| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Immunology |
1 Department of Biological Sciences, University of Maryland Baltimore County, Baltimore, Maryland; 2 The Schepens Eye Research Institute and Department of Ophthalmology, Harvard Medical School, Boston, Massachusetts; and 3 Division of Oncology, University of Washington, Seattle, Washington
Requests for reprints: Suzanne Ostrand-Rosenberg, Department of Biological Sciences, University of Maryland Baltimore County, Baltimore, MD 21250. Phone: 410-455-2237; Fax: 410-455-3875; E-mail: srosenbe{at}umbc.edu.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
T cells that are cytotoxic for tumor cells are typically CD8+ T lymphocytes, and optimal activation of these cells usually requires coactivation of CD4+ T helper lymphocytes (3, 4). CD4+ T lymphocytes are also required for generating CD8+ T memory cells (57). Because of these critical roles for CD4+ T cells, we are developing cancer vaccines that specifically target the activation of CD4+ T cells while concurrently activating cytotoxic CD8+ T lymphocytes.
CD4+ T lymphocytes are activated to peptide antigen that is presented by MHC class II molecules. Because MHC II molecule expression is usually limited to professional antigen-presenting cells (APC), immunity to most pathogens requires that professional APCs acquire antigen from exogenous sources. To facilitate the presentation of endocytosed antigen, professional APCs contain the MHC class IIassociated accessory molecule, invariant chain (Ii). Ii hinders the presentation of endogenously synthesized peptides and favors the presentation of antigen acquired by endocytosis. It mediates this effect by binding to newly synthesized MHC class II molecules in the endoplasmic reticulum and preventing them from acquiring peptides of endogenously synthesized molecules. The Ii chain also contains trafficking signals, which guide newly synthesized MHC II molecules to the endocytic pathway where Ii protein is degraded and peptides derived from endocytosed proteins bind (reviewed by refs. 8, 9). In professional APCs, MHC class II and Ii molecules are coordinately regulated at the transcriptional level by the MHC class II transcriptional activator (CIITA), a master regulatory gene that controls expression of all MHC II alleles (1013). This coordinate regulation assures that professional APCs efficiently present antigenic peptides acquired from extracellular sources.
Ii has been considered essential for MHC II function. Its requirement is supported by the finding that Ii knockout mice have dysfunctional or very low levels of MHC class II molecules, and CD4+ T cell activation is minimal (1418). In contrast, some Ii-negative nonprofessional APCs when transfected or transduced with MHC class II genes present antigen and activate CD4+ T cells (16, 1922), suggesting that MHC class II molecules can be fully functional in the absence of Ii.
Based on the assumption that coexpression of Ii blocks endogenous antigen presentation, we have produced cancer vaccines by transducing MHC II tumor cells with syngeneic MHC II and costimulatory molecule genes. The vaccines mediate tumor regression in mice and activate tumor-specific CD4+ T cells (20, 2326). Activated CD4+ T cells in both mouse and human systems are specific for antigens encoded by the vaccine cells. These vaccines have been produced by transducing MHC class II tumor cells with a single HLA-DR allele. Because expression of multiple MHC II alleles may facilitate presentation of a broader repertoire of tumor antigens, we have now transduced tumor cells with the CIITA. To determine if Ii coexpression affects T-cell activation to endogenous antigen, we have introduced small interfering RNAs (siRNA) specific for Ii into human tumor cells transduced with the CIITA and CD80 costimulatory molecule genes. The transductants efficiently activate human CD4+ T cells to HER-2/neu tumor antigen epitopes, suggesting that this strategy may be useful for vaccine design. Properly conformed and functional MHC II heterodimers are present in transductants with or without Ii siRNA, indicating that Ii is not essential for the HLA-DR function. Surprisingly, transductants with or without the Ii siRNA are equally efficient at activating CD4+ T cells, indicating that in this system, Ii does not impair endogenous antigen presentation.
