoprecipitated with MycN antibody and run on SDS-PAGE. The densitometric quantitation of each band (bottom, lanes). Coomassie blue staining of the total cell lysate used for immunoprecipitation (bottom). D, proposed model for MycN autoregulatory loop mediated by CRABP-II and Hu proteins. MycN increases CRABP-II expression by directly binding to its promoter. Increased levels of CRABP-II protein result in an increase in the Hu proteins, Hel-N1 and HuD, through an unknown mechanism. The rate of synthesis is also increased in the presence of higher CRABP-II levels.

 
CRABP-II expression does not change the half-life of MycN protein but increases its rate of synthesis. As no difference was observed in MycN mRNA levels in the CRABP-II transfectants, we next sought to determine if higher levels of MycN protein observed in CRABP-II-transfected cells are due to an increase in the half-life of MycN protein. Accordingly, control and CRABP-II-overexpressing NUB6 cells were treated with cycloheximide (Fig. 5B), and consistent with previous reports, the half-life of MycN was observed to be ~30 minutes. Interestingly, there was no difference in the half-life of MycN protein between control and CRABP-II transfectants, although the levels of MycN at 0 and 30 minutes after cycloheximide treatment were higher in CRABP-II-transfected cells (Fig. 5B). These results indicate that CRABP-II does not alter the MycN half-life. The rate of protein synthesis of MycN was determined by pulse chase experiments, and as expected, CRABP-II-expressing cells had elevated MycN levels at the beginning of the pulse. Similarly, after a chase of 30 minutes (Fig. 5C) or 60 minutes (data not shown), increased MycN levels were observed in CRABP-II-overexpressing cells as compared with controls. These results indicate that the rate of MycN protein synthesis is increased in the presence of CRABP-II.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We identified CRABP-II as an overexpressed protein in MycN-amplified neuroblastoma tumors. Southern blot analysis of 5 tumors with, and 20 tumors without, MycN oncogene amplification did not reveal rearrangement or amplification of the CRABP-II gene in genomic digests with HindIII or EcoRI hybridized with a CRABP-II cDNA probe (ref. 10; data not shown). Thus, there was no evidence of gross genomic alterations of CRABP-II in neuroblastoma, although subtle mutations cannot be ruled out.

Using a tetracycline-regulated inducible system in the SH-EP neuroblastoma cell line, we showed that induction of MycN and CRABP-II expression is tightly correlated, suggesting that MycN modulates CRABP-II levels, by either a direct or indirect mechanism. A putative MycN binding site (GGCCACGTGCAT) containing an E-box element at position –1263 to –1252 was identified in the CRABP-II gene promoter. Chromatin immunoprecipitation experiments showed that MycN protein binds to this region of the CRABP-II promoter, suggesting the possibility of direct regulation. CRABP-II was identified as a putative target of MycN transcriptional regulation in previously reported neuroblastoma microarray experiments by Mac et al., although the results from the three different cell lines used were variable and not confirmed by an alternative methodology (40). Although one of the cell lines used in that study (C11) showed a 3-fold increase in CRABP-II mRNA levels in MycN-overexpressing transfectants, SHEP tet-21 cells did not show any difference in CRABP-II expression in the presence or absence of tetracycline. This finding is consistent with our results when the cells are cultured in 10% serum. CRABP-II expression is regulated by various factors such as calcium, estrogen, transforming growth factor-ß, and other growth factors present in serum (4144). Because MycN is a weak transcription factor with only 2- to 3-fold induction of target genes, the effect of MycN on CRABP-II expression may not be obvious in the presence of these growth factors. When 1% serum or charcoal dextran–treated serum was used to decrease the effect of these growth factors on CRABP-II expression, we observed significant MycN-dependent up-regulation of CRABP-II.

