| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Experimental Therapeutics, Molecular Targets, and Chemical Biology |
1 Molecular Radiation Therapeutics Branch and 2 Radiation Oncology Branch, National Cancer Institute, Bethesda, Maryland
Requests for reprints: Philip J. Tofilon, Radiation Research Program, Molecular Radiation Therapeutics Branch, EPN/6015A, 6130 Executive Boulevard, MSC 7440, Rockville, MD 20892-7440. Phone: 301-496-6336; Fax: 301-480-5785; E-mail: tofilonp{at}mail.nih.gov.
| Abstract |
|---|
|
|
|---|
10-fold greater than those whose transcription was affected. The radiation-induced change in a gene's translational activity was shown to involve the recruitment of existing mRNAs to and away from polysomes. Moreover, the change in a gene's translational activity after irradiation correlated with changes in the level of its corresponding protein. These data suggest that radiation modifies gene expression primarily at the level of translation. In contrast to transcriptional changes, there was considerable overlap in the genes affected at the translational level among brain tumor cell lines and normal astrocytes. Thus, the radiation-induced translational control of a subset of mRNAs seems to be a fundamental component of cellular radioresponse. (Cancer Res 2006; 66(2): 1052-61) | Introduction |
|---|
|
|
|---|
Radiation-induced gene expression profiles generated from microarray analysis of total cellular RNA have been reported for a number of normal cells and tissue as well as for a variety of tumor cells grown in vitro and in vivo (16). Comparison of these profiles reveals few commonly affected genes among the cell types evaluated and even among tumor cell lines originating from the same histology. Moreover, whereas these microarray analyses accurately reflect changes in transcription, there has been an overall lack of data correlating radiation-induced changes in mRNAs with their corresponding proteins. Although there are exceptions involving individual genes (1), the vast majority of mRNA changes detected after irradiation have not been extended to the protein level. Given that protein is the operational end product of gene expression, the lack of correlation between mRNA and protein changes combined with the heterogeneity among cell lines has made it difficult to assign a functional consequence to radiation-induced gene expression. Along these lines, Birrell et al. showed that after irradiation of yeast, there was little or no relationship between radiation-induced transcriptional changes and survival (7).
These DNA microarray studies were based on the assumption that radiation-induced gene expression occurs primarily through changes in transcription. However, gene expression is dependent not only on transcriptional activity but on a variety of post-transcriptional events, including the initiation of mRNA translation. In contrast to prokaryotic cells, eukaryotic transcription and translation are not directly coupled with each event confined to separate cell compartments (nucleus versus cytoplasm). Indeed, after stress, in eukaryotic cells, there is often a poor correlation between mRNA levels and protein production (8, 9). Accounting for the disengagement of the transcriptome and proteome is translational control (1012), which has been shown to play a significant role in regulating gene expression during such fundamental processes as T-cell activation (13), growth factor signaling (14), and tumorigenesis (15). Given that translational control can provide a critical regulatory point for gene expression, we hypothesized that radiation modulates the translation of a subset of mRNAs. The initiation of translation involves recruitment of mRNAs to polysomes (polyribosomes): the association of an mRNA with polysomes can then be used as an indicator of translational activity (11). Therefore, to obtain a genome-wide perspective of the effects of radiation on translation control, we have done microarray analysis on polysomal-bound RNA; to allow for a comparison with the effects of radiation on transcription, microarray analysis was also done using total RNA. Because radiation remains a primary treatment modality for brain tumors, these gene expression analyses were done on human brain tumor cell lines and normal astrocytes. The data presented indicate that gene translation is considerably more susceptible to radiation-induced modifications than is transcription, and that the changes in translational activity involve the recruitment of existing mRNAs to and away from polysomes. Moreover, there was a correlation between the genes whose expression was modified at the translational level and the expression of their corresponding proteins. These results suggest that radiation primarily affects gene expression at the level of translation.