| Materials and Methods |
|---|
|
|
|---|
siRNA. Complementary sequences in the coding region of the human Ii gene (Genbank accession no. NID NM_004355) were identified using the Ambion siRNA target finder search engine (Ambion, Inc., Austin, TX). Sequences with no homology to other known human mRNAs were chosen at random from the 3' to 5' end of the Ii mRNA. siRNAs were produced by in vitro transcription with T7 RNA polymerase (29) using the Ambion Silencer siRNA Construction kit and were made homologous to sequences 4, 8, 16, 24, and 50 (double adenine regions found by the Ambion target finder search engine). siRNAs were transfected into 293T/CIITA cells (20) using 40 ng siRNA. siRNAs producing 4- to 50-fold decreases in Ii expression were identified, and oligonucleotide siRNA expression cassettes were prepared by MWG Biotech (High Point, NC) and inserted into the pSIREN Retro-Q vector (Clontech) according to the manufacturer's directions (Clontech). The forward and reverse primers were annealed and ligated to the linearized pSIREN-RetroQ vector with BamHI and EcoRI "sticky ends."
Retroviral constructs, transductions, and drug selection. The human CIITA gene was cloned from pcDNA1-amp/tagCIITA (30) into Litmus28 (New England Biolabs, Beverly, MA) using XbaI and EcoRI and then cloned into a modified pLNCX retroviral vector, pLNXC2(AvrII) (neo resistance; ref. 20) using BglII and AvrII.
The HLA-DRB1*0701 cDNA (in RSV.5 vector; ref. 31) contained two point mutations: a guanine instead of an adenine at base 13 and an adenine instead of a thymine at base 191. These errors were corrected using Splicing by Overlapping Extensions (SOEing; ref. 32) using the following four primers in successive SOEing reactions: primer 1, AGTACCCGGGATGGTGTGTCTGAAGCTCCCTG; primer 2, AGCGCACGAACTCCTCCTGGTTATAGAA; primer 3, TTCTATAACCAGGAGGAGTTCGTGCGCT; primer 4, TAGTGCGGCCGCTCAGCTCAGGAATCCTGTTG. Reaction 1: 10 pmol/L RSV.5/DRB1*0701 template and 0.5 µmol/L of primers 1 and 2; cycle at 95°C for 2 minutes, then 30 cycles of 95°C for 30 seconds, 60.2°C for 30 seconds, 72°C for 1 minute, then 72°C for 10 minutes. Reaction 2: 10 pmol/L RSV.5/DR1*0701 template and 0.5 µmol/L primers 1 and 2; same as PCR1, but annealing temperature was 62.3°C. Reaction 3: 10 pmol/L of product from reactions 1 and 2 were mixed with primers 1 and 4 and incubated at 95°C for 2 minutes followed by five rounds of 95°C for 30 seconds followed by 60.2°C for 30 seconds followed by 72°C for 1 minute. Then five rounds more of the same reaction with annealing temperature at 62.3°C followed by 23 rounds of the same reaction at 64.8°C followed by 72°C for 10 minutes. All reactions used 2 units of PFU turbo polymerase (Invitrogen) according to the manufacturer's specifications. These primers added the XmaI and NotI restriction sites on the 5' and 3' ends of the cDNA, respectively. The corrected sequence was confirmed by sequencing of both strands.
Using the same restriction sites as for cloning of pLNCX2/HLA-DR1, the HLA-DRB1*0701 or HLA-DRB1*0401 genes were cloned into the downstream site of the pIRES/DRA0101 vector containing the HLA-DRA*0101 gene in the upstream site. The DRA0101-IRES-DRB1 section was excised from the resulting vector and cloned into the retroviral vector pLNCX2(AvrII). The pLHCX/CD80 retroviral construct, retrovirus production, and transductions were previously described (20).
Transduced cells were selected as follows: CD80 transductants (150 µg/mL hygromycin); DR4, DR7, and CIITA transductants (300 µg/mL G418); siRNA transductants (0.3 µg/mL puromycin). If 2 to 3 weeks of drug selection did not yield homogeneous populations of transgene-expressing cells, the transductants were sorted by magnetic bead selection (Miltenyi, Auburn, CA) according to the manufacturer's directions.