In addition, our cDNA microarray and proteomic data show up-regulation of HuB (Hel-N1) in three different CRABP-II-transfected neuroblastoma cell lines and up-regulation of HuD in NUB-6 CRABP-II transfectants (Table 1). HuB and HuD are RNA-binding proteins and in neuroblastoma, HuD and HuB have been shown to bind to the 3'-UTR of MycN mRNA (24), and increase MycN mRNA stability (25). As shown previously for other mRNAs, we observed no increase in MycN mRNA stability in CRABP-II transfectants over control transfectants. However, it is possible that HuD and HuB exert their effect at a translational level (26, 27), suggesting additional roles for Hu proteins in translation control. Our study shows that the CRABP-II-dependent increase in MycN protein is not due to the altered stability of either MycN mRNA or protein but to an increase in de novo protein synthesis. These results are consistent with the possibility that Hu proteins facilitate efficient translation of MycN mRNA by increasing its association with polysomes as has been shown for CAAT/enhancer binding protein-ß expression in 3T3-L1 adipocytes (26). The increase in MycN levels in CRABP-II-overexpressing cells had no effect on proliferation but cell migration was increased, thereby suggesting that CRABP-II potentiates the effects of MycN differentially in MycN amplified cells. CRABP-II may increase the levels of some genes involved in cell migration and down-regulate genes related to cell proliferation like gro1 oncogene (Table 1B), thereby selectively regulating the function of MycN. We have identified osteopontin (OPN) as one of the genes differentially expressed in CRABP-II transfected cells on microarray analysis (Table 1A). Osteopontin, a chemokine-like extracellular matrix–associated protein, is known to play a crucial role in determining the metastatic potential of various cancers by mediating cell migration and adhesion (45). Therefore, we suggest that CRABP-II may differentially regulate the function of MycN, leading to the increased cell migration phenotype observed in tumors overexpressing CRABP-II. Other reports have also shown that in Wilms tumors, very high levels of CRABP-II correlate with poor clinical outcome (46), and a decrease in cell invasion occurs after CRABP-II inhibition in head and neck sarcoma (19).

CRABP-II is a cytosolic and nuclear protein that is induced by and binds to RA but whose biological functions are not well understood (47). In our neuroblastoma experiments, we did not find any correlation between CRABP-II expression in response to RA (data not shown). In contrast, we show evidence for an RA-independent role for CRABP-II in neuroblastoma. Several other studies point to the RA-independent role for CRABP-II in different cell types. In mammary carcinoma, exogenous expression of CRABP-II sensitized the cells to RA-induced growth inhibition and suppressed their tumorigenicity in immunodeficient mice. Similarly, injection of an adenovirus expressing CRABP-II into mammary carcinomas that spontaneously develop in TgN (MMTVneu) 202Mul mice resulted in delayed tumor growth and prolonged survival rates (48, 49). Remarkably, in both mouse models, administration of exogenous RA had no additional beneficial effect, suggesting the possibility that in mammary carcinoma cells, CRABP-II has a role that is independent of its function in RA metabolism. In melphalan-resistant MCF7 cells, CRABP-II is highly expressed (20). In promyelocytic leukemia (AML M3), where RA is a basic therapeutic modality, increased expression of CRABP-II does not correlate with response to RA (16, 17).

There is growing evidence suggesting that CRABP-II may be regulated by factors other than RA. CRABP-II is directly regulated by estrogen in the rat uterus through an ER binding site in the promoter region of CRABP-II but not by RA (42). In breast cancer cell lines, estrogen induces CRABP-II expression, possibly through retinoic acid receptor-{alpha} (43). In addition, overexpression of CRABP-II has been observed in several breast cancer cell lines and primary tumors (43). From analysis of the published microarray data, we found that CRABP-II was expressed in these cell lines, irrespective of the estrogen status but that all of these cell lines expressed high c-myc levels. A previous study from our lab identified both MycN and CRABP-II overexpression in Wilms tumors (46), and expression of MycN correlates with CRABP-II levels in these tumors.3 Moreover, CRABP-II overexpression in tumors is not explained by their sensitivity or resistance to RA. Considering that CRABP-II can be induced by several factors, including myc, and that it can localize to the nucleus, it is likely that CRABP-II may act as a general transcriptional coactivator or downstream effector for several transcription factors and the overall effect on the cells depends on the transcription factor inducing it. The SHEP cell line overexpressing CRABP-II did not show any alteration in cellular function (i.e., cell proliferation, cell migration, or cell cycle distribution) further suggesting that CRABP-II may act in concert with other transcription factors.

