Cancer Research Cell Death Mechanisms and Cancer Therapy  EMT and Cancer Progression and Treatment
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thompson, J. A.
Right arrow Articles by Ostrand-Rosenberg, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thompson, J. A.
Right arrow Articles by Ostrand-Rosenberg, S.
[Cancer Research 66, 1147-1154, January 15, 2006]
© 2006 American Association for Cancer Research


Immunology

Tumor Cells Transduced with the MHC Class II Transactivator and CD80 Activate Tumor-Specific CD4+ T Cells Whether or Not They Are Silenced for Invariant Chain

James A. Thompson1, Samudra K. Dissanayake1, Bruce R. Ksander2, Keith L. Knutson3, Mary L. Disis3 and Suzanne Ostrand-Rosenberg1

1 Department of Biological Sciences, University of Maryland Baltimore County, Baltimore, Maryland; 2 The Schepens Eye Research Institute and Department of Ophthalmology, Harvard Medical School, Boston, Massachusetts; and 3 Division of Oncology, University of Washington, Seattle, Washington

Requests for reprints: Suzanne Ostrand-Rosenberg, Department of Biological Sciences, University of Maryland Baltimore County, Baltimore, MD 21250. Phone: 410-455-2237; Fax: 410-455-3875; E-mail: srosenbe{at}umbc.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The specificity and potency of the immune system make immunotherapy a potential strategy for the treatment of cancer. To exploit this potential, we have developed cell-based cancer vaccines consisting of tumor cells expressing syngeneic MHC class II and costimulatory molecules. The vaccines mediate tumor regression in mice and activate human CD4+ T cells in vitro. Previous vaccines were generated by transducing MHC II negative tumor cells with a single HLA-DR allele. Because expression of multiple MHC II alleles would facilitate presentation of a broader repertoire of tumor antigens, we have now transduced tumor cells with the MHC class II transactivator (CIITA), a regulatory gene that coordinately increases expression of all MHC II alleles. Previous studies in mice indicated that coexpression of the MHC II accessory molecule invariant chain (Ii) inhibited presentation of endogenously synthesized tumor antigens and reduced vaccine efficacy. To determine if Ii expression affects presentation of MHC class II–restricted endogenously synthesized tumor antigens in human tumor cells, HLA-DR-MCF10 breast cancer cells were transduced with the CIITA, CD80 costimulatory molecule gene, and with or without small interfering RNAs (siRNA) specific for Ii. Ii expression is silenced >95% in CIITA/CD80/siRNA transductants; down-regulation of Ii does not affect HLA-DR expression or stability; and Ii+ and Ii transductants activate human CD4+ T cells to DRB1*0701-restricted HER-2/neu epitopes. Therefore, tumor cells transduced with the CIITA, CD80, and with or without Ii siRNA present endogenously synthesized tumor antigens and are potential vaccines for activating tumor-specific CD4+ T cells. (Cancer Res 2006; 66(2): 1147-54)


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Immunotherapy is a potential approach for the treatment and/or prevention of cancer because of its specificity, sensitivity, potency, and long-term memory. T lymphocytes, the cellular arm of the immune response, are particularly promising because they have the capability of localizing to tumor sites and directly killing tumor cells. Because of these characteristics, vaccines and/or immunotherapy may facilitate the destruction of existing disseminated metastatic tumor cells and protect individuals against the recurrence of primary tumors and/or the outgrowth of latent metastatic cells (1, 2).

T cells that are cytotoxic for tumor cells are typically CD8+ T lymphocytes, and optimal activation of these cells usually requires coactivation of CD4+ T helper lymphocytes (3, 4). CD4+ T lymphocytes are also required for generating CD8+ T memory cells (57). Because of these critical roles for CD4+ T cells, we are developing cancer vaccines that specifically target the activation of CD4+ T cells while concurrently activating cytotoxic CD8+ T lymphocytes.

CD4+ T lymphocytes are activated to peptide antigen that is presented by MHC class II molecules. Because MHC II molecule expression is usually limited to professional antigen-presenting cells (APC), immunity to most pathogens requires that professional APCs acquire antigen from exogenous sources. To facilitate the presentation of endocytosed antigen, professional APCs contain the MHC class II–associated accessory molecule, invariant chain (Ii). Ii hinders the presentation of endogenously synthesized peptides and favors the presentation of antigen acquired by endocytosis. It mediates this effect by binding to newly synthesized MHC class II molecules in the endoplasmic reticulum and preventing them from acquiring peptides of endogenously synthesized molecules. The Ii chain also contains trafficking signals, which guide newly synthesized MHC II molecules to the endocytic pathway where Ii protein is degraded and peptides derived from endocytosed proteins bind (reviewed by refs. 8, 9). In professional APCs, MHC class II and Ii molecules are coordinately regulated at the transcriptional level by the MHC class II transcriptional activator (CIITA), a master regulatory gene that controls expression of all MHC II alleles (1013). This coordinate regulation assures that professional APCs efficiently present antigenic peptides acquired from extracellular sources.

Ii has been considered essential for MHC II function. Its requirement is supported by the finding that Ii knockout mice have dysfunctional or very low levels of MHC class II molecules, and CD4+ T cell activation is minimal (1418). In contrast, some Ii-negative nonprofessional APCs when transfected or transduced with MHC class II genes present antigen and activate CD4+ T cells (16, 1922), suggesting that MHC class II molecules can be fully functional in the absence of Ii.

Based on the assumption that coexpression of Ii blocks endogenous antigen presentation, we have produced cancer vaccines by transducing MHC II tumor cells with syngeneic MHC II and costimulatory molecule genes. The vaccines mediate tumor regression in mice and activate tumor-specific CD4+ T cells (20, 2326). Activated CD4+ T cells in both mouse and human systems are specific for antigens encoded by the vaccine cells. These vaccines have been produced by transducing MHC class II tumor cells with a single HLA-DR allele. Because expression of multiple MHC II alleles may facilitate presentation of a broader repertoire of tumor antigens, we have now transduced tumor cells with the CIITA. To determine if Ii coexpression affects T-cell activation to endogenous antigen, we have introduced small interfering RNAs (siRNA) specific for Ii into human tumor cells transduced with the CIITA and CD80 costimulatory molecule genes. The transductants efficiently activate human CD4+ T cells to HER-2/neu tumor antigen epitopes, suggesting that this strategy may be useful for vaccine design. Properly conformed and functional MHC II heterodimers are present in transductants with or without Ii siRNA, indicating that Ii is not essential for the HLA-DR function. Surprisingly, transductants with or without the Ii siRNA are equally efficient at activating CD4+ T cells, indicating that in this system, Ii does not impair endogenous antigen presentation.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cells. SUM159PT, Jurkat, Sweig, 293T, and peripheral blood mononuclear cells (PBMC) were handled as described (20). The human breast cancer line MCF10CA1 (hereafter called MCF10) and its nonmalignant counterpart MCF10A were cultured in MCF10 medium (DMEM/Hams F12, 1:1; 5% heat-inactivated FCS; 0.029 mol/L Na bicarbonate; 10 mmol/L HEPES; ref. 27) or MCF10A medium [MCF10 medium supplemented with 10 µg/mL insulin, 0.5 µg/mL hydrocortisone, 100 ng/mL cholera toxin (all from Sigma, St. Louis, MO), and 20 ng/mL epidermal growth factor (Invitrogen, Carlsbad, CA). MCF10 transductants were supplemented with puromycin (0.3 µg/mL; Clontech, Palo Alto, CA) or hygromycin (150 µg/mL; Calbiochem, San Diego, CA). The OMM2.3 human ocular melanoma line (28) was grown in RPMI with 10% heat-inactivated FCS and 5 x 10–5 mol/L ß-mercaptoethanol. All cell lines and procedures were approved by the institutional review boards of the participating institutions.