Peptides, antibodies, reagents, and immunofluorescence. HER-2/neu peptide 98-114 (RLRIVRGTQLFEDNYAL) and peptide 776-790 (GVGSPYVSRLLGICL; refs. 33, 34) were synthesized at the University of Maryland Biopolymer Laboratory. Monoclonal antibodies (mAb: HLA-DR-FITC and CD80-PE), streptavidin-PE, FITC-isotype, and PE-isotype controls were from BD PharMingen (San Diego, CA). Biotinylated HLA-DR1 mAb (BIH0126) was from One Lambda, Inc. (Canoga Park, CA); HLA-DQ-PE and HLA-DP-FITC were from Chemicon (Temecula, CA); rat anti-mouse IgG-FITC was from ICN (Costa Mesa, CA); c-neu (Ab-2) was from Oncogene (Cambridge MA); CD4-FITC, CD8-FITC, and anti-human IgG-FITC were from Miltenyi Biotech; and human IgG-FITC was from Cappel (West Chester, PA). Culture supernatants of hybridomas W6/32 (pan HLA-A,B,C), L243 (pan anti-HLA-DR), PIN1.1 (anti-Ii), and 28.14.8 (anti-H-2DbLd) were prepared, and tumor cells and PBMCs were stained for cell surface markers (MHC class I, class II, CD80, CD4, CD8, and immunoglobulin) or fixed and stained for Ii as described (20).
Western blots. Ii Western blots were done as described (20). Blots for MHC II were done as for Ii with the following modifications: cell lysates were loaded onto SDS-PAGE gels using nonreducing loading dye [0.2% SDS, 20% glycerol, 1.25 mol/L Tris (pH 6.8), and 0.4 mg/mL bromophenol blue]. Half of each sample was boiled for 5 minutes immediately before loading. Blocking buffer was 2% bovine serum in TBST. Membranes were incubated with undiluted supernatant from hybridoma L243, and the last wash was done for 1 hour.
T-cell priming. PBMCs from healthy donors (2 x 107/4 mL/well) were cultured in PBMC medium [Iscove's modified Dulbecco's medium, 10% FCS, 1% penicillin, 1% streptomycin (BioSource, Rockville, MD), 2 mmol/L Glutamax (Bethesda Research Laboratories/Life Sciences, Grand Island, NY)] with 2 µg/mL of HER2 p98 or p776 in six-well tissue culture plates at 37°C and 5% CO2 for 5 days. Nonadherent cells were harvested, washed twice with PBMC medium, and replated in 24-well plates with 20 units/mL of recombinant human interleukin 2 (IL-2; R&D Systems, Minneapolis, MN) at 1 x 106/2 mL/well. HER2-activated nonadherent cells were harvested 7 days later; live cells were isolated using Histopaque-1077, cultured 1 to 5 days without exogenous IL-2, and used the following day. For some experiments, after incubation with IL-2, nonadherent PBMCs were cultured at 1 x 107/4 mL/well with 8 x 106, 50 Gy-irradiated SUM/DR7/CD80 cells for 5 days, washed and cultured as above with IL-2 for 7 days, and washed and rested for 1 day before use.
Alternatively, PBMCs were obtained from HER-2/neu-immunized patients with stage III or IV breast, ovarian, or nonsmall cell lung cancer participating in a University of Washington Food and Drug Administrationapproved phase I trial (35). Patients were immunized intradermally once a month for 6 months to the same regional draining lymph node site with three different peptides derived from HER-2/neu and admixed with 100 µg granulocyte macrophage colony-stimulating factor. PBMCs were collected 1 month after the last immunization and cryoperserved. For ex vivo boost, PBMCs were thawed at 37°C, washed twice, and resuspended at 3 x 106/mL in X-VIVO media [10% human AB serum, 2 mmol/L L-glutamine, 20 mmol/L HEPES buffer, and 10 mmol/L acetylcysteine solution (USP)]. The cells were stimulated with 10 mg/mL of HER-2/neu peptides (p98, p776, or p98+p776) and incubated at 37°C in 5% CO2 for 12 days. On days 4/5 and 8, 10 units/mL of recombinant human IL-2 (Chiron Corp., Emeryville, CA) and 10 ng/mL of recombinant human IL-12 (R&D System) were added. On day 12, the cells were harvested, washed, counted, tested by flow cytometry and enzyme-linked immunospot (ELISPOT), and resuspended at 1 x 106/mL in fresh media containing 1 x 105/mL of anti-CD3/CD28coated beads to a final concentration of 1 or 10 bead(s) per T cell. Between days 14 and 23, the cell concentration was evaluated every 2 to 3 days, and the cells were diluted to 0.5 to 1 x 106/mL with fresh media as needed. On days 15, 18, 20, and 22, IL-2 was added to a final concentration of 30 units/mL, and on day 25, the expanded cells were harvested, washed, counted, and evaluated by flow cytometry and ELISPOT (36).