| Materials and Methods |
|---|
|
|
|---|
RNA sample preparation, probe labeling, and microarray procedure. Cells were scraped from tissue culture flasks, and total RNA was extracted from each sample using TRIZOL reagent (Invitrogen, Carlsbad, CA) passed through an RNeasy spin column (Qiagen, Valencia, CA) and then amplified using RiboAmp RNA kits (Arcturus, Mountain View, CA) according to manufacturer's protocol. Amplified RNA (1.5-3.0 µg) was labeled with Cy3-dUTP (experimental RNA) or Cy5-dUTP (Stratagene Universal Reference, La Jolla, CA) using Superscript II Reverse Transcriptase (Invitrogen, Carlsbad, CA). Each cDNA microarray chip contained 7680 human cDNA clones (National Cancer Institute ROSP 8K Human Array), and methods for microarray hybridization and washing were described previously (16). Hybridized arrays were scanned with 10-µm resolution on a GenePix 4000A scanner (Axon Instruments, Inc., Foster City, CA) at wavelengths 635 and 532 nm for Cy5- and Cy3-labeled probes, respectively. The resulting TIFF images were analyzed by GenePix Pro 4.0 software (Axon Instruments). The ratios of the sample intensity to the reference [green (Cy3)/red (Cy5)] intensity for all targets were determined, and ratio normalization was done to normalize the center of ratio distribution to 1.0. Tumor cell lines had a biological replicate, and each replicate was run on duplicate slides. The biological replicates (i.e., independent experiments) had correlation coefficients of
0.78 for total RNA and
0.83 for polysome RNA, indicative of high reproducibility (17). Microarray analysis was done on primary normal human astrocytes using duplicate slides.
Polysome preparation and analysis. Polysomes were isolated using sucrose-gradient fractionation basically as described by Galban et al. (18). Cells were grown to
80% confluence in 150-mm2 tissue culture dishes and incubated in 100 µg of cycloheximide/mL for 15 minutes before collection. Cytoplasmic RNA was obtained by lysing cells in 1 mL of polysome buffer [10 mmol/L Tris-HCl (pH 8), 140 mmol/L NaCl, 1.5 mmol/L MgCl2, 0.5% NP40, 10 mmol/L DTT, 100 µg/mL cycloheximide, 500 µg/mL heparin, 1 mmol/L phenylmethanesulfonyl fluoride, and 500 units/mL RNasin (Promega, Madison, WI)]. After 10 minutes on ice, lysates were centrifuged (10,000 x g for 10 minutes), and the resulting cytosolic supernatant was layered onto a 10% to 50% sucrose gradient. Gradients were then centrifuged at 35,000 x g for 3 hours at 4°C and 1-mL fractions collected using an ISCO Density Gradient Fractionation System (ISCO, Lincoln, NE) with continuous monitoring based on A254. The RNA in each fraction was extracted using TRIZOL and used for Northern analysis, or fractions 5 to 11 (corresponding to polysome-bound RNA) were pooled and subjected to microarray analysis as described above.
Microarray data analysis. Raw intensity profiles were analyzed using the mAdb tools (National Center for Biotechnology Information, NIH) to perform microarray normalization and statistical analysis. All nonflagged raw fluorescent intensities were subjected to a spot quality filter with signal: background ratios of >2, a minimum background corrected signal of 250 counts, and 60% of pixels in the spots with an intensity greater than a SD plus background. Scatter plots were created and correlation coefficients calculated using the mAdb software.3 As a supervised approach for analyzing the function of genes whose levels were modified by
2-fold, GOstat was done.4 This program automatically obtains the Gene Ontology annotations from a database and generates a statistical analysis of the functional annotations that are overrepresented in the inputted list of genes (19).
Ingenuity Pathway Analysis (IPA)5 was used as an additional method for evaluating functional significance of the radiation-induced gene profiles. IPA uses a curated database to construct functional regulatory networks from a list of individual genes. A data set containing gene identifiers and their corresponding expression values was uploaded as an Excel spreadsheet using the template provided in the application. Each gene identifier was mapped to its corresponding gene object in the Ingenuity Pathways Knowledge Base. A log 2transformed cutoff of 1.0 was set to identify genes whose expression was significantly differentially regulated. These genes (referred to as focus genes) were then used as the starting point for generating biological networks. To build networks, the program uses its knowledge base to identify interactions between focus genes as well as other genes. IPA then determines a statistical score for each network according to the fit of the network to the set of focus genes. The score is the negative log of P and denotes the likelihood of the focus genes in the network being found together due to chance. Biological functions were assigned to each gene network by using the findings that have been extracted from the scientific literature and stored in the Ingenuity Pathways Knowledge Base. The biological functions assigned to each network are ranked according to the significance of that biological function to the network. A Fisher's exact test is used to calculate P, determining the probability that the biological function assigned to that network is explained by chance alone.