In summary, we present a model to show the relationship between MycN and CRABP-II. Our study shows that CRABP-II is expressed at high levels in MycN-amplified neuroblastoma tumors with evidence of direct regulation of CRABP-II by MycN. Therefore, we suggest a novel positive feedback loop whereby MycN induces CRABP-II by binding to its promoter. This in turn results in increased HuD and HuB levels in the cells through an unknown mechanism(s), resulting in increased MycN expression (Fig. 5D). CRABP-II expression along with MycN may worsen the effects of MycN gene amplification and therefore may be a candidate for therapeutic targeting. Targeting MycN is difficult for several reasons including (a) the homology of MycN to c-myc, which is involved in normal and essential cellular functions; (b) gene amplification producing large amounts of protein, and therefore, is difficult to inhibit; and (c) that drug delivery to the nucleus could be difficult as MycN is a nuclear protein. On the other hand, proteins that mediate some of the oncogenic functions of MycN may be good therapeutic targets. Our finding that inhibition of CRABP-II expression with siRNA leads to down-regulation of MycN suggests that CRABP-II may be a useful therapeutic target for neuroblastoma, where RA fails.


    Acknowledgments
 
Grant support: American Cancer Society, Cuyahoga County Section, and Cleveland Sport Stars Foundation.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Manfred Schwab for SH-EP-tet21, Patrick Reynolds for SMS-KCNR, Rork Kuick for the computerized analysis of 2-D gels, Jeanna Guenther for microarray experiments, and Jaharul-Haque, Gregory Plautz, and Patricia Stanhope-Baker for critical reading of the manuscript.