Antigen presentation assays. Antigen presentation assays and T-cell depletions were done as described (20) using Miltenyi human CD4 and CD8 beads with the following modifications: stimulator cells were used at 2.5 x 104 per well. MCF10-derived and MCF10A stimulator cells were not irradiated; all other stimulators were 50 Gy irradiated. Antibody blocking experiments included 20 µg/mL L243 (anti-HLA-DR), W6-32 (anti-class I MHC), or 28.14.8. For exogenous HER2 peptide presentation, assays were as for endogenous antigen presentation, except soluble HER2 peptide p98 or p776 was included at 2 µg/mL.
HLA-DR nomenclature and genotypes. Normal donor PBMCs are A24, A29, B44, B35, DR7, DR11, and DRß3,4. SUM159PT cells are A2, A24, B5, B15, DR4, and DR13. OMM2.3 cells are A11, A29, B7, and B52. MCF10 and MCF10A cells are A33, B55, B22, DR7, and DR4. HLA genotypes were determined by PCR typing and are referred to by their short-hand form (e.g., HLA-DR7 is DRB1*0701).
Statistical analyses. Means, SDs, and statistical significance as measured by Student's t test were calculated using Excel v2002.
| Results |
|---|
|
|
|---|
|
Western analyses for Ii (mAb PIN1.1) were done 3 days after transduction to confirm that Ii expression was down-regulated. The predominant form of Ii in MCF10/CIITA cells is p35, with a smaller amount of p33 (Fig. 2A). The p35 isoform, which is translated via an alternative translation initiation site, is normally the less abundant isoform of Ii (37). Others have noted an increase in p35 in tumors (38). The p35 and p33 isoforms are both down-regulated >95% in the siRNAs 53, 48, or 32 transductants, and there is a slight down-regulation in siRNA 4.1. siRNAs 4.2 and 54 do not affect Ii expression. Interestingly, at 3 days after transduction, all of the down-regulated cell lines contain a 23-kDa band that corresponds to an Ii degradation product. To ascertain if p23 persists, MCF10/CIITA/siRNA 32 and 53 were cultured in selective media for 3 weeks and subsequently tested by Western analysis. Neither full-length Ii nor the Ii degradation product is present 3 weeks after selection (Fig. 2B). Similar results were obtained with MCF10/CD80/CIITA/siRNA cells (data not shown).
|
MCF10/CIITA/CD80 cells down-regulated for Ii contain stable MHC class II heterodimers. Formation of stable
ß heterodimers that dissociate upon boiling is a hallmark of correctly conformed MHC class II molecules (39). To determine if the siRNA transductants have properly conformed MHC II molecules, lysates of >3-week drug-selected cells were either boiled or not boiled before Western blotting with the L243 mAb, which is specific for MHC II
ß dimers. Nonboiled samples contain bands migrating at
55 kDa that correspond to stable MHC class II
ß heterodimers (Fig. 2D). Therefore, tumor cells transduced with the CIITA and Ii siRNA express properly conformed MHC class II molecules in the absence of Ii.
MCF10/CIITA/CD80/siRNA cells present endogenous HER-2/neu peptides and activate CD4+ T cells. To assess if MHC class II is functional in the absence of Ii, MCF10/CD80/CIITA/siRNA 32 cells, which are down-regulated for Ii >99%, were used as APCs for the activation of PBMCs to tumor-encoded epitopes. HER-2/neu, a growth factor receptor that is overexpressed by many tumors, was used as the tumor antigen because (a) MCF10 cells constitutively overexpress HER-2/neu (Fig. 3A); (b) HER-2/neu contains two HLA-DR7-restricted peptides (p98 and p776; refs. 33, 34); and (c) MCF10/CD80/CIITA cells express DR7. To control for HLA-DR specificity, ocular melanoma OMM2.3 and breast cancer SUM159PT were transduced with CD80 and DR7 or DR4 retroviruses (Fig. 3B). OMM2.3 and SUM159PT cells express HER-2/neu and do not express Ii, and the respective transductants express CD80 and DR4 or DR7 (Fig. 3C).