siRNA. Complementary sequences in the coding region of the human Ii gene (Genbank accession no. NID NM_004355) were identified using the Ambion siRNA target finder search engine (Ambion, Inc., Austin, TX). Sequences with no homology to other known human mRNAs were chosen at random from the 3' to 5' end of the Ii mRNA. siRNAs were produced by in vitro transcription with T7 RNA polymerase (29) using the Ambion Silencer siRNA Construction kit and were made homologous to sequences 4, 8, 16, 24, and 50 (double adenine regions found by the Ambion target finder search engine). siRNAs were transfected into 293T/CIITA cells (20) using 40 ng siRNA. siRNAs producing 4- to 50-fold decreases in Ii expression were identified, and oligonucleotide siRNA expression cassettes were prepared by MWG Biotech (High Point, NC) and inserted into the pSIREN Retro-Q vector (Clontech) according to the manufacturer's directions (Clontech). The forward and reverse primers were annealed and ligated to the linearized pSIREN-RetroQ vector with BamHI and EcoRI "sticky ends."

Retroviral constructs, transductions, and drug selection. The human CIITA gene was cloned from pcDNA1-amp/tagCIITA (30) into Litmus28 (New England Biolabs, Beverly, MA) using XbaI and EcoRI and then cloned into a modified pLNCX retroviral vector, pLNXC2(AvrII) (neo resistance; ref. 20) using BglII and AvrII.

The HLA-DRB1*0701 cDNA (in RSV.5 vector; ref. 31) contained two point mutations: a guanine instead of an adenine at base 13 and an adenine instead of a thymine at base 191. These errors were corrected using Splicing by Overlapping Extensions (SOEing; ref. 32) using the following four primers in successive SOEing reactions: primer 1, AGTACCCGGGATGGTGTGTCTGAAGCTCCCTG; primer 2, AGCGCACGAACTCCTCCTGGTTATAGAA; primer 3, TTCTATAACCAGGAGGAGTTCGTGCGCT; primer 4, TAGTGCGGCCGCTCAGCTCAGGAATCCTGTTG. Reaction 1: 10 pmol/L RSV.5/DRB1*0701 template and 0.5 µmol/L of primers 1 and 2; cycle at 95°C for 2 minutes, then 30 cycles of 95°C for 30 seconds, 60.2°C for 30 seconds, 72°C for 1 minute, then 72°C for 10 minutes. Reaction 2: 10 pmol/L RSV.5/DR1*0701 template and 0.5 µmol/L primers 1 and 2; same as PCR1, but annealing temperature was 62.3°C. Reaction 3: 10 pmol/L of product from reactions 1 and 2 were mixed with primers 1 and 4 and incubated at 95°C for 2 minutes followed by five rounds of 95°C for 30 seconds followed by 60.2°C for 30 seconds followed by 72°C for 1 minute. Then five rounds more of the same reaction with annealing temperature at 62.3°C followed by 23 rounds of the same reaction at 64.8°C followed by 72°C for 10 minutes. All reactions used 2 units of PFU turbo polymerase (Invitrogen) according to the manufacturer's specifications. These primers added the XmaI and NotI restriction sites on the 5' and 3' ends of the cDNA, respectively. The corrected sequence was confirmed by sequencing of both strands.

Using the same restriction sites as for cloning of pLNCX2/HLA-DR1, the HLA-DRB1*0701 or HLA-DRB1*0401 genes were cloned into the downstream site of the pIRES/DRA0101 vector containing the HLA-DRA*0101 gene in the upstream site. The DRA0101-IRES-DRB1 section was excised from the resulting vector and cloned into the retroviral vector pLNCX2(AvrII). The pLHCX/CD80 retroviral construct, retrovirus production, and transductions were previously described (20).

Transduced cells were selected as follows: CD80 transductants (150 µg/mL hygromycin); DR4, DR7, and CIITA transductants (300 µg/mL G418); siRNA transductants (0.3 µg/mL puromycin). If 2 to 3 weeks of drug selection did not yield homogeneous populations of transgene-expressing cells, the transductants were sorted by magnetic bead selection (Miltenyi, Auburn, CA) according to the manufacturer's directions.

Peptides, antibodies, reagents, and immunofluorescence. HER-2/neu peptide 98-114 (RLRIVRGTQLFEDNYAL) and peptide 776-790 (GVGSPYVSRLLGICL; refs. 33, 34) were synthesized at the University of Maryland Biopolymer Laboratory. Monoclonal antibodies (mAb: HLA-DR-FITC and CD80-PE), streptavidin-PE, FITC-isotype, and PE-isotype controls were from BD PharMingen (San Diego, CA). Biotinylated HLA-DR1 mAb (BIH0126) was from One Lambda, Inc. (Canoga Park, CA); HLA-DQ-PE and HLA-DP-FITC were from Chemicon (Temecula, CA); rat anti-mouse IgG-FITC was from ICN (Costa Mesa, CA); c-neu (Ab-2) was from Oncogene (Cambridge MA); CD4-FITC, CD8-FITC, and anti-human IgG-FITC were from Miltenyi Biotech; and human IgG-FITC was from Cappel (West Chester, PA). Culture supernatants of hybridomas W6/32 (pan HLA-A,B,C), L243 (pan anti-HLA-DR), PIN1.1 (anti-Ii), and 28.14.8 (anti-H-2DbLd) were prepared, and tumor cells and PBMCs were stained for cell surface markers (MHC class I, class II, CD80, CD4, CD8, and immunoglobulin) or fixed and stained for Ii as described (20).

Western blots. Ii Western blots were done as described (20). Blots for MHC II were done as for Ii with the following modifications: cell lysates were loaded onto SDS-PAGE gels using nonreducing loading dye [0.2% SDS, 20% glycerol, 1.25 mol/L Tris (pH 6.8), and 0.4 mg/mL bromophenol blue]. Half of each sample was boiled for 5 minutes immediately before loading. Blocking buffer was 2% bovine serum in TBST. Membranes were incubated with undiluted supernatant from hybridoma L243, and the last wash was done for 1 hour.

T-cell priming. PBMCs from healthy donors (2 x 107/4 mL/well) were cultured in PBMC medium [Iscove's modified Dulbecco's medium, 10% FCS, 1% penicillin, 1% streptomycin (BioSource, Rockville, MD), 2 mmol/L Glutamax (Bethesda Research Laboratories/Life Sciences, Grand Island, NY)] with 2 µg/mL of HER2 p98 or p776 in six-well tissue culture plates at 37°C and 5% CO2 for 5 days. Nonadherent cells were harvested, washed twice with PBMC medium, and replated in 24-well plates with 20 units/mL of recombinant human interleukin 2 (IL-2; R&D Systems, Minneapolis, MN) at 1 x 106/2 mL/well. HER2-activated nonadherent cells were harvested 7 days later; live cells were isolated using Histopaque-1077, cultured 1 to 5 days without exogenous IL-2, and used the following day. For some experiments, after incubation with IL-2, nonadherent PBMCs were cultured at 1 x 107/4 mL/well with 8 x 106, 50 Gy-irradiated SUM/DR7/CD80 cells for 5 days, washed and cultured as above with IL-2 for 7 days, and washed and rested for 1 day before use.

Alternatively, PBMCs were obtained from HER-2/neu-immunized patients with stage III or IV breast, ovarian, or non–small cell lung cancer participating in a University of Washington Food and Drug Administration–approved phase I trial (35). Patients were immunized intradermally once a month for 6 months to the same regional draining lymph node site with three different peptides derived from HER-2/neu and admixed with 100 µg granulocyte macrophage colony-stimulating factor. PBMCs were collected 1 month after the last immunization and cryoperserved. For ex vivo boost, PBMCs were thawed at 37°C, washed twice, and resuspended at 3 x 106/mL in X-VIVO media [10% human AB serum, 2 mmol/L L-glutamine, 20 mmol/L HEPES buffer, and 10 mmol/L acetylcysteine solution (USP)]. The cells were stimulated with 10 mg/mL of HER-2/neu peptides (p98, p776, or p98+p776) and incubated at 37°C in 5% CO2 for 12 days. On days 4/5 and 8, 10 units/mL of recombinant human IL-2 (Chiron Corp., Emeryville, CA) and 10 ng/mL of recombinant human IL-12 (R&D System) were added. On day 12, the cells were harvested, washed, counted, tested by flow cytometry and enzyme-linked immunospot (ELISPOT), and resuspended at 1 x 106/mL in fresh media containing 1 x 105/mL of anti-CD3/CD28–coated beads to a final concentration of 1 or 10 bead(s) per T cell. Between days 14 and 23, the cell concentration was evaluated every 2 to 3 days, and the cells were diluted to 0.5 to 1 x 106/mL with fresh media as needed. On days 15, 18, 20, and 22, IL-2 was added to a final concentration of 30 units/mL, and on day 25, the expanded cells were harvested, washed, counted, and evaluated by flow cytometry and ELISPOT (36).

Antigen presentation assays. Antigen presentation assays and T-cell depletions were done as described (20) using Miltenyi human CD4 and CD8 beads with the following modifications: stimulator cells were used at 2.5 x 104 per well. MCF10-derived and MCF10A stimulator cells were not irradiated; all other stimulators were 50 Gy irradiated. Antibody blocking experiments included 20 µg/mL L243 (anti-HLA-DR), W6-32 (anti-class I MHC), or 28.14.8. For exogenous HER2 peptide presentation, assays were as for endogenous antigen presentation, except soluble HER2 peptide p98 or p776 was included at 2 µg/mL.

HLA-DR nomenclature and genotypes. Normal donor PBMCs are A24, A29, B44, B35, DR7, DR11, and DRß3,4. SUM159PT cells are A2, A24, B5, B15, DR4, and DR13. OMM2.3 cells are A11, A29, B7, and B52. MCF10 and MCF10A cells are A33, B55, B22, DR7, and DR4. HLA genotypes were determined by PCR typing and are referred to by their short-hand form (e.g., HLA-DR7 is DRB1*0701).

Statistical analyses. Means, SDs, and statistical significance as measured by Student's t test were calculated using Excel v2002.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
siRNA down-regulates Ii. The human breast cancer epithelial cell line MCF10 (27), which does not constitutively express MHC class II or Ii molecules, was transduced with a retrovirus encoding the human CIITA gene (Fig. 1A) and selected by magnetic bead sorting for MHC class II expression. CIITA-transduced MCF10 (MCF10/CIITA) cells are MHC class II (HLA-DR, DP, and DQ) and Ii positive as shown by immunofluorescence (Fig. 1B).


Figure 1
View larger version (32K):
[in this window]
[in a new window]
 
Figure 1. CIITA-transduced breast cancer cells express HLA-DR, HLA-DP, HLA-DQ, HLA-A, HLA-B, HLA-C, and invariant chain. A, CIITA retroviral vector. B, parental MCF10 and transduced MCF10/CIITA/CD80 cells were stained for HLA-DR (mAb L243), HLA-DQ (mAb CBL118P), HLA-DP (mAb CBL100F), HLA-A,B,C (mAb W6/32), or Ii (PIN1.1) and analyzed by flow cytometry. Unfilled peaks, specific antibody-stained cells; filled peaks, isotype control stained cells. C, forward (f) and reverse (r) oligonucleotides used to construct siRNA cassettes homologous to human Ii mRNA.

 
Retroviruses expressing siRNAs for Ii were constructed to down-regulate Ii in MCF10/CIITA cells. Four sequences in the human Ii gene, starting with AA and having low GC content, were selected (sequences 4, 38, 16, and 50). Double-stranded RNA molecules of these sequences were prepared and were transiently transfected into 293T cells that had previously been transduced with the CIITA retrovirus. Sequences 4 and 50 but not 38 or 16 down-regulated Ii by 4- to 50-fold (data not shown). To obtain stable transductants, sequence 4 was cloned into the pSIREN vector with two different termination signals giving vectors 4.1 and 4.2, with 4.2 containing additional sequence following the six thymidines. Sequence 50 was not used because it contained a four-thymidine repeat that is a stop of transcription for the U6 polymerase III promoter. Additional sequences starting with AA and having low GC content were selected adjacent to sequence 50 and were inserted into pSIREN (sequences 48, 53, and 54). An additional sequence 32 was also randomly selected and inserted into pSIREN. Sequences were inserted using the forward and reverse primers shown in Fig. 1C. Retroviruses containing these six siRNAs were prepared and used to transduce MCF10, MCF10/CIITA, and CD80-expressing cells (MCF10/siRNA, MCF10/CIITA/siRNA, MCF10/CIITA/CD80/siRNA cells). Transduced cells were analyzed by flow cytometry 3 days after transduction. Lines containing siRNAs 32, 53, and 48 showed a marked down-regulation of Ii but not complete loss, whereas cells containing siRNAs 4.1, 4.2, and 54 had minimal down-regulation of Ii (data not shown).

Western analyses for Ii (mAb PIN1.1) were done 3 days after transduction to confirm that Ii expression was down-regulated. The predominant form of Ii in MCF10/CIITA cells is p35, with a smaller amount of p33 (Fig. 2A). The p35 isoform, which is translated via an alternative translation initiation site, is normally the less abundant isoform of Ii (37). Others have noted an increase in p35 in tumors (38). The p35 and p33 isoforms are both down-regulated >95% in the siRNAs 53, 48, or 32 transductants, and there is a slight down-regulation in siRNA 4.1. siRNAs 4.2 and 54 do not affect Ii expression. Interestingly, at 3 days after transduction, all of the down-regulated cell lines contain a 23-kDa band that corresponds to an Ii degradation product. To ascertain if p23 persists, MCF10/CIITA/siRNA 32 and 53 were cultured in selective media for 3 weeks and subsequently tested by Western analysis. Neither full-length Ii nor the Ii degradation product is present 3 weeks after selection (Fig. 2B). Similar results were obtained with MCF10/CD80/CIITA/siRNA cells (data not shown).


Figure 2
View larger version (28K):
[in this window]
[in a new window]
 
Figure 2. Ii siRNAs silence Ii expression in CIITA-transduced cells without altering HLA-DR expression. MCF10 cells were transduced with retroviruses containing the CIITA and siRNAs for Ii. A and B, Western blots of MCF10, transduced MCF10, and control Sweig and Jurkat cells probed for Ii with the PIN1.1 mAb, 3 days after transduction (A) or 3 weeks after transduction (B). C, parental and transduced MCF10 cells stained for HLA-DR (mAb L243) or Ii (mAb PIN1.1). D, Western blots of parental and transduced MCF10 cells probed for HLA-DR (mAb L243) after 3 weeks of drug selection. Samples were either boiled (B) or not boiled (NB) before loading on the gel. 4.1, 4.2, 32, 48, 53, 54 identify independent Ii siRNAs.

 
To determine if siRNA-mediated down-regulation of Ii affected cell surface expression of MHC class II molecules, the transductants were analyzed by immunofluorescence 3 weeks after siRNA transduction. HLA-DR expression is the same in siRNA and non-siRNA transductants (Fig. 2C, top). Ii is absent in MCF10/CD80/CIITA/siRNA 53 and reduced >95% in lines 32 and 48 (bottom). Therefore, down-regulation of Ii by siRNA eliminates Ii expression without affecting MHC class II expression.

MCF10/CIITA/CD80 cells down-regulated for Ii contain stable MHC class II heterodimers. Formation of stable {alpha}ß heterodimers that dissociate upon boiling is a hallmark of correctly conformed MHC class II molecules (39). To determine if the siRNA transductants have properly conformed MHC II molecules, lysates of >3-week drug-selected cells were either boiled or not boiled before Western blotting with the L243 mAb, which is specific for MHC II {alpha}ß dimers. Nonboiled samples contain bands migrating at ~55 kDa that correspond to stable MHC class II {alpha}ß heterodimers (Fig. 2D). Therefore, tumor cells transduced with the CIITA and Ii siRNA express properly conformed MHC class II molecules in the absence of Ii.

MCF10/CIITA/CD80/siRNA cells present endogenous HER-2/neu peptides and activate CD4+ T cells. To assess if MHC class II is functional in the absence of Ii, MCF10/CD80/CIITA/siRNA 32 cells, which are down-regulated for Ii >99%, were used as APCs for the activation of PBMCs to tumor-encoded epitopes. HER-2/neu, a growth factor receptor that is overexpressed by many tumors, was used as the tumor antigen because (a) MCF10 cells constitutively overexpress HER-2/neu (Fig. 3A); (b) HER-2/neu contains two HLA-DR7-restricted peptides (p98 and p776; refs. 33, 34); and (c) MCF10/CD80/CIITA cells express DR7. To control for HLA-DR specificity, ocular melanoma OMM2.3 and breast cancer SUM159PT were transduced with CD80 and DR7 or DR4 retroviruses (Fig. 3B). OMM2.3 and SUM159PT cells express HER-2/neu and do not express Ii, and the respective transductants express CD80 and DR4 or DR7 (Fig. 3C).


Figure 3
View larger version (37K):
[in this window]
[in a new window]
 
Figure 3. MCF10, OMM2.3, and SUM159PT cells overexpress HER-2/neu and transduced HLA genes and do not express Ii. A, parental and transduced MCF10 and control NIH3T3 cells labeled with antibodies to HER-2/neu or CD80 and analyzed by flow cytometry. B, HLA-DR4 and HLA-DR7 retroviral constructs. C, parental and transduced OMM2.3 and SUM159 cells stained with antibodies to HLA-DR (mAb L243), Ii (mAb PIN1.1), HER-2/neu, CD80, or HLA-A,B,C and analyzed by flow cytometry. Unfilled peaks, specific antibody-stained cells; filled peaks, isotype control stained cells.

 
To determine if the CIITA/siRNA cells present endogenously synthesized tumor peptides, HER-2/neu peptide p98 and/or p776-activated T cells were cocultured with transduced tumor cells, and IFN-{gamma} production was measured. Soluble peptide p98 or p776 was added to some wells to determine if the transductants preferentially present peptides from exogenous sources. MCF10/CIITA/CD80/siRNA 32 and MCF10/CIITA/CD80 present peptides p98 and p776 from endogenously synthesized HER-2/neu (Fig. 4A and B). Peptide p776 is presented equally well by MCF10/CIITA/CD80/siRNA 32 and MCF10/CIITA/CD80, whereas MCF10/CIITA/CD80 cells are slightly better presenters of p98 (P < 0.05). Both MCF10 cell lines present exogenously pulsed HER-2/neu peptides. Exogenous peptide presentation is not significantly better than presentation of endogenous peptide and is not affected by Ii expression. HER-2/neu presentation is DR7 restricted because cells lacking DR7 (MCF10/CD80, OMM2.3/DR4/CD80, and SUM159/CD80) do not induce significant IFN-{gamma} release. T-cell activation is limited to MHC-restricted antigen, and there is no activation to allogeneic MHC antigens because neither MCF10/CD80 nor SUM159/CD80 cells induce significant IFN-{gamma} release. Therefore, down-regulation of Ii by siRNA slightly diminishes presentation of peptide p98 but does not significantly affect presentation of p776, suggesting that presentation of some epitopes may be Ii dependent, whereas presentation of others is independent of Ii. In either case, removal of Ii does not render MHC class II molecules unable to present antigen, indicating that MHC class II antigens are functional in the absence of Ii.


Figure 4
View larger version (25K):
[in this window]
[in a new window]
 
Figure 4. CIITA- and CD80-transduced MCF10 cells down-regulated for Ii by RNAi present endogenously synthesized HER-2/neu epitopes and activate CD4+ T cells. HLA-DR7-restricted peptide 98–specific T cells (A) or peptide 776–specific T cells (B) were cocultured with MCF10, OMM2.3, or SUM159PT parental cells or transductants, and T-cell activation was quantified by measuring IFN-{gamma} release. Exogenous peptide was added to some wells. C, p98- and p776-primed T cells were cocultured with transduced MCF10 or SUM159PT cells in the presence of antibodies to HLA-DR (mAb L243) or HLA-A,B,C (mAb W6/32). HLA-DR7-restricted, p776-primed PBMCs were depleted for CD4+ or CD8+ T cells before incubation with MCF10 (D) or SUM159PT (E) transductants as in (A) and (B).

 
To rule out that PBMCs were responding to secreted HER-2/neu that is subsequently endocytosed, PBMCs were mixed with supernatants from MCF10/CIITA/CD80/siRNA 32 cells. PBMC were pulsed with p98 as a positive control. Peptide-pulsed PBMC produced IFN-{gamma}; however, supernatant-pulsed cells did not (data not shown). Therefore, MCF10/CIITA/CD80/siRNA 32 cells are presenting endogenously synthesized molecules.

Peptides p98 and p776 also activate CD8+ T cells, suggesting that they may contain nested MHC class I epitopes (33, 34). The HER-2/neu-activated T cells share DR7 with the transduced MCF10 cells, and DR7 and A24 with SUM159PT/DR7/CD80 cells. No MHC class I alleles are common between p98- and p776-activated PBMCs and transduced MCF10 cells. Because peptides p98 and p776 are presented by both DR4 and DR7, there is the potential for the activation of both CD4+ and CD8+ T cells by SUM159PT/DR7/CD80 but not by MCF10/CIITA/CD80/siRNA 32 cells. To identify which T cells are activated, PBMCs were primed with p98 and p776 and subsequently incubated with vaccine cells in the presence of antibodies to MHC class I and/or MHC class II. Antibodies to MHC class II block antigen presentation by MCF10/CIITA/CD80/siRNA 32 and MCF/CIITA/CD80, whereas antibodies to both MHC I and II block antigen presentation by SUM159/DR7/CD80 cells (Fig. 4C). To confirm the activation of CD4+ and CD8+ T cells, PBMCs were primed with p776 and depleted for CD4+ or CD8+ T cells, before activation by MCF10 or SUM159PT transductants. Depletion of CD4+ T cells completely eliminates T-cell activation by both MCF10/CIITA/CD80/32 and SUM/DR7/CD80 cells. Depletion of CD8+ T cells significantly reduces T-cell activation by SUM159PT transductants and has a smaller effect on MCF10/CIITA/CD80/32-induced T-cell activation (Fig. 4D and E). This latter effect is probably nonspecific because MCF10/CIITA/CD80/32 cells do not share MHC class I alleles with PBMCs. Similar results were obtained with p98-primed PBMCs (data not shown).

MCF10/CIITA/32 cells were also included in this experiment (Fig. 4D) to determine if coexpression of CD80 enhances boosting of HER-2/neu-specific CD4+ T cells. In agreement with earlier findings (20), CD80-expressing transductants are better stimulators. Therefore, the transductants activate both CD4+ and CD8+ T cells if they share common alleles with the responding PBMCs, and coexpression of CD80 enhances activation.

Nonmalignant cells do not activate T cells. A potential problem with cell-based vaccines is that they will activate T cells against nonmalignant cells due to cross-reactivity with normal self-antigens. To determine if the MHC II vaccines induce reactivity against nonmalignant cells, PBMCs were activated with HER-2/neu p776 peptide and tested on MCF10 cells and their nonmalignant counterpart, MCF10A cells. As measured by flow cytometry, MCF10A cells express HER-2/neu, although at slightly lower levels than MCF10 cells (Fig. 5A compare with Fig. 3A). Unlike MCF10 cells, MCF10A cells do not express MHC II molecules; however, they are inducible for MHC II if incubated for 48 hours with 1,000 units/mL of rIFN{gamma}. As seen in Fig. 5B, neither untreated nor IFN{gamma}-treated MCF10A cells activate T cells. Therefore, tumor-specific T cells are activated by MHC II+CD80+ tumor cell–based vaccines and not by nonmalignant cells of the same tissue origin.


Figure 5
View larger version (19K):
[in this window]
[in a new window]
 
Figure 5. Nonmalignant breast cells do not activate T cells. A, untreated MCF10A cells were stained for CD80 or HER-2/neu, and IFN-{gamma}-treated (1,000 units for 48 hours) MCF10A cells were stained for HLA-DR or HLA-A,B,C and analyzed by flow cytometry. Unfilled peaks, specific antibody-stained cells; filled peaks, isotype control stained cells. B, PBMCs were pulsed with p776 or p98 and incubated with MCF10, MCF10A, or IFN{gamma}-treated MCF10A cells, and the supernatants were analyzed for IFN-{gamma} as per Fig. 4.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A goal of tumor immunotherapy is to activate T lymphocytes to tumor-encoded antigens. Although some tumor peptides have been identified, many are unknown, and it is unclear how diverse an immune response is needed to eradicate tumor cells in vivo. The vaccines (transductants) described here circumvent the identification of tumor antigens and potentially present a diversity of immunogenic peptides. The vaccines were designed to preferentially present endogenously synthesized MHC II–restricted epitopes (1). In previous studies, we made vaccines by transducing MHC class II alleles into Ii-negative tumor cells (20, 23, 24, 40, 41). We now show that immunogenic cells can also be made by transducing tumor cells with the CIITA with or without Ii.

Our vaccine design was based on the hypothesis that coexpression of Ii would inhibit the presentation of endogenously synthesized tumor peptides, a hypothesis supported by our own earlier work and extensive work of others in nontumor systems (8, 9). Recent mass spectroscopy studies (42) provide direct biochemical support for this hypothesis and also provide an explanation for the lack of inhibition of Ii for HER-2/neu peptides p98 and p776. These investigators showed that the MHC II molecules of MHC II+Ii cells contain peptides presented by MHC II+Ii+ cells plus additional novel peptides, which are not presented by MHC II+Ii+ cells (42). Because p98 and p776 were originally identified as epitopes presented by MHC II+Ii+ professional APCs (33, 34), they are most likely in the category of epitopes that are presented by both Ii+ and Ii APCs. However, the findings of ref. (42) make it likely that the MHC II+Ii transductants also present novel tumor antigen epitopes that are not presented by professional APCs. In this fashion, Ii RNAi vaccines may activate a more diverse repertoire of tumor-specific CD4+ T cells than professional APCs and may activate T cells that have not previously been tolerized by the tumor.

Clinical studies also support an inhibitory role for Ii. Chamuleau et al. have shown that acute myelogenous leukemia (AML) patients in complete remission whose HLA-DR+ myeloid leukemic blasts have low levels of the MHC class II–associated Ii peptide (CLIP), a degradation product of Ii, have a significantly better clinical prognosis than patients whose blasts are DR+CLIP+ (43). Similar to AML blasts of progressor patients, DM-deficient mice also have DR+CLIP+ APCs, which are inefficient presenters of endogenously synthesized molecules (44). Preferential expression of the Ii p35 isoform is also associated with increased malignancy in chronic lymphocytic leukemia, and this effect has been attributed to reduced presentation of endogenously synthesized tumor antigens (38). Expression of CLIP is also associated with polarization towards a type 2 CD4 (Th2) response (45, 46), which may favor tumor progression (47).

Although early studies suggested that Ii expression was essential for MHC class II function (14, 15, 17), there are now many reports showing that MHC II alleles are properly conformed and functional in the absence of Ii (19, 20, 25, 48, 49). The present report extends this conclusion and shows that peptide affinity for MHC II is not affected by Ii, because peptide binding to surface MHC II molecules is similar for Ii+ and Ii cells. Therefore, although Ii may be required during development for expression of some mouse MHC II alleles, most MHC II alleles are stable and functional in the absence of Ii.

We envision that the vaccine strategy described here will be used to generate MHC II allele–specific vaccines from established cell lines. We propose a "cocktail" approach in which a patient will be treated with a mixture of multiple cell lines expressing MHC class I and II molecules matched to their genotype. Following HLA typing, a patient's "semicustomized cocktail" would be prepared from stocks of frozen transduced cells. This approach depends on the existence of shared tumor antigens and eliminates the need for autologous tumor cells, making it feasible to treat most patients. Although retroviruses could be used to induce MHC II and CD80 molecules, alternative techniques that are less controversial would be preferable.

This vaccine strategy has the potential to activate T cells to self-antigens that are also expressed on nonmalignant cells. Autoimmunity has not been observed in the three mouse tumor systems studied in vivo,4 and the absence of reactivity with the nonmalignant breast line MCF10A suggests that autoimmunity against normal cells will also not be a problem in patients. In addition, a DR4+DR7+ patient with advanced metastatic ocular melanoma has been treated with irradiated OMM2.3/CD80/DR4 and OMM2.3/CD80/DR7 vaccines, and no autoimmune or other complications were noted.5

Vaccines consisting of tumor cells transduced with the CIITA and Ii siRNAs have several potential advantages over previous vaccines in which MHC II nonexpressing tumor cells were transduced with individual MHC II alleles. Vaccines made by transducing single HLA-DR alleles are limited to presenting tumor antigen epitopes restricted by the transduced allele(s). In contrast, CIITA-transduced vaccine cells express multiple HLA-DR alleles, as well as DP and DQ alleles, and hence have the potential to present a much broader repertoire of tumor antigen epitopes. The CIITA/siRNA vaccines also differ from the previous MHC II vaccines in that expression of the CIITA up-regulates accessory molecules, such as HLA-DM. Although our previous studies have not shown that HLA-DM expression facilitates vaccine efficacy (50), studies by others have shown that HLA-DM expression stabilizes MHC II in the absence of Ii, aids MHC II traffic, and helps edit the MHC II peptide repertoire (42).

The CIITA/Ii siRNA strategy also expands the choice of tumor cells which could be used to generate vaccines to include tumors that constitutively express MHC II or are inducible for MHC II by treatment with IFN{gamma}. Tumor cells that constitutively coexpress MHC II and costimulatory molecules, such as some leukemias (43), are particularly attractive targets for Ii siRNA therapy because creating a vaccine would only require down-regulating Ii via RNA interference (RNAi). This approach is supported by studies in which Ii was down-regulated in MHC II–positive, Ii-positive mouse tumor cells by antisense RNA (5155). Mice immunized with the Ii antisense down-regulated tumor cells were protected against later challenge with wild-type tumor. Because siRNA is more effective in down-regulating Ii than antisense RNA, Ii siRNA vaccines may have more therapeutic efficacy than Ii antisense vaccines. Therefore, tumor cells expressing the CIITA and costimulatory molecules may be useful reagents, and concomitant down-regulation of Ii via RNAi may further improve vaccine efficacy and protect and/or treat tumor recurrence and/or metastatic disease.


    Acknowledgments
 
Grant support: NIH grants R01CA84232 and R01CA52527 (S. Ostrand-Rosenberg), K01 CA100764 (K.L. Knutson), R01CA85374 (M.L. Disis), and M01-RR-00037 (Clinical Research Center Facility, University of Washington) and Department of Defense Breast Cancer Program predoctoral fellowship grant DAMD17-03-1-0337 (J.A. Thompson).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Dr. Santa Ono (Department of Immunology, University College London, University of London, United Kingdom) for the CIITA gene, Dr. Dean Mann (Department of Pathology, University of Maryland Medical System, Baltimore, MD) for the PBMC, Virginia Clements for making the OMM2.3 transductants, Matthew Barthalow for making the pLNCX2/CIITA construct, Agnes Cheung and Nicole Dean for making the DR4 construct, Dr. Robert Pauley (Karmanos Cancer Institute, Wayne State University School of Medicine, Detroit, MI) for the MCF10 cells, and Dr. Amy Fulton (Department of Pathology, University of Maryland, Baltimore, MD) for the MCF10A cells.


    Footnotes
 
4 Ostrand-Rosenberg and Clements, unpublished. Back

5 S. Slavin, personal communication. Back

Received 6/29/05. Revised 10/17/05. Accepted 11/ 1/05.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Ostrand-Rosenberg S, Pulaski B, Clements V, et al. Cell-based vaccines for the stimulation of immunity to metastatic cancers. Immunol Rev 1999;170:101–14.[CrossRef][Medline]
  2. Finn OJ. Cancer vaccines: between the idea and the reality. Nat Rev Immunol 2003;3:630–41.[CrossRef][Medline]
  3. Kern DE, Klarnet JP, Jensen MC, Greenberg PD. Requirement for recognition of class II molecules and processed tumor antigen for optimal generation of syngeneic tumor-specific class I-restricted CTL. J Immunol 1986;136:4303–10.[Abstract]
  4. Wang JC, Livingstone AM. Cutting edge: CD4+ T cell help can be essential for primary CD8+ T cell responses in vivo. J Immunol 2003;171:6339–43.[Abstract/Free Full Text]
  5. Gao FG, Khammanivong V, Liu WJ, et al. Antigen-specific CD4+ T-cell help is required to activate a memory CD8+ T cell to a fully functional tumor killer cell. Cancer Res 2002;62:6438–41.[Abstract/Free Full Text]
  6. Janssen EM, Lemmens EE, Wolfe T, et al. CD4+ T cells are required for secondary expansion and memory in CD8+ T lymphocytes. Nature 2003;421:852–6.[CrossRef][Medline]
  7. Shedlock DJ, Shen H. Requirement for CD4 T cell help in generating functional CD8 T cell memory. Science 2003;300:337–9.[Abstract/Free Full Text]
  8. Lechler R, Aichinger G, Lightstone L. The endogenous pathway of MHC class II antigen presentation. Immunol Rev 1996;151:51–79.[CrossRef][Medline]
  9. Stumptner-Cuvelette P, Benaroch P. Multiple roles of the invariant chain in MHC class II function. Biochim Biophys Acta 2002;1542:1–13.[Medline]
  10. Rahmsdorf HJ, Harth N, Eades AM, et al. Interferon-{gamma}, mitomycin C, cycloheximide as regulatory agents of MHC class II-associated invariant chain expression. J Immunol 1986;136:2293–9.[Abstract]
  11. Koch N, Wong GH, Schrader JW. Ia antigens and associated invariant chain are induced simultaneously in lines of T-dependent mast cells by recombinant interferon-{gamma}. J Immunol 1984;132:1361–9.[Abstract]
  12. Collins T, Korman AJ, Wake CT, et al. Immune interferon activates multiple class II major histocompatibility complex genes and the associated invariant chain gene in human endothelial cells and dermal fibroblasts. Proc Natl Acad Sci U S A 1984;81:4917–21.[Abstract/Free Full Text]
  13. Steimle V, Siegrist CA, Mottet A, Lisowska-Grospierre B, Mach B. Regulation of MHC class II expression by interferon-{gamma} mediated by the transactivator gene CIITA. Science 1994;265:106–9.[Abstract/Free Full Text]
  14. Viville S, Neefjes J, Lotteau V, et al. Mice lacking the MHC class II-associated invariant chain. Cell 1993;72:635–48.[CrossRef][Medline]
  15. Bikoff EK, Huang LY, Episkopou V, et al. Defective major histocompatibility complex class II assembly, transport, peptide acquisition, and CD4+ T cell selection in mice lacking invariant chain expression. J Exp Med 1993;177:1699–712.[Abstract/Free Full Text]
  16. Bikoff EK, Germain RN, Robertson EJ. Allelic differences affecting invariant chain dependency of MHC class II subunit assembly. Immunity 1995;2:301–10.[CrossRef][Medline]
  17. Elliott EA, Drake JR, Amigorena S, et al. The invariant chain is required for intracellular transport and function of major histocompatibility complex class II molecules. J Exp Med 1994;179:681–94.[Abstract/Free Full Text]
  18. Kenty G, Bikoff EK. BALB/c invariant chain mutant mice display relatively efficient maturation of CD4+ T cells in the periphery and secondary proliferative responses elicited upon peptide challenge. J Immunol 1999;163:232–41.[Abstract/Free Full Text]
  19. Sekaly RP, Tonnelle C, Strubin M, Mach B, Long EO. Cell surface expression of class II histocompatibility antigens occurs in the absence of the invariant chain. J Exp Med 1986;164:1490–504.[Abstract/Free Full Text]
  20. Dissanayake SK, Thompson JA, Bosch JJ, et al. Activation of tumor-specific CD4(+) T lymphocytes by major histocompatibility complex class II tumor cell vaccines: a novel cell-based immunotherapy. Cancer Res 2004;64:1867–74.[Abstract/Free Full Text]
  21. Topilski I, Harmelin A, Flavell RA, Levo Y, Shachar I. Preferential Th1 immune response in invariant chain-deficient mice. J Immunol 2002;168:1610–7.[Abstract/Free Full Text]
  22. Miller J, Germain RN. Efficient cell surface expression of class II MHC molecules in the absence of associated invariant chain. J Exp Med 1986;164:1478–89.[Abstract/Free Full Text]
  23. Baskar S, Glimcher L, Nabavi N, Jones RT, Ostrand-Rosenberg S. Major histocompatibility complex class II+B7-1+ tumor cells are potent vaccines for stimulating tumor rejection in tumor-bearing mice. J Exp Med 1995;181:619–29.[Abstract/Free Full Text]
  24. Pulaski B, Ostrand-Rosenberg S. MHC class II and B7.1 immunotherapeutic cell-based vaccine reduces spontaneous mammary carcinoma metastases without affecting primary tumor growth. Cancer Res 1998;58:1486–93.[Abstract/Free Full Text]
  25. Armstrong T, Clements V, Martin B, Ting JP-Y, Ostrand-Rosenberg S. Major histocompatibility complex class II-transfected tumor cells present endogenous antigen and are potent inducers of tumor-specific immunity. Proc Natl Acad Sci U S A 1997;120:123–8.
  26. Armstrong T, Clements V, Ostrand-Rosenberg S. MHC class II-transfected tumor cells directly present antigen to tumor-specific CD4+ T lymphocytes. J Immunol 1998;160:661–6.[Abstract/Free Full Text]
  27. Pauley RJ, Soule HD, Tait L, et al. The MCF10 family of spontaneously immortalized human breast epithelial cell lines: models of neoplastic progression. Eur J Cancer Prev 1993;2 Suppl 3:67–76.
  28. Verbik DJ, Murray TG, Tran JM, Ksander BR. Melanomas that develop within the eye inhibit lymphocyte proliferation. Int J Cancer 1997;73:470–8.[CrossRef][Medline]
  29. Yu JY, DeRuiter SL, Turner DL. RNA interference by expression of short-interfering RNAs and hairpin RNAs in mammalian cells. Proc Natl Acad Sci U S A 2002;99:6047–52.[Abstract/Free Full Text]
  30. Tai AK, Zhou G, Chau K, Ono SJ. Cis-element dependence and occupancy of the human invariant chain promoter in CIITA-dependent and -independent transcription. Mol Immunol 1999;36:447–60.[CrossRef][Medline]
  31. Long EO, Rosen-Bronson S, Karp DR, et al. Efficient cDNA expression vectors for stable and transient expression of HLA-DR in transfected fibroblast and lymphoid cells. Hum Immunol 1991;31:229–35.[CrossRef][Medline]
  32. Horton RM, Cai ZL, Ho SN, Pease LR. Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction. Biotechniques 1990;8:528–35.[Medline]
  33. Sotiriadou R, Perez SA, Gritzapis AD, et al. Peptide HER2(776-788) represents a naturally processed broad MHC class II-restricted T cell epitope. Br J Cancer 2001;85:1527–34.[CrossRef][Medline]
  34. Salazar LG, Fikes J, Southwood S, et al. Immunization of cancer patients with HER-2/neu-derived peptides demonstrating high-affinity binding to multiple class II alleles. Clin Cancer Res 2003;9:5559–65.[Abstract/Free Full Text]
  35. Disis ML, Gooley TA, Rinn K, et al. Generation of T-cell immunity to the HER-2/neu protein after active immunization with HER-2/neu peptide-based vaccines. J Clin Oncol 2002;20:2624–32.[Abstract/Free Full Text]
  36. Knutson KL, Schiffman K, Disis ML. Immunization with a HER-2/neu helper peptide vaccine generates HER-2/neu CD8 T-cell immunity in cancer patients. J Clin Invest 2001;107:477–84.[CrossRef][Medline]
  37. Strubin M, Long EO, Mach B. Two forms of the Ia antigen-associated invariant chain result from alternative initiations at two in-phase AUGs. Cell 1986;47:619–25.[CrossRef][Medline]
  38. Veenstra H, Jacobs P, Dowdle EB. Abnormal association between invariant chain and HLA class II {alpha} and ß chains in chronic lymphocytic leukemia. Cell Immunol 1996;171:68–73.[CrossRef][Medline]
  39. Sadegh-Nasseri S, Germain RN. A role for peptide in determining MHC class II structure. Nature 1991;353:167–70.[CrossRef][Medline]
  40. Pulaski B, Clements V, Pipeling M, Ostrand-Rosenberg S. Immunotherapy with vaccines combining MHC class II/CD80+ tumor cells with IL-12 reduces established metastatic disease and stimulates immune effectors and monokine-induced by interferon-{gamma}. Cancer Immunol Immunother 2000;49:34–45.[CrossRef][Medline]
  41. Pulaski B, Terman D, Khan S, Muller E, Ostrand-Rosenberg S. Cooperativity of SEB superantigen, MHC class II, CD80 in immunotherapy of advanced metastases in a clinically relevant post-operative breast cancer model. Cancer Res 2000;60:2710–5.[Abstract/Free Full Text]
  42. Muntasell A, Carrascal M, Alvarez I, et al. Dissection of the HLA-DR4 peptide repertoire in endocrine epithelial cells: strong influence of invariant chain and HLA-DM expression on the nature of ligands. J Immunol 2004;173:1085–93.[Abstract/Free Full Text]
  43. Chamuleau ME, Souwer Y, Van Ham SM, et al. Class II-associated invariant chain peptide expression on myeloid leukemic blasts predicts poor clinical outcome. Cancer Res 2004;64:5546–50.[Abstract/Free Full Text]
  44. Martin WD, Hicks GG, Mendiratta SK, et al. H2-M mutant mice are defective in the peptide loading of class II molecules, antigen presentation, and T cell repertoire selection. Cell 1996;84:543–50.[CrossRef][Medline]
  45. Rohn TA, Boes M, Wolters D, et al. Upregulation of the CLIP self peptide on mature dendritic cells antagonizes T helper type 1 polarization. Nat Immunol 2004;5:909–18.[CrossRef][Medline]
  46. Chaturvedi P, Hengeveld R, Zechel MA, Lee-Chan E, Singh B. The functional role of class II-associated invariant chain peptide (CLIP) in its ability to variably modulate immune responses. Int Immunol 2000;12:757–65.[Abstract/Free Full Text]
  47. Shurin MR, Lu L, Kalinski P, Stewart-Akers AM, Lotze MT. Th1/Th2 balance in cancer, transplantation and pregnancy. Springer Semin Immunopathol 1999;21:339–59.[Medline]
  48. Long EO, LaVaute T, Pinet V, Jaraquemada D. Invariant chain prevents the HLA-DR-restricted presentation of a cytosolic peptide. J Immunol 1994;153:1487–94.[Abstract]
  49. Qi L, Rojas J, Ostrand-Rosenberg S. Tumor cells present MHC class II-restricted nuclear and mitochondrial antigens and are the predominant antigen presenting cells in vivo. J Immunol 2000;165:5451–61.[Abstract/Free Full Text]
  50. Qi L, Ostrand-Rosenberg S. MHC class II presentation of endogenous tumor antigen by cellular vaccines depends on the endocytic pathway but not H2-M. Traffic 2000;1:152–60.[CrossRef][Medline]
  51. Wang Y, Xu M, Che M, et al. Curative antitumor immune response is optimal with tumor irradiation followed by genetic induction of major histocompatibility complex class I, class II molecules and suppression of Ii protein. Hum Gene Ther 2005;16:187–99.[CrossRef][Medline]
  52. Lu X, Kallinteris NL, Li J, et al. Tumor immunotherapy by converting tumor cells to MHC class II-positive, Ii protein-negative phenotype. Cancer Immunol Immunother 2003;52:592–8.[CrossRef][Medline]
  53. Hillman GG, Kallinteris NL, Li J, et al. Generating MHC Class II+/Ii phenotype after adenoviral delivery of both an expressible gene for MHC class II inducer and an antisense Ii-RNA construct in tumor cells. Gene Ther 2003;10:1512–8.[CrossRef][Medline]
  54. Xu M, Lu X, Kallinteris NL, et al. Immunotherapy of cancer by antisense inhibition of Ii protein, an immunoregulator of antigen selection by MHC class II molecules. Curr Opin Mol Ther 2004;6:160–5.[Medline]
  55. Qiu G, Goodchild J, Humphreys RE, Xu M. Cancer immunotherapy by antisense suppression of Ii protein in MHC-class-II-positive tumor cells. Cancer Immunol Immunother 1999;48:499–506.[CrossRef][Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
D. Kim, T. Hoory, A. Monie, J. P.-Y. Ting, C.-F. Hung, and T.-C. Wu
Enhancement of DNA Vaccine Potency through Coadministration of CIITA DNA with DNA Vaccines via Gene Gun
J. Immunol., May 15, 2008; 180(10): 7019 - 7027.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
E. C. de Bruin, C. J.H. van de Velde, J. H. J.M. van Krieken, C. A.M. Marijnen, and J. P. Medema
Epithelial Human Leukocyte Antigen-DR Expression Predicts Reduced Recurrence Rates and Prolonged Survival in Rectal Cancer Patients
Clin. Cancer Res., February 15, 2008; 14(4): 1073 - 1079.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. J. Bosch, J. A. Thompson, M. K. Srivastava, U. K. Iheagwara, T. G. Murray, M. Lotem, B. R. Ksander, and S. Ostrand-Rosenberg
MHC Class II-Transduced Tumor Cells Originating in the Immune-Privileged Eye Prime and Boost CD4+ T Lymphocytes that Cross-react with Primary and Metastatic Uveal Melanoma Cells
Cancer Res., May 1, 2007; 67(9): 4499 - 4506.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
S. A. Oldford, J. D. Robb, D. Codner, V. Gadag, P. H. Watson, and S. Drover
Tumor cell expression of HLA-DM associates with a Th1 profile and predicts improved survival in breast carcinoma patients
Int. Immunol., November 1, 2006; 18(11): 1591 - 1602.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thompson, J. A.
Right arrow Articles by Ostrand-Rosenberg, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thompson, J. A.
Right arrow Articles by Ostrand-Rosenberg, S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online