    Footnotes
 
3 Manuscript in preparation. Back

Received 12/21/05. Revised 5/30/06. Accepted 6/19/06.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Brodeur GM, Seeger RC, Schwab M, Varmus HE, Bishop JM. Amplification of N-myc in untreated human neuroblastomas correlates with advanced disease stage. Science 1984;224:1121–4.[Abstract/Free Full Text]
  2. Seeger RC, Brodeur GM, Sather H, et al. Association of multiple copies of the N-myc oncogene with rapid progression of neuroblastomas. N Engl J Med 1985;313:1111–6.[Abstract]
  3. Seeger RC, Wada R, Brodeur GM, et al. Expression of N-myc by neuroblastomas with one or multiple copies of the oncogene. Prog Clin Biol Res 1988;271:41–9.[Medline]
  4. Look AT, Hayes FA, Shuster JJ, et al. Clinical relevance of tumor cell ploidy and N-myc gene amplification in childhood neuroblastoma: a Pediatric Oncology Group study. J Clin Oncol 1991;9:581–91.[Abstract]
  5. Weiss WA, Aldape K, Mohapatra G, Feuerstein BG, Bishop JM. Targeted expression of MYCN causes neuroblastoma in transgenic mice. EMBO J 1997;16:2985–95.[CrossRef][Medline]
  6. Hailat N, Keim DR, Melhem RF, et al. High levels of p19/nm23 protein in neuroblastoma are associated with advanced stage disease and with N-myc gene amplification. J Clin Invest 1991;88:341–5.[Medline]
  7. Keim DR, Hailat N, Kuick R, et al. PCNA levels in neuroblastoma are increased in tumors with an amplified N-myc gene and in metastatic stage tumors. Clin Exp Metastasis 1993;11:83–90.[CrossRef][Medline]
  8. Hailat N, Strahler J, Melhem R, et al. N-myc gene amplification in neuroblastoma is associated with altered phosphorylation of a proliferation related polypeptide (Op18). Oncogene 1990;5:1615–8.[Medline]
  9. Ungar DR, Hailat N, Strahler JR, et al. Hsp27 expression in neuroblastoma: correlation with disease stage. J Natl Cancer Inst 1994;86:780–4.[Abstract/Free Full Text]
  10. Astrom A, Tavakkol A, Pettersson U, Cromie M, Elder JT, Voorhees JJ. Molecular cloning of two human cellular retinoic acid-binding proteins (CRABP). Retinoic acid-induced expression of CRABP-II but not CRABP-I in adult human skin in vivo and in skin fibroblasts in vitro. J Biol Chem 1991;266:17662–6.[Abstract/Free Full Text]
  11. Bailey JS, Siu CH. Purification and partial characterization of a novel binding protein for retinoic acid from neonatal rat. J Biol Chem 1988;263:9326–32.[Abstract/Free Full Text]
  12. Noy N. Retinoid-binding proteins: mediators of retinoid action. Biochem J 2000;348 Pt 3:481–95.[CrossRef][Medline]
  13. Bertucci F, Houlgatte R, Benziane A, et al. Gene expression profiling of primary breast carcinomas using arrays of candidate genes. Hum Mol Genet 2000;9:2981–91.[Abstract/Free Full Text]
  14. Hibbs K, Skubitz KM, Pambuccian SE, et al. Differential gene expression in ovarian carcinoma: identification of potential biomarkers. Am J Pathol 2004;165:397–414.[Abstract/Free Full Text]
  15. Tsibris JC, Segars J, Coppola D, et al. Insights from gene arrays on the development and growth regulation of uterine leiomyomata. Fertil Steril 2002;78:114–21.[CrossRef][Medline]
  16. Delva L, Cornic M, Balitrand N, et al. Resistance to all-trans retinoic acid (ATRA) therapy in relapsing acute promyelocytic leukemia: study of in vitro ATRA sensitivity and cellular retinoic acid binding protein levels in leukemic cells. Blood 1993;82:2175–81.[Abstract/Free Full Text]
  17. Zhou DC, Hallam SJ, Lee SJ, et al. Constitutive expression of cellular retinoic acid binding protein II and lack of correlation with sensitivity to all-trans retinoic acid in acute promyelocytic leukemia cells. Cancer Res 1998;58:5770–6.[Abstract/Free Full Text]
  18. Li CM, Guo M, Borczuk A, et al. Gene expression in Wilms' tumor mimics the earliest committed stage in the metanephric mesenchymal-epithelial transition. Am J Pathol 2002;160:2181–90.[Abstract/Free Full Text]
  19. Vo HP, Crowe DL. Transcriptional regulation of retinoic acid responsive genes by cellular retinoic acid binding protein-II modulates RA mediated tumor cell proliferation and invasion. Anticancer Res 1998;18:217–24.[Medline]
  20. Hathout Y, Riordan K, Gehrmann M, Fenselau C. Differential protein expression in the cytosol fraction of an MCF-7 breast cancer cell line selected for resistance toward melphalan. J Proteome Res 2002;1:435–42.[CrossRef][Medline]
  21. Samuel S, Bernstein LR. Adhesion, migration, transcriptional, interferon-inducible, and other signaling molecules newly implicated in cancer susceptibility and resistance of JB6 cells by cDNA microarray analyses. Mol Carcinog 2004;39:34–60.[CrossRef][Medline]
  22. Bertucci F, Van Hulst S, Bernard K, et al. Expression scanning of an array of growth control genes in human tumor cell lines. Oncogene 1999;18:3905–12.[CrossRef][Medline]
  23. Gao FB, Carson CC, Levine T, Keene JD. Selection of a subset of mRNAs from combinatorial 3' untranslated region libraries using neuronal RNA-binding protein Hel-N1. Proc Natl Acad Sci U S A 1994;91:11207–11.[Abstract/Free Full Text]
  24. Chagnovich D, Fayos BE, Cohn SL. Differential activity of ELAV-like RNA-binding proteins in human neuroblastoma. J Biol Chem 1996;271:33587–91.[Abstract/Free Full Text]
  25. Manohar CF, Short ML, Nguyen A, et al. HuD, a neuronal-specific RNA-binding protein, increases the in vivo stability of MYCN RNA. J Biol Chem 2002;277:1967–73.[Abstract/Free Full Text]
  26. Gantt KR, Jain RG, Dudek RW, Pekala PH. HuB localizes to polysomes and alters C/EBP-ß expression in 3T3–1 adipocytes. Biochem Biophys Res Commun 2004;313:619–22.[CrossRef][Medline]
  27. Bolognani F, Merhege MA, Twiss J, Perrone-Bizzozero NI. Dendritic localization of the RNA-binding protein HuD in hippocampal neurons: association with polysomes and upregulation during contextual learning. Neurosci Lett 2004;371:152–7.[CrossRef][Medline]
  28. Hanash SM, Strahler JR. Advances in two-dimensional electrophoresis. Nature 1989;337:485–6.[CrossRef][Medline]
  29. Merril CR, Dunau ML, Goldman D. A rapid sensitive silver stain for polypeptides in polyacrylamide gels. Anal Biochem 1981;110:201–7.[CrossRef][Medline]
  30. Kuick R, Boerwinkle E, Hanash SM, Sing CF. A statistical analysis of spot variation using the two-dimensional polyacrylamide gel electrophoresis. Comput Biomed Res 1986;19:90–102.[CrossRef][Medline]
  31. Wimmer K, Kuick R, Thoraval D, Hanash SM. Two-dimensional separations of the genome and proteome of neuroblastoma cells. Electrophoresis 1996;17:1741–51.[CrossRef][Medline]
  32. Boyd KE, Farnham PJ. Myc versus USF: discrimination at the cad gene is determined by core promoter elements. Mol Cell Biol 1997;17:2529–37.[Abstract]
  33. Chang HM, Paulson M, Holko M, et al. Induction of interferon-stimulated gene expression and antiviral responses require protein deacetylase activity. Proc Natl Acad Sci U S A 2004;101:9578–83.[Abstract/Free Full Text]
  34. Dong B, Zhou Q, Zhao J, et al. Phospholipid scramblase 1 potentiates the antiviral activity of interferon. J Virol 2004;78:8983–93.[Abstract/Free Full Text]
  35. Lohnes D, Jones G. Further metabolism of 1{alpha},25-dihydroxyvitamin D3 in target cells. J Nutr Sci Vitaminol (Tokyo) 1992;Spec no:75–8.
  36. Rochette-Egly C, Lutz Y, Saunders M, Scheuer I, Gaub MP, Chambon P. Retinoic acid receptor {gamma}: specific immunodetection and phosphorylation. J Cell Biol 1991;115:535–45.[Abstract/Free Full Text]
  37. Malynn BA, de Alboran IM, O'Hagan RC, et al. N-myc can functionally replace c-myc in murine development, cellular growth, and differentiation. Genes Dev 2000;14:1390–9.[Abstract/Free Full Text]
  38. Korkola JE, De Vries S, Fridlyand J, et al. Differentiation of lobular versus ductal breast carcinomas by expression microarray analysis. Cancer Res 2003;63:7167–75.[Abstract/Free Full Text]
  39. Thompson N, Lyons J. Recent progress in targeting the Raf/MEK/ERK pathway with inhibitors in cancer drug discovery. Curr Opin Pharmacol 2005;5:350–6.[CrossRef][Medline]
  40. Mac SM, D'Cunha CA, Farnham PJ. Direct recruitment of N-myc to target gene promoters. Mol Carcinog 2000;29:76–86.[CrossRef][Medline]
  41. Nugent P, Greene RM. Interactions between the transforming growth factor ß (TGF ß) and retinoic acid signal transduction pathways in murine embryonic palatal cells. Differentiation 1994;58:149–55.[CrossRef][Medline]
  42. Li XH, Ong DE. Cellular retinoic acid-binding protein II gene expression is directly induced by estrogen, but not retinoic acid, in rat uterus. J Biol Chem 2003;278:35819–25.[Abstract/Free Full Text]
  43. Lu M, Mira-y-Lopez R, Nakajo S, Nakaya K, Jing Y. Expression of estrogen receptor {alpha}, retinoic acid receptor {alpha} and cellular retinoic acid binding protein II genes is coordinately regulated in human breast cancer cells. Oncogene 2005;24:4362–9.[CrossRef][Medline]
  44. Vettermann O, Siegenthaler G, Winter H, Schweizer J. Retinoic acid signaling cascade in differentiating murine epidermal keratinocytes: alterations in papilloma- and carcinoma-derived cell lines. Mol Carcinog 1997;20:58–67.[CrossRef][Medline]
  45. Standal T, Borset M, Sundan A. Role of osteopontin in adhesion, migration, cell survival and bone remodeling. Exp Oncol 2004;26:179–84.[Medline]
  46. Li W, Kessler P, Williams BR. Transcript profiling of Wilms tumors reveals connections to kidney morphogenesis and expression patterns associated with anaplasia. Oncogene 2005;24:457–68.[CrossRef][Medline]
  47. Tavakkol A, Griffiths CE, Keane KM, Palmer RD, Voorhees JJ. Cellular localization of mRNA for cellular retinoic acid-binding protein II and nuclear retinoic acid receptor-{gamma} 1 in retinoic acid-treated human skin. J Invest Dermatol 1992;99:146–50.[CrossRef][Medline]
  48. Manor D, Shmidt EN, Budhu A, et al. Mammary carcinoma suppression by cellular retinoic acid binding protein-II. Cancer Res 2003;63:4426–33.[Abstract/Free Full Text]
  49. Budhu AS, Noy N. Direct channeling of retinoic acid between cellular retinoic acid-binding protein II and retinoic acid receptor sensitizes mammary carcinoma cells to retinoic acid-induced growth arrest. Mol Cell Biol 2002;22:2632–41.[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gupta, A.
Right arrow Articles by Rawwas, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gupta, A.
Right arrow Articles by Rawwas, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online