|
production was measured. Soluble peptide p98 or p776 was added to some wells to determine if the transductants preferentially present peptides from exogenous sources. MCF10/CIITA/CD80/siRNA 32 and MCF10/CIITA/CD80 present peptides p98 and p776 from endogenously synthesized HER-2/neu (Fig. 4A and B). Peptide p776 is presented equally well by MCF10/CIITA/CD80/siRNA 32 and MCF10/CIITA/CD80, whereas MCF10/CIITA/CD80 cells are slightly better presenters of p98 (P < 0.05). Both MCF10 cell lines present exogenously pulsed HER-2/neu peptides. Exogenous peptide presentation is not significantly better than presentation of endogenous peptide and is not affected by Ii expression. HER-2/neu presentation is DR7 restricted because cells lacking DR7 (MCF10/CD80, OMM2.3/DR4/CD80, and SUM159/CD80) do not induce significant IFN-
release. T-cell activation is limited to MHC-restricted antigen, and there is no activation to allogeneic MHC antigens because neither MCF10/CD80 nor SUM159/CD80 cells induce significant IFN-
release. Therefore, down-regulation of Ii by siRNA slightly diminishes presentation of peptide p98 but does not significantly affect presentation of p776, suggesting that presentation of some epitopes may be Ii dependent, whereas presentation of others is independent of Ii. In either case, removal of Ii does not render MHC class II molecules unable to present antigen, indicating that MHC class II antigens are functional in the absence of Ii.
|
; however, supernatant-pulsed cells did not (data not shown). Therefore, MCF10/CIITA/CD80/siRNA 32 cells are presenting endogenously synthesized molecules. Peptides p98 and p776 also activate CD8+ T cells, suggesting that they may contain nested MHC class I epitopes (33, 34). The HER-2/neu-activated T cells share DR7 with the transduced MCF10 cells, and DR7 and A24 with SUM159PT/DR7/CD80 cells. No MHC class I alleles are common between p98- and p776-activated PBMCs and transduced MCF10 cells. Because peptides p98 and p776 are presented by both DR4 and DR7, there is the potential for the activation of both CD4+ and CD8+ T cells by SUM159PT/DR7/CD80 but not by MCF10/CIITA/CD80/siRNA 32 cells. To identify which T cells are activated, PBMCs were primed with p98 and p776 and subsequently incubated with vaccine cells in the presence of antibodies to MHC class I and/or MHC class II. Antibodies to MHC class II block antigen presentation by MCF10/CIITA/CD80/siRNA 32 and MCF/CIITA/CD80, whereas antibodies to both MHC I and II block antigen presentation by SUM159/DR7/CD80 cells (Fig. 4C). To confirm the activation of CD4+ and CD8+ T cells, PBMCs were primed with p776 and depleted for CD4+ or CD8+ T cells, before activation by MCF10 or SUM159PT transductants. Depletion of CD4+ T cells completely eliminates T-cell activation by both MCF10/CIITA/CD80/32 and SUM/DR7/CD80 cells. Depletion of CD8+ T cells significantly reduces T-cell activation by SUM159PT transductants and has a smaller effect on MCF10/CIITA/CD80/32-induced T-cell activation (Fig. 4D and E). This latter effect is probably nonspecific because MCF10/CIITA/CD80/32 cells do not share MHC class I alleles with PBMCs. Similar results were obtained with p98-primed PBMCs (data not shown).
MCF10/CIITA/32 cells were also included in this experiment (Fig. 4D) to determine if coexpression of CD80 enhances boosting of HER-2/neu-specific CD4+ T cells. In agreement with earlier findings (20), CD80-expressing transductants are better stimulators. Therefore, the transductants activate both CD4+ and CD8+ T cells if they share common alleles with the responding PBMCs, and coexpression of CD80 enhances activation.
Nonmalignant cells do not activate T cells. A potential problem with cell-based vaccines is that they will activate T cells against nonmalignant cells due to cross-reactivity with normal self-antigens. To determine if the MHC II vaccines induce reactivity against nonmalignant cells, PBMCs were activated with HER-2/neu p776 peptide and tested on MCF10 cells and their nonmalignant counterpart, MCF10A cells. As measured by flow cytometry, MCF10A cells express HER-2/neu, although at slightly lower levels than MCF10 cells (Fig. 5A compare with Fig. 3A). Unlike MCF10 cells, MCF10A cells do not express MHC II molecules; however, they are inducible for MHC II if incubated for 48 hours with 1,000 units/mL of rIFN
. As seen in Fig. 5B, neither untreated nor IFN
-treated MCF10A cells activate T cells. Therefore, tumor-specific T cells are activated by MHC II+CD80+ tumor cellbased vaccines and not by nonmalignant cells of the same tissue origin.
|
| Discussion |
|---|
|
|
|---|
Our vaccine design was based on the hypothesis that coexpression of Ii would inhibit the presentation of endogenously synthesized tumor peptides, a hypothesis supported by our own earlier work and extensive work of others in nontumor systems (8, 9). Recent mass spectroscopy studies (42) provide direct biochemical support for this hypothesis and also provide an explanation for the lack of inhibition of Ii for HER-2/neu peptides p98 and p776. These investigators showed that the MHC II molecules of MHC II+Ii cells contain peptides presented by MHC II+Ii+ cells plus additional novel peptides, which are not presented by MHC II+Ii+ cells (42). Because p98 and p776 were originally identified as epitopes presented by MHC II+Ii+ professional APCs (33, 34), they are most likely in the category of epitopes that are presented by both Ii+ and Ii APCs. However, the findings of ref. (42) make it likely that the MHC II+Ii transductants also present novel tumor antigen epitopes that are not presented by professional APCs. In this fashion, Ii RNAi vaccines may activate a more diverse repertoire of tumor-specific CD4+ T cells than professional APCs and may activate T cells that have not previously been tolerized by the tumor.
Clinical studies also support an inhibitory role for Ii. Chamuleau et al. have shown that acute myelogenous leukemia (AML) patients in complete remission whose HLA-DR+ myeloid leukemic blasts have low levels of the MHC class IIassociated Ii peptide (CLIP), a degradation product of Ii, have a significantly better clinical prognosis than patients whose blasts are DR+CLIP+ (43). Similar to AML blasts of progressor patients, DM-deficient mice also have DR+CLIP+ APCs, which are inefficient presenters of endogenously synthesized molecules (44). Preferential expression of the Ii p35 isoform is also associated with increased malignancy in chronic lymphocytic leukemia, and this effect has been attributed to reduced presentation of endogenously synthesized tumor antigens (38). Expression of CLIP is also associated with polarization towards a type 2 CD4 (Th2) response (45, 46), which may favor tumor progression (47).
Although early studies suggested that Ii expression was essential for MHC class II function (14, 15, 17), there are now many reports showing that MHC II alleles are properly conformed and functional in the absence of Ii (19, 20, 25, 48, 49). The present report extends this conclusion and shows that peptide affinity for MHC II is not affected by Ii, because peptide binding to surface MHC II molecules is similar for Ii+ and Ii cells. Therefore, although Ii may be required during development for expression of some mouse MHC II alleles, most MHC II alleles are stable and functional in the absence of Ii.
We envision that the vaccine strategy described here will be used to generate MHC II allelespecific vaccines from established cell lines. We propose a "cocktail" approach in which a patient will be treated with a mixture of multiple cell lines expressing MHC class I and II molecules matched to their genotype. Following HLA typing, a patient's "semicustomized cocktail" would be prepared from stocks of frozen transduced cells. This approach depends on the existence of shared tumor antigens and eliminates the need for autologous tumor cells, making it feasible to treat most patients. Although retroviruses could be used to induce MHC II and CD80 molecules, alternative techniques that are less controversial would be preferable.
This vaccine strategy has the potential to activate T cells to self-antigens that are also expressed on nonmalignant cells. Autoimmunity has not been observed in the three mouse tumor systems studied in vivo,4 and the absence of reactivity with the nonmalignant breast line MCF10A suggests that autoimmunity against normal cells will also not be a problem in patients. In addition, a DR4+DR7+ patient with advanced metastatic ocular melanoma has been treated with irradiated OMM2.3/CD80/DR4 and OMM2.3/CD80/DR7 vaccines, and no autoimmune or other complications were noted.5
Vaccines consisting of tumor cells transduced with the CIITA and Ii siRNAs have several potential advantages over previous vaccines in which MHC II nonexpressing tumor cells were transduced with individual MHC II alleles. Vaccines made by transducing single HLA-DR alleles are limited to presenting tumor antigen epitopes restricted by the transduced allele(s). In contrast, CIITA-transduced vaccine cells express multiple HLA-DR alleles, as well as DP and DQ alleles, and hence have the potential to present a much broader repertoire of tumor antigen epitopes. The CIITA/siRNA vaccines also differ from the previous MHC II vaccines in that expression of the CIITA up-regulates accessory molecules, such as HLA-DM. Although our previous studies have not shown that HLA-DM expression facilitates vaccine efficacy (50), studies by others have shown that HLA-DM expression stabilizes MHC II in the absence of Ii, aids MHC II traffic, and helps edit the MHC II peptide repertoire (42).
The CIITA/Ii siRNA strategy also expands the choice of tumor cells which could be used to generate vaccines to include tumors that constitutively express MHC II or are inducible for MHC II by treatment with IFN
. Tumor cells that constitutively coexpress MHC II and costimulatory molecules, such as some leukemias (43), are particularly attractive targets for Ii siRNA therapy because creating a vaccine would only require down-regulating Ii via RNA interference (RNAi). This approach is supported by studies in which Ii was down-regulated in MHC IIpositive, Ii-positive mouse tumor cells by antisense RNA (5155). Mice immunized with the Ii antisense down-regulated tumor cells were protected against later challenge with wild-type tumor. Because siRNA is more effective in down-regulating Ii than antisense RNA, Ii siRNA vaccines may have more therapeutic efficacy than Ii antisense vaccines. Therefore, tumor cells expressing the CIITA and costimulatory molecules may be useful reagents, and concomitant down-regulation of Ii via RNAi may further improve vaccine efficacy and protect and/or treat tumor recurrence and/or metastatic disease.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Dr. Santa Ono (Department of Immunology, University College London, University of London, United Kingdom) for the CIITA gene, Dr. Dean Mann (Department of Pathology, University of Maryland Medical System, Baltimore, MD) for the PBMC, Virginia Clements for making the OMM2.3 transductants, Matthew Barthalow for making the pLNCX2/CIITA construct, Agnes Cheung and Nicole Dean for making the DR4 construct, Dr. Robert Pauley (Karmanos Cancer Institute, Wayne State University School of Medicine, Detroit, MI) for the MCF10 cells, and Dr. Amy Fulton (Department of Pathology, University of Maryland, Baltimore, MD) for the MCF10A cells.
| Footnotes |
|---|
5 S. Slavin, personal communication. ![]()
Received 6/29/05. Revised 10/17/05. Accepted 11/ 1/05.
| References |
|---|
|
|
|---|
, mitomycin C, cycloheximide as regulatory agents of MHC class II-associated invariant chain expression. J Immunol 1986;136:22939.[Abstract]
. J Immunol 1984;132:13619.[Abstract]
mediated by the transactivator gene CIITA. Science 1994;265:1069.
and ß chains in chronic lymphocytic leukemia. Cell Immunol 1996;171:6873.[CrossRef][Medline]
. Cancer Immunol Immunother 2000;49:3445.[CrossRef][Medline]This article has been cited by other articles:
![]() |
D. Kim, T. Hoory, A. Monie, J. P.-Y. Ting, C.-F. Hung, and T.-C. Wu Enhancement of DNA Vaccine Potency through Coadministration of CIITA DNA with DNA Vaccines via Gene Gun J. Immunol., May 15, 2008; 180(10): 7019 - 7027. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. C. de Bruin, C. J.H. van de Velde, J. H. J.M. van Krieken, C. A.M. Marijnen, and J. P. Medema Epithelial Human Leukocyte Antigen-DR Expression Predicts Reduced Recurrence Rates and Prolonged Survival in Rectal Cancer Patients Clin. Cancer Res., February 15, 2008; 14(4): 1073 - 1079. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Bosch, J. A. Thompson, M. K. Srivastava, U. K. Iheagwara, T. G. Murray, M. Lotem, B. R. Ksander, and S. Ostrand-Rosenberg MHC Class II-Transduced Tumor Cells Originating in the Immune-Privileged Eye Prime and Boost CD4+ T Lymphocytes that Cross-react with Primary and Metastatic Uveal Melanoma Cells Cancer Res., May 1, 2007; 67(9): 4499 - 4506. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Oldford, J. D. Robb, D. Codner, V. Gadag, P. H. Watson, and S. Drover Tumor cell expression of HLA-DM associates with a Th1 profile and predicts improved survival in breast carcinoma patients Int. Immunol., November 1, 2006; 18(11): 1591 - 1602. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |