| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Cell, Tumor, and Stem Cell Biology |
1 Drug Metabolism and Toxicology, Division of Pharmaceutical Sciences, Graduate School of Medical Science, Kanazawa University; and 2 Futaba Breast Clinic, Kanazawa, Japan
Requests for reprints: Tsuyoshi Yokoi, Drug Metabolism and Toxicology, Division of Pharmaceutical Sciences, Graduate School of Medical Science, Kanazawa University, Kakuma-machi, Kanazawa 920-1192, Japan. Phone: 81-76-234-4407; Fax: 81-76-234-4407; E-mail: tyokoi{at}kenroku.kanazawa-u.ac.jp.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Human cytochrome P450 (CYP) 1B1 is a member of CYP and is mainly expressed in ovary, uterus, and breast (11, 12). CYP1B1 catalyzes the metabolic activation of a variety of procarcinogens and promutagens, including polycyclic aromatic hydrocarbons and aryl amines (12) and metabolism of 17ß-estradiol (13–15). Whereas 17ß-estradiol contributes to the growth and development of estrogen-dependent cancers, such as breast and endometrial cancers (16), 4-hydroxyestradiol, a catechol metabolite formed by CYP1B1, generates free radicals from reductive-oxidative cycling with the corresponding semiquinone and quinone forms, which cause DNA damage (17, 18). The expression level of CYP1B1 is higher in various types of malignant cancers compared with normal tissues (19). Thus, it is evident that CYP1B1 is associated with cancer. It should be noted that there is no apparent difference in the CYP1B1 mRNA levels between tumor and normal tissues (20, 21). Although there is no direct evidence of lack of association between mRNA and protein of CYP1B1 in panel of human tissues, the phenomena are reminiscent of post-transcriptional regulation. An extremely long 3'-UTR (
3 kb) is peculiar to CYP1B1 mRNA. This background prompted us to investigate whether human CYP1B1 might be post-transcriptionally regulated by miRNA.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Cells and culture conditions. The human uterine cervix adenocarcinoma cell line HeLa was obtained from Riken Gene Bank (Tsukuba, Japan). The human breast adenocarcinoma cell line MCF-7 and human embryonic kidney cell line HEK293 were obtained from the American Type Culture Collection (Rockville, MD). The human leukemic T-cell line Jurkat was kindly provided by Dr. Yoshinobu Nakanishi (Kanazawa University, Kanazawa, Japan). HeLa cells were cultured in DMEM (Nissui Pharmaceutical, Tokyo, Japan) supplemented with 10% fetal bovine serum (FBS; Invitrogen). MCF-7 cells were cultured in DMEM supplemented with 0.1 mmol/L nonessential amino acid (Invitrogen) and 10% FBS. HEK293 cells were cultured in DMEM supplemented with 4.5 g/L glucose, 10 mmol/L HEPES, and 10% FBS. Jurkat cells were cultured in RPMI 1640 (Nissui Pharmaceutical) supplemented with 10% FBS. These cells were maintained at 37°C under an atmosphere of 5% CO2-95% air.
RNase protection assay. Total RNA was isolated from the cells using ISOGEN (Nippon Gene, Tokyo, Japan). Antisense RNA probes were synthesized by mirVana miRNA Probe Construction kit. The oligonucleotides used for miR-27b and U6 small nuclear RNA (snRNA) were 5'-TTCACAGTGGCTAAGTTCTGCCTGTCTC-3' and 5'-AGAAGATTAGCATGGCCCCTGCGCAAGGCCTGTCTC-3', respectively. RNase protection assays were done using a mirVana miRNA Detection kit according to the manufacturer's protocol. The antisense RNA probes labeled with [
-32P]UTP using T7 RNA polymerase were hybridized to total RNA (3 µg) at 42°C for 10 hours and then digested by RNase A/T1. The protected miRNAs were separated by electrophoresis through 15% polyacrylamide/1x Tris-borate EDTA (TBE)/8 mol/L urea gels with 1x TBE as the running buffer, and then the miRNAs were detected and quantified with a Fuji Bio-Imaging Analyzer BAS 1000 (Fuji Film, Tokyo, Japan).
Real-time reverse transcription-PCR. The cDNAs were synthesized from total RNAs using ReverTra Ace (Toyobo, Osaka, Japan) according to the manufacturer's protocol. The forward and reverse primers for human precursor miR-27b (pre-miR-27b) were 5'-ACCTCTCTAACAAGGTGCAGAGCTT-3' and 5'-ACCTTCTCTTCAGGTGCAGAACTTAG-3', respectively. The forward and reverse primers for human U6 snRNA were 5'-CGCTTCGGCAGCACATATACTAA-3' and 5'-TATGGAACGCTTCACGAATTTGC-3', respectively. The PCR analyses for human pre-miR-27b were done as follows: after an initial denaturation at 95°C for 30 seconds, the amplification was done by denaturation at 95°C for 10 seconds, annealing and extension at 68°C for 20 seconds for 45 cycles. The PCR condition for human U6 snRNA was done as follows: after an initial denaturation at 95°C for 30 seconds, the amplification was done by denaturation at 94°C for 10 seconds, annealing and extension at 62°C for 20 seconds for 45 cycles. PCR was done using the Smart Cycler (Cepheid, Sunnyvale, CA) with Smart Cycler software (version 1.2b).
Construction of reporter plasmids. To construct luciferase reporter plasmids, various target fragments were inserted at the XbaI site, downstream of the luciferase gene in the pGL3-promoter vector. The sequence from +4,358 to +4,381 in the human CYP1B1 gene (5'-CAGAACTTAGCCTTTACCTGTGAA-3') was termed miR-27b recognition element (MRE27b). The fragment containing three copies of the MRE27b, 5'-CTAGATTCATGTCCCAGAACTTAGCCTTTACCTGTGAAGTGTTCATGTCCCAGAACTTAGCCTTTACCTGTGAAGTGTTCATGTCCCAGAACTTAGCCTTTACCTGTGAAGTG-3' (MRE27b is italicized), was cloned into the pGL3-promoter vector, resulting in single and double insertions. These plasmids were termed pGL3/1B1MREx3 and pGL3/1B1MREx6, respectively. A fragment containing the perfect matching sequence with the mature miR-27b, 5'-CTAGACAGAACTTAGCCACTGTGAAT-3' (the matching sequence of miR-27b is italicized), was cloned into the pGL3-promoter vector (pGL3/miR-27b). The region 1 (+4,311 to +4,439) containing the MRE27b and the region 2 (+3,899 to +4,019) in the human CYP1B1 gene (Fig. 1A ) were amplified by PCR using the following primers adapted to the XbaI site: 5'-TTTTCTAGATGTCTCAGGTTTGTTTT-3' and 5'-GAATCTAGAATGCAACTATTTGATCT-3' for region 1 and 5'-GCTCTAGATGCCTCATTATGTCAACCA-3' and 5'-GCTCTAGACCTTACCTTTCTTCCATATAAA-3' for region 2. The pGL3-promoter plasmids containing regions 1 and 2 were termed pGL3/1B1UTR1 and pGL3/1B1UTR2 plasmids, respectively. The complementary sequence of region 1 was also cloned into the pGL3-promoter plasmid (pGL3/1B1UTR1rev). The nucleotide sequences of the constructed plasmids were confirmed by DNA sequencing analyses.
|
Stable expression of recombinant human CYP1B1 in HEK293 cells. A fragment containing the full-length coding region and 3'-UTR of human CYP1B1 cDNA (from –21 to +4,756) was amplified by PCR using the primers of 5'-GAAACCGCACCTCCCCG-3' and 5'-AAAGTATATTAAACAAAGTTTC-3'. It was subcloned into the pTARGET vector. The nucleotide sequences of the plasmid (pTARGET/CYP1B1) were confirmed by DNA sequencing analyses. HEK293 cells were seeded into six-well plates, and 2 µg of pTARGET/CYP1B1 plasmid were transfected using LipofectAMINE according to the manufacturer's protocols. When the cells reached 60% confluence, they were diluted from 1:10 to 1:200 and subjected to 400 µg/mL G418. The medium was renewed every week, and colonies of stably transfected cells (HEK293/1B1 cells) were isolated and expanded.
Electroporation of AsO and precursor for miR-27b. MCF-7 and HEK293/1B1 cells were washed twice with PBS and resuspended in HEPES-buffered saline [10 mmol/L HEPES (pH 7.3), 140 mmol/L NaCl] with 6 mmol/L glucose at 6 x 105 and 1 x 106 cells per pulse, respectively. A 250-µL aliquot of cells was added to a 0.4-cm gap electroporation cuvette (Bio-Rad, Hercules, CA) with 75, 125, 750, or 1,125 pmol of AsOs or 50, 100, 200, or 400 pmol of precursor and then incubated at 4°C for 10 minutes. The cells were then electroporated using a Gene Pulser II (Bio-Rad) at 220 V and 950 µF for MCF-7 cells and at 245 V and 950 µF for HEK293/1B1 cells and grown in the medium for 24 to 96 hours. After the incubation, the protein level and enzymatic activity of CYP1B1 were determined as described below.
SDS-PAGE and Western blot analyses. To prepare microsomes, MCF-7 cells seeded into 10-cm dishes were harvested and homogenized with homogenization buffer [0.1 mol/L Tris-HCl, 0.1 mol/L KCl, 1 mmol/L EDTA (pH 7.4)] and centrifuged at 19,000 x g, 4°C for 20 minutes. The supernatant was centrifuged at 105,000 x g for 1 hour at 4°C, and the precipitate was resuspended in TGE buffer [10 mmol/L Tris-HCl, 20% glycerol, 1 mmol/L EDTA (pH 7.4)]. To prepare the whole-cell lysate, HEK293/1B1 cells seeded into 10-cm dishes were harvested and homogenized with lysis solution [8 mol/L urea, 4% CHAPS, 2% Pharmalyte (pH 3-10)] containing protease inhibitors (1 mmol/L DTT, 0.5 mmol/L amidinophenyl methanesulfonyl fluoride hydrochloride, 2 µg/mL aprotinin, 2 µg/mL pepstatin, 2 µg/mL leupeptin). After centrifuging at 12,000 x g for 1 hour at 4°C, the supernatant was collected. The microsomal protein (30 µg) or whole-cell lysate (10 µg) was separated by 7.5% SDS-PAGE. The gel was transferred onto nitrocellulose membrane and probed with rabbit anti-human CYP1B1 or rabbit anti-human CYP1A1 antibodies. Biotinylated anti-rabbit IgG and Vectastain avidin-biotin complex method (ABC) kit (Vector Laboratories, Burlingame, CA) were used for diaminobenzidine staining.
Enzymatic activity. The enzymatic activity of CYP1B1 was determined using a P450-Glo Assay kit (Promega). After the electroporation, the cells seeded into 24-well plates were treated with 10 nmol/L TCDD for the last 24 hours, and then the medium was replaced with medium containing 20 µmol/L Luciferin 6' chloroethyl ether. After incubation for 8 hours at 37°C under an atmosphere of 5% CO2-95% air, 100 µL of the medium were added to 100 µL of Luciferin Detection Reagent. After incubation for 20 minutes at room temperature, the luminescence was measured with a luminometer. The protein concentrations of the cells were determined using Bradford protein assay reagent (Bio-Rad) with 
-globulin as the standard. The enzymatic activity was normalized with the protein content.
Human breast cancerous and adjacent noncancerous tissues. Breast cancerous and adjacent noncancerous tissues were obtained as surgical samples from 24 Japanese patients with primary breast carcinoma. The patients (ages 41-77 years) were nonsmokers and had not undergone chemotherapy. By standard histopathologic criteria, 21 patients were diagnosed as invasive ductal carcinoma and 3 patients as invasive lobular carcinoma. The histologic grade was determined by standard criteria (22) as grade 1 (n = 1), grades 1 to 2 (n = 13), grade 2 (n = 9), and grades 2 to 3 (n = 1). The samples were obtained immediately after resection, divided into breast cancerous and adjacent noncancerous tissues, and immediately frozen with liquid nitrogen. The samples were stored at –80°C until use. The expression levels of miR-27b in human breast cancerous and adjacent noncancerous tissues were determined by RNase protection assay and real-time reverse transcription-PCR (RT-PCR) as described above. This study was approved by the Ethics Committee of Kanazawa University. Written informed consent was obtained from all subjects before their participation in this study.
Immunohistochemistry. Immunohistochemical analyses of CYP1B1 were done using formalin-fixed, paraffin-embedded specimens of breast cancerous tissues from 24 patients. The sections were soaked in Antigen Retrieval Citra Solution (BioGenex, San Ramon, CA) at room temperature for 10 minutes and then incubated with anti-human CYP1B1 antibodies at 4°C for 16 hours. About the antibodies, no significant cross-reactivity to either human CYP1A1 or CYP1A2 protein has been reported (23). Staining was done using a Vectastain ABC kit. The extent of immunostaining was evaluated by the intensity of staining (score, 1-3), the localization in cytoplasm (score, 1-3), and area of staining (score, 1-4). Based on the combined scores, the samples were divided into three groups as weak (score, 3-5), moderate (score, 6-7), and strong (score, 8-10) staining of CYP1B1 protein. Three independent pathologists judged the results.
Statistical analyses. Data are expressed as mean ± SD of triplicate determinations. Statistical significance was determined by ANOVA and Dunnett multiple comparisons test. Comparison of two groups was made with an unpaired, two-tailed Student's t test. Correlations between the results obtained by RNase protection assay and real-time RT-PCR were determined by Pearson's product-moment method. The statistical significance of differences between the expression level of miR-27b in breast cancerous tissues and adjacent noncancerous tissues was determined by paired, two-tailed Student's t test. The relationships between the immunostained CYP1B1 level and miR-27b level in human breast cancerous tissues were investigated by ANOVA and Tukey method test. A P < 0.05 was considered statistically significant.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
3 kb; Fig. 1A). When the sequences of the CYP1B1 mRNA were compared between human, mouse, and rat, the homology of the coding region was extremely high (>80%). In addition, high homology was found in the 3'-UTR near the polyadenylation site of 44 nucleotides in length (from +4,344 to +4,387). A near-perfect matching sequence with miR-27b was identified (from +4,358 to +4,381) using the miRNA registry release 7.1 (Fig. 1B; ref. 24).3 This region was termed the miR-27b recognition element (MRE27b). We investigated whether miR-27b might be involved in the regulation of human CYP1B1 expression through the MRE27b. Expression levels of miR-27b in human cancer cell lines. A RNase protection assay was done to determine the expression level of mature miR-27b in various human cancer cell lines (Fig. 2A ). The mature miR-27b was detected in HeLa and MCF-7 cells but not in Jurkat and HEK293 cells. The expression level of pre-miR-27b was determined by real-time RT-PCR (Fig. 2B). Consistently, HeLa and MCF-7 cells showed significantly high expression of pre-miR-27b compared with Jurkat and HEK293 cells.
|
Effects of overexpression or inhibition of miR-27b on luciferase activity. To investigate whether miR-27b might control the luciferase activity, the precursor for miR-27b was exogenously expressed in Jurkat cells (Fig. 2D and E). The overexpression of miR-27b significantly decreased the luciferase activities of the pGL3/miR-27b (17% of control), pGL3/1B1MREx3 (34% of control), pGL3/1B1MREx6 (26% of control), and pGL3/1B1UTR1 (62% of control) plasmids (Fig. 2D). As shown in Fig. 2E, the precursor for miR-27b decreased the luciferase activities of pGL3/miR-27b and pGL3/1B1MREx3 plasmids in a concentration-dependent manner.
To investigate the effect of inhibition of endogenous miR-27b on the luciferase activity, AsO for miR-27b was transfected in MCF-7 cells (Fig. 2F and G). The transiently transfected AsO for miR-27b significantly increased the luciferase activities of the pGL3/miR-27b (2.1-fold of control), pGL3/1B1MREx3 (1.8-fold of control), pGL3/1B1MREx6 (1.8-fold of control), and pGL3/1B1UTR1 plasmids (1.4-fold of control; Fig. 2F). As shown in Fig. 2G, the AsO for miR-27b increased the luciferase activities of pGL3/miR-27b and pGL3/1B1MREx3 plasmids in a concentration-dependent manner. These results suggest that miR-27b recognized the MRE27b on the human CYP1B1 mRNA and regulated the expression post-transcriptionally.
Effects of inhibition of miR-27b on protein level and enzymatic activity of endogenous CYP1B1 in MCF-7 cells. We investigated the effects of the inhibition of miR-27b on the protein level and enzymatic activity of endogenous CYP1B1. A RNase protection assay revealed that the endogenous miR-27b level was greatly decreased by the transfection of the AsO for miR-27b in MCF-7 cells (Fig. 3A ). As shown in Fig. 3B, the CYP1B1 protein level was significantly increased by the transfection of the AsO for miR-27b. That there was no change of the CYP1A1 protein level indicated that the effects of the AsO for miR-27b were specific for CYP1B1 protein. The effects of the AsO for miR-27b on the enzymatic activity of CYP1B1 were examined by a P450-Glo assay. The enzymatic activity of CYP1B1 was increased by the electroporation of the AsO for miR-27b in MCF-7 cells in concentration- and time-dependent manners (Fig. 3C and D).
|
|
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
22-nucleotide functional RNA molecule. They play important roles in the regulation of target genes by binding to complementary regions of transcripts to repress their translation or regulate degradation. As many as 1,000 miRNA genes are thought to exist in the human genome (3). Some miRNAs are reported to be associated with physiologic functions, such as differentiation, development, and disease. Because miRNAs have only very recently received attention, the target genes of miRNAs are not completely understood yet. In the present study, we examined whether human CYP1B1, which is a member of CYP and catalyzes the metabolism of procarcinogens and estradiol, might be a target of miRNA. We identified MRE27b in the 3'-UTR in CYP1B1 mRNA. Luciferase assays showed that the endogenous and exogenous miR-27b negatively regulated the activity through MRE27b. The AsO for miR-27b could restore the protein level and enzymatic activity of endogenous CYP1B1, whereas the precursor for miR-27b decreased the protein expression and enzymatic activity of exogenous CYP1B1. These results clearly indicated that the expression of human CYP1B1 is post-transcriptionally regulated by miR-27b. It is well known that CYP1B1 is transcriptionally regulated, as we (25–27) and others (28–30) previously reported the involvement of aryl hydrocarbon receptor, Sp1, estrogen receptor, and steroidogenic factor-1. Thus, in addition to the transcriptional regulation, we found that the post-transcriptional regulation is also responsible for the CYP1B1 expression. The sequences of mRNA around MRE27b are highly conserved among species (Fig. 1). Therefore, the regulation by miR-27b may occur in other species.
miR-27b is highly expressed in human normal breast (31). Recent studies have reported that the miRNA expression levels are changed with the development of tumors, such as those of lung cancer (7), chronic lymphocytic leukemias (9), colorectal neoplasia (10), large cell lymphoma (32), and glioblastoma (33). Thus, many miRNAs are differentially expressed in different cancers. The miRNAs are generally down-regulated but sometimes up-regulated in cancers. In the present study, we found that the miR-27b level is decreased in breast cancerous tissues compared with noncancerous tissues. Immunohistochemical analyses revealed the high expression of CYP1B1 protein in breast cancerous tissues in accordance with previous studies (19, 34). The high expression of CYP1B1 protein in cancer cells would result from the decreased expression of miR-27b. The patients in the present study were both estrogen receptor–positive and progesterone receptor–positive. No association was observed between the levels of these receptors and the miR-27b or CYP1B1 level (data not shown). Furthermore, the miR-27b or CYP1B1 level was not associated with the presence or absence of lymph node metastasis (10 of 24 patients had lymph node metastasis). Thus, the biopathologic features or tumor stage of breast cancer would not affect the inverse association between the miR-27b and CYP1B1 levels. Highly expressed CYP1B1 in breast cancer would enhance the metabolism of 17ß-estradiol. Whereas 17ß-estradiol contributes to the growth and development of estrogen-dependent cancers, such as breast and endometrial cancers (16), 4-hydroxyestradiol formed by CYP1B1 causes DNA damage (17, 18). Thus, the abnormal expression of CYP1B1 would be related to the development of estrogen-dependent cancer.
More than half of the human miRNA genes are located at sites known to be involved in cancers, such as fragile sites, minimal regions of loss of heterozygosity, minimal regions of amplification, or common break point regions. Such locations support the notion that some miRNAs are involved in tumorigenesis. Calin et al. (35) reported that the gene coding miR-27b is located on the locus that is deleted in some cancers, such as urothelial or bladder cancer. It is plausible that the miR-27b would be down-regulated in these cancers. Human CYP1B1 is also expressed in urothelial and bladder tissues (36). The regulation of CYP1B1 by miR-27b would occur in these tissues, and the high CYP1B1 levels in urothelial or bladder cancer (36) might be due to the decreased miR-27b level.
The gene coding miR-27b is located on human 9q22.1, clustering with miR-23b and miR-24-1. Because these miRNAs are components of the same transcriptional unit (gi|4105182; ref. 37), the expression profiles of these miRNAs are considered to be in parallel. A moderate pairing with miR-24-1 is found at the neighborhood of MRE27b from +4,347 to +4,370 on the human CYP1B1 gene, although the pairing probability is lower than that of miR-27b (miR-24-1, the score is 144 and the energy is –15.4 kcal/mol; miR-27b, the score is 158 and the energy is –29.5 kcal/mol; ref. 38).4 miR-27a, which is a paralogous miRNA of miR-27b, has one nucleotide mismatch with the miR-27b and its pairing is possible (the score is 151 and the energy is –25.9 kcal/mol). Thus, the possibility that miR-24-1 or miR-27a may regulate the CYP1B1 expression cannot be excluded.
CYP1B1 is also expressed in eye tissue (39). Mutations or genetic polymorphisms of CYP1B1 are associated with primary congenital glaucoma (40, 41), and structural defect in eyes has been found in cyp1b1 knockout mice (42), indicating that CYP1B1 is responsible for eye development. At present, there is no information about the expression of miRNAs in eye tissue. The possibility that CYP1B1 level might be modulated by miR-27b in eye tissue in relation with eye development is worth pursuing in the future.
In conclusion, the results presented here suggested that human CYP1B1 is post-transcriptionally regulated by miR-27b, which would serve as a possible mechanism for the high expression of CYP1B1 protein in cancerous tissues. The silencing mechanism by miRNA might be one of the key factors regulating the cell-specific expression as well as individual differences in the expression of CYPs.
|
Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Noriko Kawagishi (Futaba Breast Clinic, Kanazawa, Japan) for enthusiasm and research support and Brent Bell for reviewing the article.
|
Footnotes |
|---|
Received 4/17/06. Revised 6/15/06. Accepted 7/12/06.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
|
|
 |
|
  Y.-Z. Pan, W. Gao, and A.-M. Yu MicroRNAs Regulate CYP3A4 Expression via Direct and Indirect Targeting Drug Metab. Dispos., October 1, 2009; 37(10): 2112 - 2117. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Komagata, M. Nakajima, S. Takagi, T. Mohri, T. Taniya, and T. Yokoi Human CYP24 Catalyzing the Inactivation of Calcitriol Is Post-Transcriptionally Regulated by miR-125b Mol. Pharmacol., October 1, 2009; 76(4): 702 - 709. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Wang, R. Rathinam, A. Walch, and S. K. Alahari ST14 (Suppression of Tumorigenicity 14) Gene Is a Target for miR-27b, and the Inhibitory Effect of ST14 on Cell Growth Is Independent of miR-27b Regulation J. Biol. Chem., August 21, 2009; 284(34): 23094 - 23106. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y.-Z. Pan, M. E. Morris, and A.-M. Yu MicroRNA-328 Negatively Regulates the Expression of Breast Cancer Resistance Protein (BCRP/ABCG2) in Human Cancer Cells Mol. Pharmacol., June 1, 2009; 75(6): 1374 - 1379. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S M Khoshnaw, A R Green, D G Powe, and I O Ellis MicroRNA involvement in the pathogenesis and management of breast cancer J. Clin. Pathol., May 1, 2009; 62(5): 422 - 428. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. R. Ware Nutrition and the Prevention and Treatment of Cancer: Association of Cytochrome P450 CYP1B1 With the Role of Fruit and Fruit Extracts Integr Cancer Ther, March 1, 2009; 8(1): 22 - 28. [Abstract] [PDF]
|
|
|
|
 |
|
 R. B. Halberg, M. C. Larsen, T. L. Elmergreen, A. Y. Ko, A. A. Irving, L. Clipson, and C. R. Jefcoate Cyp1b1 Exerts Opposing Effects on Intestinal Tumorigenesis via Exogenous and Endogenous Substrates Cancer Res., September 15, 2008; 68(18): 7394 - 7402. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Kovalchuk, J. Filkowski, J. Meservy, Y. Ilnytskyy, V. P. Tryndyak, V. F. Chekhun, and I. P. Pogribny Involvement of microRNA-451 in resistance of the MCF-7 breast cancer cells to chemotherapeutic drug doxorubicin Mol. Cancer Ther., July 1, 2008; 7(7): 2152 - 2159. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Hudder and R. F. Novak miRNAs: Effectors of Environmental Influences on Gene Expression and Disease Toxicol. Sci., June 1, 2008; 103(2): 228 - 240. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Rahman, S. F. Lax, C. H. Sutter, Q. T. Tran, G. L. Stevens, G. L. Emmert, J. Russo, R. J. Santen, and T. R. Sutter CYP1B1 Is Not a Major Determinant of the Disposition of Aromatase Inhibitors in Epithelial Cells of Invasive Ductal Carcinoma Drug Metab. Dispos., May 1, 2008; 36(5): 963 - 970. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Giantin, M. Carletti, F. Capolongo, S. Pegolo, R. M. Lopparelli, F. Gusson, C. Nebbia, M. Cantiello, P. Martin, T. Pineau, et al. Effect of Breed upon Cytochromes P450 and Phase II Enzyme Expression in Cattle Liver Drug Metab. Dispos., May 1, 2008; 36(5): 885 - 893. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Takagi, M. Nakajima, T. Mohri, and T. Yokoi Post-transcriptional Regulation of Human Pregnane X Receptor by Micro-RNA Affects the Expression of Cytochrome P450 3A4 J. Biol. Chem., April 11, 2008; 283(15): 9674 - 9680. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. D. Moffat, P. C. Boutros, T. Celius, J. Linden, R. Pohjanvirta, and A. B. Okey microRNAs in Adult Rodent Liver Are Refractory to Dioxin Treatment Toxicol. Sci., October 1, 2007; 99(2): 470 - 487. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
) and noncancerous tissues (
) from 11 patients were analyzed. C, comparison between the expression levels of pre-miR-27b in breast cancerous and adjacent noncancerous tissues obtained from 24 patients. Expression level of pre-miR-27b was determined by real-time RT-PCR and normalized with U6 snRNA level. Horizontal bars, mean; bars, SD. ***, P < 0.0005, paired Student's t test. D, inverse association between the expression levels of miR-27b and CYP1B1 protein in human breast cancer. According to the scoring of CYP1B1 immunohistochemistry, 24 samples were divided to three groups: group I (weak staining, 6 samples), group II (moderate staining, 11 samples), and group III (strong staining, 7 samples). Y axis, expression level of pre-miR-27b normalized with U6 snRNA in breast cancerous tissues. Horizontal bars, mean; bars, SD, *, P < 0.05; **, P < 0.01.