Northern analysis. Northern blot analysis was done using RNA isolated from whole cells or from the individual fractions generated from sucrose gradients, which used equal volumes from each fraction. Denatured RNA was separated using 1.5% agarose gels containing GelStar for RNA visualization (Nucleic Acid Gel Stain, Cambrex BioScience, Rockland, ME) and transferred to positively charged Zeta-Probe blotting Membranes (Bio-Rad, Hercules, CA). The mRNAs encoding GADPH, enolase 1 (ENO1), superoxide dismutase (SOD2), glutathione synthetase (GSS), and ß-actin were detected with specific oligonucleotides (Sigma-Genosys, Woodlands, TX): TTATTGATGGTACATGACAAGGTGCGGCTC, GGAGATGACACGGCTCACATGAGTGTAG, TGCTATGATTGATATGACCACCACCATTGA, CAATTCTGTAGACTGTACTGACGAGGCATG, and GTCAAGAAAGGGTGTAACGCAACTAAGTCA, respectively, that were end labeled with digoxin (DIG Oligonucleotide 3'-End Labeling kit, Roche Applied Science, Indianapolis, IN). Oligonucleotide and anti-DIG-alkaline phosphatase hybridization were done by using DIG OMNI System for Oligonucleotide Probes kit (Roche Applied Science) according to manufacturer's instructions. Visualization of the chemiluminescent signal was done with a Typhoon scanner (Molecular Dynamics, Sunnyvale, CA). The distribution of mRNA among the sucrose-gradient fractions was determined by densitometry.
Immunoblots. Cells were rinsed with ice-cold PBS and scrapped into lysis buffer containing 50 mmol/L Tris (pH 7.4), 150 mmol/L NaCl, 1 mmol/L EDTA, 1% NP40, supplemented with Roche protease inhibitor cocktail and Sigma phosphatase inhibitors I and II (St. Louis, MO). After centrifugation at 14,000 rpm to separate insoluble material, proteins were subjected to SDS-PAGE using NuPage 4% to 12% gels and NuPage MES or MOPS buffers according to the manufacturer's instructions (Invitrogen, San Diego, CA). After electrophoresis, gels were electroblotted onto polyvinylidene difluoride membranes (Millipore, Bedford, MA). The nonspecific sites on the membranes were blocked at room temperature for 30 minutes with 5% nonfat milk in TBS supplemented with 0.2% Tween 20 (TBS-T). Membranes were probed in blocking solution overnight at 4°C with the following antibodies: ADAM9, carbonic anhydrase 1 (Abcam, Cambridge, MA); FMRP, aquaporin 3, ß-actin (Chemicon, Temecula, CA); cyclin C, enolase 2, mitogen-activated protein kinase 6 (MAPK6), Ataxin 2 (BD Biosciences, San Jose, CA); Elk-3 (Net), TNFRSF6 (Fas), glyceraldehyde 3 phosphate dehydrogenase (GAPDH), p53R2, eIF4G, glutathione synthetase (Santa Cruz Biotechnology, Santa Cruz, CA); SOD2 (Upstate, Waltham, MA); and enolase 1 (GenWay, San Diego, CA). Membranes were then washed thrice in TBS-T and incubated with the appropriate horseradish peroxidaseconjugated secondary antibody at a 1:2,000 dilution in blocking solution for 1 hour at room temperature. Membranes were again washed thrice in TBS-T, developed with enhanced chemiluminescence Western blotting detection reagents (Amersham, Buckinghamshire, United Kingdom), and visualized with a Typhoon scanner (Molecular Dynamics).
| Results |
|---|
|
|
|---|
1 log of cell killing, and collected 6 hours later. The radiation treatment protocol was chosen to correspond to previous studies indicating that the maximum number of genes induced at the transcriptional level (i.e., using total RNA) is typically around 6 hours after a dose of
4 to 10 Gy (2, 6). In addition, the 6-hour time point has been typically used to evaluate the effects of radiation on the expression of individual transcripts (20). To identify genes under translational control after cellular exposure to radiation, cytoplasmic lysates from irradiated and control U87 cells were centrifuged through sucrose gradients and then collected in 11 continuous 1-mL fractions from lightest, which are devoid of ribosomes, to the heaviest, which contain the largest polysome complexes (18). A representative absorption profile (A254) from a sucrose gradient generated from U87 cells along with the RNA content of each 1-mL fraction is shown in Fig. 1. Radiation had no detectable effect on the polysome profile or the RNA content of each fraction (data not shown). The polysome containing fractions 5 to 11 were pooled; RNA was extracted and used for microarray analysis. In the same experiment, total RNA was isolated from whole-cell lysates from duplicate irradiated and untreated cultures and subjected to microarray analysis. Using both polysome-bound RNA and total RNA in these studies allowed for the identification of genes whose expression was regulated by radiation at the translational and/or transcriptional levels, respectively.
|
2-fold after irradiation, which were then classified as outliers. In total RNA, radiation resulted in 108 outliers (38 increased and 70 decreased), which is similar to the number of genes previously reported to be affected after irradiation of U87 cells (2). However, when microarray gene expression analysis was done using polysome RNA 1111 (757 increased and 354 decreased) outliers were detected. The list of genes whose expression was affected by
2-fold after irradiation in polysome and total RNA is presented in Supplementary Table 1. These data suggest that at least in U87 cells, although radiation affects gene transcription (total RNA) and translation (polysomal RNA), translation control is considerably more susceptible to radiation. A direct comparison of the radiation-induced gene expression profiles obtained from total RNA versus polysome RNA appears in Fig. 2B. As indicated by the correlation coefficient generated by the scatter plot, the radiation-induced expression profiles obtained from these two sources of mRNA were significantly different. Importantly, as shown in the accompanying Venn diagram, there were no outlier genes commonly affected by radiation in total RNA and polysome-bound RNA.
|
|
|
|
|
|
|
The studies above focused on brain tumor cell lines. To determine whether radiation has similar effects on normal cells of the central nervous system (CNS), microarray gene expression analysis was done on total and polysomal RNA isolated from normal human astrocytes grown in monolayer culture. As for the tumor cell lines, polysome-bound RNA was substantially more susceptible to radiation-induced changes than total RNA (Fig. 6A). The number of genes affected at the translational level (n = 1,399) was significantly greater than the number of genes (n = 39) modified by radiation at the transcriptional levels (total RNA). Ten genes were commonly affected in both total and polysomal RNA. The genes whose expression was modified in polysomal RNA in astrocytes were then compared with those identified as common outliers in the tumor cell lines (Fig. 6B). Although there were no genes commonly affected among the four cell types with respect to transcription changes (total RNA), there were 184 genes commonly affected at the level of translation (polysome RNA). As shown by GOstat analysis (Table 1) and the IPA in Fig. 5B, the genes affected after irradiation of normal astrocytes distributed to similar functional categories as those affected in the brain tumor cell lines. These results suggest that although there is cell type specificity, a fundamental cellular response to radiation involves modifying the translational control of a subset of genes.
| Discussion |
|---|
|
|
|---|
The mechanism through which radiation regulates the association of specific mRNAs with polysomes remains to be investigated. At a relatively high dose of 20 Gy radiation has been reported to decrease overall translation through inhibiting the disassociation of 4E-BP1 and eIF4E (24). However, at a clinically relevant dose of 2 Gy, radiation was shown to enhance the activities of S6 kinases via ErbB-dependent pathways, which suggested an increase in translational activity (25). Whereas these reports have associated radiation with changes in translation, the mechanism accounting for the recruitment to and away from polysomes of a specific subset of mRNAs as observed herein is unclear. To account for this specificity and because the mRNAs targeted by radiation were found to be components of functional pathways and interactive networks the post-transcriptional operon model put forth by Keene and Tenenbaum (26), which hypothesizes that RNA-binding proteins regulate the translation of functionally related mRNAs, may be applicable. Along these lines, Murmu et al. have reported that after whole body irradiation the RNA-binding protein CUGBP2 is induced in the mouse intestine, which was proposed to regulate cyclooxygenase-2 translation (27). In addition, epidermal growth factor receptor stimulation, which can occur after irradiation (25), was shown to result in the phosphorylation of CUGBP1 and increase its activity in mammary epithelial cells (28). Consistent with a potential role for RNA-binding proteins in the effects of radiation on translation control (Fig. 4A), irradiation of U87 cells resulted in an increase in the levels of FMRP, an RNA-binding protein involved in Fragile X syndrome (29) and GAPDH, a glycolytic enzyme recently shown to have RNA binding activity and to play a role in post-transcriptional regulation (23). Clearly, although the data presented here indicate that radiation regulates the translational activity of a subset of mRNAs, defining the mechanisms mediating this effect will require further investigations.
The disconnect between changes in transcription and translation after irradiation is consistent with previous reports involving eukaryotic cells undergoing other forms of stress (8, 9) and would seem to account for the general inability to correlate radiation-induced changes in gene transcription as detected by microarray analyses with changes in corresponding protein. In contrast, as shown here, the radiation-induced change in a gene's translational activity as detected by microarray analysis of polysome-bound RNA correlated for the most part (14 of 16) with a change in its protein product. Clearly, there are a number of processes distal to translation initiation, including protein stability and half-life that could account for the lack of a correlation between a change in the polysome association of an mRNA and its protein. However, given that polysome recruitment is a critical regulatory event through which environmental signals/stress can affect gene expression (714), the data presented are consistent with translational control serving as the primary mechanism mediating radiation-induced gene expression. Moreover, this study suggests that microarray analysis of polysome-bound RNA may provide an initial high-throughput screening strategy for identifying proteins that play a role in regulating cellular radioresponse.
The mRNAs whose polysome association was modified after irradiation were not simply a random collection but were components of a number of functional pathways. Several of the general pathways represented, such as cell cycle, cell death, and DNA replication, recombination and repair would be predicted to have a role in determining radiosensitivity. However, the affected genes were also preferentially distributed in other pathways that may be indicative of more novel aspects of cellular radioresponse. For example, IPA identified a statistically significant number of the genes that participate in cellular movement and cell morphology. Further investigation of these genes and their associated networks and pathways may provide insight into the previous observation that radiation increases glioma cell migration and invasiveness after irradiation (30). In addition, there were a number of genes increased in polysomes after irradiation involved in transcription regulation (GOstat) and gene expression (IPA). This may suggest that the effects of radiation on translational control may actually serve as regulators of transcription. More detailed time course analyses of radiation-induced translational and transcriptional changes will address this possibility. Whereas distributed to specific functional categories, the analyses presented indicate that the genes affected by radiation at the translational level were also components of interacting networks. While serving to illustrate the complexity of events and processes involved in cellular radioresponse, distribution of genes to interacting networks also suggest that it may be possible to target a single protein and affect the activities of multiple pathways operative in an irradiated cell.
Comparison of the three brain tumor cell lines regarding the genes whose transcription was modified by radiation revealed no commonly affected genes, which is consistent with previous reports. Such results have been interpreted as indicating that radiation-induced gene transcription is highly dependent on cellular genotype (6). In contrast, at the translational level radiation affected a significant number of the same genes (n = 296) in each of the brain tumor cell lines. Moreover, of the 296 genes commonly affected in the brain tumor cell lines, 184 (62%) were also modified by radiation in primary cultures of normal human astrocytes. These findings suggest that radiation-induced translational control is a fundamental component of cellular radioresponse, at least for cells of CNS origin. Whether there are similarities with genes modified at the translational level after irradiation of other tumor and normal cells remains to be determined. However, these initial results suggest that understanding translational control should generate insights into the mechanisms regulating the cellular radiosensitivity.
| Acknowledgments |
|---|
| Footnotes |
|---|
3 http://nciarray.nci.nih.gov/. ![]()
5 https://analysis.ingenuity.com. ![]()
Received 9/26/05. Revised 11/ 8/05. Accepted 11/14/05.
| References |
|---|
|
|
|---|
translation revealed through use of cDNA arrays. Mol Cell Biol 2003;23:231628.
mRNA after cellular exposure to ionizing radiation. Proc Natl Acad Sci U S A 1989;86:101047.This article has been cited by other articles:
![]() |
S. Rosi, M. Andres-Mach, K. M. Fishman, W. Levy, R. A. Ferguson, and J. R. Fike Cranial Irradiation Alters the Behaviorally Induced Immediate-Early Gene Arc (Activity-Regulated Cytoskeleton-Associated Protein) Cancer Res., December 1, 2008; 68(23): 9763 - 9770. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Iadevaia, S. Caldarola, E. Tino, F. Amaldi, and F. Loreni All translation elongation factors and the e, f, and h subunits of translation initiation factor 3 are encoded by 5'-terminal oligopyrimidine (TOP) mRNAs RNA, September 1, 2008; 14(9): 1730 - 1736. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kumaraswamy, P. Chinnaiyan, U. T. Shankavaram, X. Lu, K. Camphausen, and P. J. Tofilon Radiation-Induced Gene Translation Profiles Reveal Tumor Type and Cancer-Specific Components Cancer Res., May 15, 2008; 68(10): 3819 - 3826. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Culjkovic, K. Tan, S. Orolicki, A. Amri, S. Meloche, and K. L.B. Borden The eIF4E RNA regulon promotes the Akt signaling pathway J. Cell Biol., April 3, 2008; 181(1): 51 - 63. [Abstract] [Full Text] [PDF] |
||||
![]() |
Rebuttal from Drs. Esser and McCarthy J Appl Physiol, September 1, 2007; 103(3): 1103 - 1103. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |