Cancer Research Cancer Epigenetics Jordan
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chapatte, L.
Right arrow Articles by Lévy, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chapatte, L.
Right arrow Articles by Lévy, F.
[Cancer Research 66, 1155-1160, January 15, 2006]
© 2006 American Association for Cancer Research

Immunology

Efficient Induction of Tumor Antigen–Specific CD8+ Memory T Cells by Recombinant Lentivectors

Laurence Chapatte, Sara Colombetti, Jean-Charles Cerottini and Frédéric Lévy

Ludwig Institute for Cancer Research, Lausanne Branch, University of Lausanne, Epalinges, Switzerland

Requests for reprints: Frédéric Lévy, Ludwig Institute for Cancer Research, Lausanne Branch, University of Lausanne, Chemin des Boveresses 155, 1066 Epalinges, Switzerland. Phone: 41-21-692-5998; Fax: 41-21-692-5995; E-mail: Frederic.Levy{at}isrec.unil.ch.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The success of active cancer immunotherapy entails a robust induction of tumor-reactive effector and memory CD8+ T cells. We compared the in vivo immunogenicity of the melanoma-associated antigen Melan-A26-35 encoded by third-generation recombinant lentivector (rec. lv) or as peptide admixed with a strong adjuvant. Ex vivo analyses of immunized HLA-A2/H-2Kb mice showed that rec. lv triggered a stronger anti-Melan-A CD8+ T-cell response than peptide vaccine. Importantly, the majority of anti-Melan-A T cells elicited by rec. lv expressed the memory marker CD127 at the peak of the primary response. In those mice, memory T cells were detectable several months after priming and could be activated by recall peptide vaccination. These results show that immunization with rec. lv induces not only a strong antigen-specific CD8+ T-cell response but also a long-lasting T-cell memory against a bona fide tumor-associated antigen. (Cancer Res 2006; 66(2): 1155-60)


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
A critical goal in the development of potent vaccines against tumors and infectious agents is the ability to induce strong and long-lasting specific CTL responses. Among the many antimelanoma vaccines currently under investigation, peptide and viral vaccines hold the highest promise because of their relative ease of production and their application to a large number of patients. Recombinant viruses offer additional advantages in that they are highly immunogenic, relatively stable, and suitable for the sustained expression of one or more determinants of interest. However, the immunodominance of certain viral epitopes may mask the response against the relevant antigenic peptide. On the basis of these considerations, genetic modifications and adaptations of recombinant retroviruses have shown promising results in targeting relevant human diseases (1–5). In the context of immunologic responses, several reports have described the successful transduction of dendritic cells and the high efficiency of transduced cells to induce specific T-cell responses (6–12). Our previous work also showed that direct administration of recombinant lentivectors (rec. lv) to mice resulted in potent T-cell responses (13).

Melan-A/MART-1 (hereafter called Melan-A), a protein expressed in melanocytes and melanomas, contains an antigenic peptide recognized by a high frequency of CD8+ T cells from HLA-A2+ melanoma patients (14). This peptide, with sequence EAAGIGILTV, encompasses amino acids 26 to 35 of the protein. Mutation of Ala27 to Leu increased the affinity of the resulting peptide analogue to HLA-A2 and simultaneously augmented its immunogenicity in vitro and in vivo (15). Importantly, CTL reactive against this mutated peptide were cross-reactive to the wild-type peptide and recognized Melan-A+ tumor cells (15, 16). For the sake of simplicity, the terminology Melan-A26-35 will be used throughout this work to describe the mutated Melan-A peptide.

Although Melan-A26-35 peptide vaccination has been shown to induce high frequencies of specific T cells in melanoma patients (17), it is not known if this primary T-cell response will develop into a long-lasting memory response and if this will translate into a better antitumor response. In the current study, we directly compared in HLA-A2/H-2Kb transgenic mice the anti-Melan-A CD8+ T-cell response elicited by direct administration of rec. lv containing the Melan-A26-35 sequence with that induced by a potent Melan-A26-35 peptide-adjuvant vaccine. We observed that the magnitude of the anti-Melan-A T-cell response was superior after a single immunization with rec. lv than after peptide vaccination. At the peak of the primary response elicited by rec. lv, a high proportion of specific T cells expressed the IL-7 receptor {alpha} chain (CD127), suggesting that rec. lv induced primarily precursors of memory T cells (18, 19). In those mice, antigen-specific memory T cells were detected several months after priming and this correlated with the efficiency of the T-cell response observed after antigen recall. We conclude that rec. lv immunization favors the development of quantitatively and qualitatively superior CD8+ T-cell responses against tumor-associated antigens.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Mice. All immunizations were done using HLA-A*0201/H-2Kb transgenic mice (20). Animal experiments were carried out in pathogen-free facilities and in compliance with the rules of the local veterinary office.

Construction of recombinant lentivector. All Melan-A sequences contained the Ala to Leu substitution at position 27 to increase the affinity of the peptide to HLA-A2. The Melan-A26-35 sequence was expressed from a UPR-based construct (21, 22). This expression system, which exploits the natural process by which free ubiquitin is produced in all eukaryotic cells, has been previously described (23). In brief, Melan-A26-35 is expressed as a linear fusion with enhanced green fluorescent protein (EGFP)-ubiquitin. Shortly after translation, Melan-A26-35 is released from EGFP-ubiquitin by the action of intracellular ubiquitin proteases. The main advantage of this system is that Melan-A26-35 is directly released in its final form in the cytoplasm. Rec. lv were generated by inserting the DNA sequence coding for EGFP-ubiquitin-Melan-A26-35 between the BamHI and XbaI sites of the lentiviral transfer vector pRRLsin18.PPT.CMV. The latter vector as well as the production of recombinant lentiviruses have been described (5, 10, 13). Details are available on request.

Synthetic peptides and CpG oligodeoxynucleotides. Peptide ELAGIGILTV was synthesized by solid-phase chemistry and was over 90% pure (by analytic high-performance liquid chromatography). Lyophilized peptides were diluted in DMSO and stored at –20°C. Synthetic CpG-containing oligodeoxynucleotides (TCCATGACGTTCCTGACGTT) optimized for mouse vaccination (oligodeoxynucleotide 1826, Coley Pharmaceutical Group, Inc., Wellesley, MA) were dissolved in sterile PBS.

Vaccination. Peptide vaccination was carried out by s.c. injection at the base of the tail of 50 µg peptide admixed with 50 µg CpG oligodeoxynucleotide emulsified in 50 µL incomplete Freund's adjuvant (Sigma) and 50 µL of PBS. Recombinant lentivectors were administered by s.c. injections of 4 x 106 expression-forming units in 100 µL PBS into the base of the tail.

Flow cytometry. Flow cytometry was done on FACSCalibur using Cellquest software (Becton Dickinson, San Jose, CA). Peripheral blood mononuclear cells (PBMC) obtained by tail bleedings were incubated with phycoerythrin-conjugated Melan-A26-35/A2Kb tetramers (prepared in our laboratory; ref. 15) for 40 minutes at 20°C, washed, and incubated with cychrome-conjugated anti-CD8 monoclonal antibody (53-6.7; eBioscience, San Diego, CA) and, where indicated, FITC-conjugated anti-CD62L antibodies (Mel-14, prepared in our laboratory) for 20 minutes at 4°C. The detection limit for staining of CD8+ T cells with Melan-A26-35/A2Kb tetramers was 0.5%, as assessed by analysis of CD8+ T cells from naïve mice. Other antibodies used were phycoerythrin cychrome 5.5–conjugated anti-CD8{alpha} (5H10, Caltag Laboratories, Burlingame, CA), Alexa 647–conjugated anti-CD127 (47R34, prepared in our laboratory), anti-CD4 (GK1.5, produced at our institute), anti-CD44 (Pgp1, produced at our institute), and anti-Ly-6C (HK1.4, Southern Biotech, Birmingham, AL). Erythrocytes were lysed using the FACS Lysing solution (Becton Dickinson, San Jose, CA).

In vivo CTL assays. In vivo CTL assays were done as previously described (13). Briefly, splenocytes from syngeneic mice were either pulsed with the peptide Melan-A26-35 for 1 hour at 37°C or left untreated. The pulsed cells (107/mL) were then labeled with carboxyfluorescein diacetate succinamidyl ester (CFSE) at a concentration of 0.6 µmol/L whereas the untreated cells were labeled with CFSE at a concentration of 0.04 µmol/L CFSE. The two cell populations were mixed at a ratio of 1:1. A total of 107 cells per mouse were injected into the tail vein on day 14 after lentiviral immunization or on day 9 after peptide vaccination. Eighteen hours later, mice were bled and PBMC, spleens, and liver were independently collected. The disappearance of peptide-pulsed cells was determined by flow cytometry. By comparing the ratio of the pulsed (high fluorescence intensity) to the nonpulsed fraction (low fluorescence intensity), the percentage of specific killing was established according to the following equation: 100 – [(percentage pulsed) x (percentage nonpulsed)–1 x 100].

In vitro CTL assays. Cytotoxic activity was measured using standard 4-hour chromium release assays as previously reported (15). EL-4A2/Kb transfectants were used as target cells. Briefly, mice were bled at the peak of the response (day 14 for rec. lv immunization and day 9 for peptide immunization) and PBMC were isolated by Ficoll gradient and counted. Target cells were labeled with 51Cr for 1 hour at 37°C in the presence or absence of 1 µmol/L Melan-A26-35 peptide, then washed and coincubated with PBMC at the indicated PBMC to target cell ratio in V-bottomed 96-well plates in a total volume of 200 µL medium. Chromium release was measured after 4 hours of incubation at 37°C. Percentage of specific lysis was calculated as follows: % specific lysis = (experimental release – spontaneous release / total release – spontaneous release) x 100.

Statistical analyses. Significance was assessed by using unpaired Student's t test. P < 0.05 was considered significant.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Kinetics of the anti-Melan-A T-cell response in HLA-A2/H-2Kb transgenic mice. We compared the immunogenicity of rec. lv containing the preprocessed Melan-A26-35 sequence with that of Melan-A26-35 peptide vaccine by injecting HLA-A2/Kb (A2Kb) transgenic mice with 4 x 106 rec. lv/Melan-A26-35 viral particles or 50 µg peptide admixed with incomplete Freund's adjuvant and CpG oligodeoxynucleotides (adj/Melan-A26-35). This vaccine formulation was reported to be optimal for the induction of strong CD8+ T-cell responses in vivo (24). The magnitude of the antigen-specific responses was determined ex vivo by staining circulating CD8+ T cells with Melan-A26-35/A2Kb tetramers (13, 24). In mice immunized with rec. lv/Melan-A26-35, a significant response was first detected at day 9 and increased to reach a peak of 15.75% tetramer-positive (tet+) T cells among total CD8+ cells at day 14 (Fig. 1A). Whereas the frequency of circulating tet+ cells decreased thereafter, a frequency of 1.74% tet+ cells was still detectable among total CD8+ T cells at day 86. The proportion of tet+ cells among activated (CD62Llow) CD8+ T cells followed a similar curve (Fig. 1B). By comparison, the frequency of tet+ cells among total CD8+ T cells elicited by peptide vaccination reached 1.9% at the peak of the response (day 9) and returned to undetectable levels 28 days after priming. Among CD62Llow CD8+ T cells, a proportion of tet+ cells remained detectable for prolonged periods of time after adj/Melan-A26-35 immunization (Fig. 1B). At day 86, this proportion was similar in mice immunized with adj/Melan-A26-35 and in those immunized with rec. lv/Melan-A26-35. However, the absolute number of tet+ CD62Llow cells among total CD8+ T cells detected at this time point was ~4 times lower in mice immunized with adj/Melan-A26-35 than in those immunized with rec. lv/Melan-A26-35. These results show that a single vaccination with rec. lv induces a strong and long-lasting CD8+ T-cell response against a melanoma-associated antigen in vivo.


Figure 1
View larger version (22K):
[in this window]
[in a new window]
  		Figure 1. Kinetics of the CD8+ T-cell response induced by rec. lv/Melan-A26-35 and adj/Melan-A26-35. A, the anti-Melan-A CD8+ T-cell response was measured ex vivo at different time points after immunization by enumerating the number of tet+ T cells among total CD8+ lymphocytes in blood. The response induced by rec. lv/Melan-A26-35 ({blacksquare}) or adj/Melan-A26-35 (bullet) is shown together with the appropriate controls ({square}, rec. lv/EGFP; {circ}, adjuvant). Points, mean of three mice; bars, SD. Representative of at least three independent experiments. B, same as (A) except that the frequency of tet+ T cells among activated CD62Llow CD8+ T lymphocytes was measured.

 
Recombinant lentivector immunizations induce stronger anti-Melan-A CD8+ T-cell responses than peptides. Because T-cell responses could be followed by ex vivo analysis of PBMC, we performed a detailed enumeration of the circulating T-cell populations 9 and 14 days after immunization with adj/Melan-A26-35 or rec. lv/Melan-A26-35, respectively. These time points correspond to the peaks of the primary T-cell response (Fig. 1). As shown in Table 1, an average of 7.6% tet+ cells among CD8+ T cells were detected 14 days after a single immunization with rec. lv/Melan-A26-35. The frequency of activated CD62Llow CD8+ T cells in these mice was higher than in mice immunized with an irrelevant lv (13.1% versus 6%). However, 43.8% of the activated CD8+ T cells isolated from mice immunized with rec. lv/Melan-A26-35 were tet+, indicating that the overall increase of activated T cells was due to the expansion of Melan-A specific T cells. Mice immunized with adj/Melan-A26-35 showed not only significantly lower CD8+ T-cell responses (2.1% tet+ cells among CD8+ T cells) but also a lower proportion of tet+ cells among CD62Llow T cells (21.7%). Thus, an average of 6.1% activated tet+ cells were found among total CD8+ T cells after rec. lv immunization compared with only 1.8% after peptide vaccination. These results show that a significantly higher proportion of circulating activated antigen-specific T cells was elicited after immunization with rec. lv than with the most efficient peptide vaccine reported thus far. Despite the different magnitude of the response, the anti-Melan-A26-35/HLA-A2 T-cell repertoire elicited by either vaccine modality was similarly diverse (data not shown).


View this table:
[in this window]
[in a new window]
  		Table 1. Analysis of T-cell response

 
In vivo and ex vivo CTL activities. Next, we tested if the tet+ CD8+ T cells elicited by rec. lv/Melan-A26-35 or adj/Melan-A26-35 immunization were capable of fulfilling effector functions. To this end, we did in vivo CTL assays using as targets peptide-pulsed syngeneic splenocytes that were injected i.v. into vaccinated mice (13). Before injection, peptide-pulsed splenocytes were labeled with high-intensity CFSE so that their fate in vivo could be followed by flow cytometry in various tissues. As internal control, the same number of nonpulsed cells was labeled with a lower intensity of CFSE and coinjected with the peptide-pulsed cells. Eighteen hours later, the proportion of living cells with low versus high CFSE content was measured by flow cytometry and allowed us to calculate the percentage of specific target cell killing. Between 51% and 76% of the injected peptide-pulsed cells were eliminated from blood, liver, and spleen of immunized mice (Fig. 2A). Specific killing was similar in mice immunized with rec. lv/Melan-A26-35 and adj/Melan-A26-35. We conclude that rec. lv and peptide immunizations induced CTL capable of performing effector functions in vivo.


Figure 2
View larger version (33K):
[in this window]
[in a new window]
  		Figure 2. Lentiviral and peptide immunizations induce specific effector T cells. A, CTL assay measuring the in vivo elimination of CFSE-labeled target cells transferred into mice immunized with rec. lv/Melan-A26-35 (top), adj/Melan-A26-35 (middle), or adjuvant only (bottom). Syngeneic splenocytes pulsed with Melan-A26-35 peptide and labeled with high CFSE intensity were transferred to vaccinated mice at the peak of the response along with the same number of nonpulsed splenocytes labeled with low CFSE intensity. The frequency of tet+ CD8+ T cells of each recipient mouse at the peak of the response is indicated. Eighteen hours later, the disappearance of peptide-pulsed cells was determined by flow cytometry in blood, spleen, and liver. The ratio of pulsed to nonpulsed cells was used to calculate the percentage of specific killing. Seven of eight mice immunized with rec. lv and five of five mice immunized with peptide or adjuvant showed similar results. B, direct ex vivo killing activities of PBMC derived from mice immunized either with rec. lv/Melan-A26-35 or adj/Melan-A26-35. Dot plots represent the percentage of tet+ T cells among total CD8+ T cells (left) and among CD62Llow CD8+ T cells (middle) after immunization with rec. lv/Melan-A26-35 (top) and adj/Melan-A26-35 (bottom). Right, distribution of CD62L among tet+ CD8+ T cells after immunization with rec. lv/Melan-A26-35 (top) and adj/Melan-A26-35 (bottom). Ex vivo cytolytic assay using total PBMC shown in the dot plots. Freshly isolated PBMC were incubated with 51Cr-labeled peptide-pulsed EL-4/A2Kb cells at ratios ranging from 300:1 to 1:1. As negative control, nonpulsed target cells were included. Points, mean; bars, SD.

 
To quantify more precisely the CTL response, we did ex vivo cytolytic assays. For this analysis, we chose a pair of mice that differed to the same extent in tet+ CD8+ T-cell frequencies as the ones described above (Fig. 2B). PBMC were isolated from immunized mice at the peak of the response and directly incubated with peptide-pulsed 51Cr-labeled target cells ex vivo. At similar PBMC-target cell ratios, T cells isolated from mice immunized with rec. lv/Melan-A26-35 lysed target cells ~10 times more efficiently than cells isolated from peptide immunized mice (Fig. 2B). Because immunization with rec. lv/Melan-A26-35 induced five to six times more tet+ cells among total CD8+ T cells than adj/Melan-A26-35 (12.2% versus 2.3%), this result shows that the lytic activity of CTL elicited by rec. lv/Melan-A26-35 was at least as strong as that observed after peptide immunization. Functional analysis of CD8+ T cells isolated from total PBMC of peptide-immunized mice confirmed that the lytic activity was confined to the CD8+ fraction (data not shown).

Efficient recall responses after rec. lv/Melan-A26-35 priming. To assess the capability of immunized mice to mount secondary responses, we injected adj/Melan-A26-35 into each group of mice described in Fig. 1 130 days after the initial vaccination. We selected peptide for the recall immunization to bypass the previously described anti-lv immunity (13). As shown in Fig. 3A, mice primed with rec. lv/Melan-A26-35 mounted an efficient memory-type T-cell response after peptide boost, reaching frequencies of ~5% tet+ cells among total CD8+ T cells. In contrast, mice primed with peptide did not respond better than untreated mice or mice primed with rec. lv/EGFP (compare with Table 1). These results highlight the potency of rec. lv in promoting the establishment of long-lasting CD8+ T-cell memory.


Figure 3
View larger version (22K):
[in this window]
[in a new window]
  		Figure 3. Immunized HLA-A2/Kb mice challenged with adj/Melan-A26-35. A, mice primed with rec. lv/Melan-A26-35 ({blacksquare}), adj/Melan-A26-35 (bullet), rec. lv/EGFP ({square}), and adjuvant ({circ}) were challenged 130 days after the first immunization with a single dose of 50 µg adj/Melan-A26-35. The frequency of the tet+ T cells among total CD8+ cells was measured at different time points after boosting. Arrow, day at which the boost was administered. Points, mean; bars, SD. B, eighty-six days after priming, PBMC of mice immunized with rec. lv/Melan-A26-35 were stained with Melan-A26-35/A2Kb tetramers. The fraction of tet+ and tet– CD8+ T cells indicated in the dot plot was further stained with antibodies against the memory markers CD44, Ly-6C, CD127, or CD62L. Representative histograms of cells expressing these markers among tet+ CD8+ T cells (top) and tet– CD8+ T cells (bottom).

 
As memory T cells are characterized by the expression of markers such as CD44, Ly-6C, and CD127 (18, 25), we did a phenotypic analysis of the tet+ CD8+ T cells detected 86 days after immunization with rec. lv/Melan-A26-35. The majority of these tet+ CD8+ T cells expressed CD44 (56%), Ly-6C (86%), and CD127 (78%). In contrast, tetramer-negative CD8+ T cells isolated from the same mice did not (Fig. 3B). Such an analysis could not be done in mice immunized with peptides because the number of tet+ CD8+ T cells at day 86 was below detection (Fig. 3A). Interestingly, 40% tet+ cells also expressed CD62L (Fig. 3B). In addition to being a marker of naïve cells, CD62L has also been shown to be expressed by memory cells. Because no circulating tet+ CD62Lhi cells could be detected in naïve mice or in mice immunized with irrelevant rec. lv (Fig. 4B and data not shown), we conclude that the tet+ CD62Lhi cells detected at day 86 could represent memory anti-Melan-A T cells. Whether the tet+ CD62Llow fraction defines the subset of memory T cells called effector memory cells (see Discussion) or cells that were recently activated by the possible sustained expression of Melan-A26-35 following rec. lv immunization remains to be elucidated. However, based on the expression of the different markers described above, we conclude that a majority of tet+ CD8+ T cells induced by rec. lv/Melan-A26-35 immunization and detected at day 86 are antigen-specific memory cells.


Figure 4
View larger version (41K):
[in this window]
[in a new window]
  		Figure 4. Rec. lv immunization induces a higher population of specific CD8+ T cells expressing CD127 compared with peptide immunization. A, mice immunized with rec. lv/Melan-A26-35 or adj/Melan-A26-35 were bled 4 days before the peak of the response (days 10 and 6, respectively) and at the peak of the response (days 14 and 10, respectively). Representative dot plots of PBMC obtained from four mice per condition and stained with Melan-A26-35/A2Kb tetramers (y axis) and CD127 (x axis). The dot plots were gated on the tet+ CD8+ T-cell populations, at day 4 before the peak, indicated on the left. Percentages of CD127hi and CD127low cells among tet+ cells are indicated. As control, the percentage of tet+ CD8+ cells isolated from mice immunized with rec. lv/EGFP is shown. B, same as (A) but among tet+ CD62Llow CD8+ T cells.

 
Increased anti-Melan-A memory T-cell frequencies early after rec. lv/Melan-A26-35 immunization. It was recently shown that a fraction of the antigen-specific CD8+ T cells detected at the peak of a primary response expressed the {alpha} chain of the IL-7 receptor (CD127). This fraction has been proposed to define a population of memory cell precursors that will constitute over time the pool of memory cells (18, 19). In light of the results shown in Fig. 3, we analyzed tet+ CD8+ T cells shortly after rec. lv/Melan-A26-35 or adj/Melan-A26-35 immunization for the expression of CD127 (Fig. 4). Among PBMC of the mouse immunized with rec. lv/Melan-A26-35, 61% tet+ cells among total CD8+ T cells were positive for CD127 at the peak of the response whereas only 25% were positive in the mouse immunized with adj/Melan-A26-35 (Fig. 4A). This proportion was similar for the tet+ population among CD62Llow T cells (Fig. 4B). Interestingly, a similar ratio between CD127hi and CD127low tet+ CD8+ T cells in rec. lv or peptide immunized mice was already detectable 4 days before the peak. Taken together, these results indicate that the primary T-cell response elicited by rec. lv favors the development of antigen-specific CD8+ T cells expressing CD127, which represent potential precursors of memory T cells. In contrast, peptide immunization favors the development of activated T cells with low CD127 expression, characteristic of effector T cells.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
In this study, we found that a single injection of rec. lv resulted in higher frequencies of activated Melan-A-specific CD8+ T cells than the most potent peptide vaccine currently available. Rec. lv also favored the development of antigen-specific memory T cells as shown by the higher proportion of CD127hi Melan-A-specific T cells detected at the peak of the primary response. Circulating memory T cells remained detectable for several months and led to superior recall responses compared with peptide vaccine.

At the peak of the response, the frequency of tet+ T cells induced by rec. lv immunization reached an average of 7.6% (1 in 13 circulating CD8+ T cell). In contrast, 2.1% tet+ cells among CD8+ T cells were induced by adj/Melan-A26-35 (Table 1). Surprisingly, these different frequencies did not result into measurable differences in in vivo CTL assays because target cells were eliminated as efficiently in mice containing 1.8% or 9.8% circulating tet+ cells among total CD8+ T cells (Fig. 2). It is likely that this assay is too easily saturable to reveal such differences. Indeed, other studies showed that as few as 0.08% circulating tet+ CD8+ CTL were able to eliminate over 50% target cells in vivo (26, 27). By contrast, the results of ex vivo CTL assays clearly indicated that the quantitative differences in circulating tet+ CD8+ T cells between mice immunized with rec. lv/Melan-A26-35 and mice immunized with adj/Melan-A26-35 translated into different effector activities. Indeed, the increased lytic activities mediated by PBMC isolated from mice immunized with rec. lv/Melan-A26-35 correlated with the increased frequency of circulating tet+ CD8+ T cells. Whereas it is possible that peptide immunization might result in efficient tumor rejection in vivo, our results indicate that this vaccination modality is unlikely to induce long-lasting protective antitumor immunity. By contrast, immunization with rec. lv offers the advantage of eliciting not only a high proportion of specific effector CD8+ T cells but also long-lasting memory T cells. Therefore, we would suggest that optimized vaccines should also stimulate the development of tumor-reactive memory T cells.

The {alpha} chain of the IL-7 receptor (CD127) has been shown to be expressed both by naïve and memory CD8+ T cells and is essential for T-cell survival (28–31). Moreover, expression of the IL-7 receptor is required for the development of memory CD8+ T cells after antigen stimulation (30). Therefore, we investigated the production of memory T cells after rec. lv immunization, taking advantage of the persistence of detectable anti-Melan-A CD8+ T cells. We found that 78% of the tet+ CD8+ cells detected 86 days after priming with rec. lv were CD127hi and displayed other characteristic memory markers, including CD44, Ly-6C, and CD62L. Within the population of memory T cells, CD62L expression levels have been shown to discriminate between the subset of effector memory cells (CD62Llow) and central memory cells (CD62Lhi; ref. 32). Our results indicate that rec. lv/Melan-A26-35 induced both populations of memory T cells although we cannot totally exclude the possibility that a fraction of the tet+ CD62Llow T cells detected at day 86 might be cells that were recently activated as a consequence of the sustained expression of the antigenic peptide after rec. lv immunization. The presence of memory T cells may explain the effect observed after recall vaccination with peptide in adjuvant. Indeed, peptide boost at day 130 induced a memory response in mice that had received rec. lv initially, with a tet+ cell frequency reaching 5% among total CD8+ T cells. This tet+ cell frequency is significantly higher than that reached after primary peptide immunization. In contrast, mice primed with peptide/adjuvant displayed no detectable memory response. It is noteworthy that the percentage of tet+ CD8+ T cells expressing CD127 at day 86 was similar to that observed at the peak of the primary response although the frequency of tet+ cells among CD8+ T cells was lower.

Analysis of CD127 expression early after priming led us to identify two subpopulations of tet+ cells among total and activated CD8+ T cells. The first population, composed of CD127low tet+ CD8+ T cells, was induced preferentially by peptide immunizations. The second one, composed of CD127hi tet+ CD8+ T cells, was elicited primarily by rec. lv. It was recently shown that a small population of CD127hi CD8+ T cells detected early after lymphocytic choriomeningitis virus infection, both among total and activated antigen-specific CD8+ T cells, defined a population of precursors of memory CD8+ T cells (19). In contrast, activated CD127low T cells were identified as effector T cells (18). Applying these criteria, our results indicate that at the peak of the primary response, the majority (62%) of specific T cells elicited by rec. lv/Melan-A26-35 were memory T-cell precursors. In contrast, a higher proportion of effector T cells than memory T-cell precursors (79% versus 21%) was induced by peptide vaccination. One would therefore conclude that a majority of antigen-specific T cells induced by rec. lv will develop into memory T cells and that the program of memory T-cell differentiation is initiated early after priming. By extension, it is tempting to speculate that the difference in tet+ cell frequencies observed among total CD8+ T cells after immunizations with rec. lv/Melan-A26-35 (average of 7.6%) and adj/Melan-A26-35 (average of 2.1%) could be caused, at least in part, by an increase in memory T-cell precursors.

It was previously reported that the immediate effector functions of CD127hi and CD127low T-cell populations were indistinguishable (19). Our data are compatible with these findings because the effector activities of tet+ CD8+ T cells induced by rec. lv/Melan-A26-35 or adj/Melan-A26-35 were qualitatively similar, despite the different frequencies of CD127-expressing cells.

The reason for the different proportions of CD127-expressing T cells induced by rec. lv or peptide immunization is currently unknown. It is possible that the sustained expression and presentation of the antigenic peptide by transduced antigen presenting cells, such as dendritic cells, may be necessary for the adequate induction of effector and memory T cells. Peptides with short in vivo half-lives may not achieve this. Alternatively, the presence of Thelper epitopes encoded by rec. lv itself may function as adjuvant and may act synergistically to promote the development of CD127hi CD8+ T cells. One possible candidate antigen for this help is the vesicular stomatitis virus G protein present at the surface of the pseudotyped rec. lv used in this study. A recent report showed that CD4+ T cells were required for the emergence of CD127+ CD8+ T cells after acute lymphocytic choriomeningitis virus infection (33). Similarly, we observed that the induction of specific CD8+ T cells by rec. lv/Melan-A26-35 was critically dependent on the presence of CD4+ T cells (ref. 13 and data not shown).

The kinetics of the primary response differed after rec. lv or peptide immunization. Whereas the T-cell response peaked 9 days after peptide immunization, the maximal response was reached 14 days after rec. lv administration. This result suggests that the pool of precursors mobilized following peptide vaccination could be larger than after rec. lv immunization. However, analysis of the T-cell receptor repertoire induced by rec. lv/Melan-A26-35 or adj/Melan-A26-35 did not provide any evidence supporting that hypothesis (data not shown). Another explanation for the delayed response in rec. lv immunized mice might be the time required for the infection of dendritic cells, expression of the antigen, and migration of the transduced dendritic cells to the draining lymph node.

We conclude that a single injection of rec. lv encoding a preprocessed melanoma-associated peptide antigen induces long-lasting antigen-specific T-cell responses in vivo that include high numbers of both effector and memory CD8+ T cells. In addition, the immunogenicity of the determinant introduced into rec. lv opens the possibility of investigating antigen-specific T-cell responses directly ex vivo and offers a unique tool for the analysis of in vivo T-cell response against other tumor-relevant epitopes alone or in combinations.


   Acknowledgments
 
Grant support: Swiss National Foundation and the Cancer Research Institute.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Drs. D. Speiser and C. Lindholm for critical reading of the manuscript and Dr. H.R. MacDonald for guidance in T-cell receptor repertoire analysis.

Received 7/25/05. Revised 10/ 6/05. Accepted 11/ 2/05.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Wiznerowicz M, Trono D. Harnessing HIV for therapy, basic research and biotechnology. Trends Biotechnol 2005;23:42–7.[CrossRef][Medline]
  2. Azzouz M, Kingsman SM, Mazarakis ND. Lentiviral vectors for treating and modeling human CNS disorders. J Gene Med 2004;6:951–62.[Medline]
  3. Brenner S, Malech HL. Current developments in the design of onco-retrovirus and lentivirus vector systems for hematopoietic cell gene therapy. Biochim Biophys Acta 2003;1640:1–24.[Medline]
  4. Zufferey R, Dull T, Mandel RJ, et al. Self-inactivating lentivirus vector for safe and efficient in vivo gene delivery. J Virol 1998;72:9873–80.[Abstract/Free Full Text]
  5. Dull T, Zufferey R, Kelly M, et al. A third-generation lentivirus vector with a conditional packaging system. J Virol 1998;72:8463–71.[Abstract/Free Full Text]
  6. Kung SKP, Bonifacino A, Metzger ME, Ringpis G-E, Donahue RE, Chen ISY. Lentiviral vector-transduced dendritic cells induce specific T cell response in a nonhuman primate model. Hum Gene Ther 2005;16:527–32.[CrossRef][Medline]
  7. Zarei S, Abraham S, Arrighi J-F, et al. Lentiviral transduction of dendritic cells confers protective antiviral immunity in vivo. J Virol 2004;78:7843–5.[Abstract/Free Full Text]
  8. Koya RC, Kasahara N, Favaro PM, et al. Potent maturation of monocyte-derived dendritic cells after CD40L lentiviral gene delivery. J Immunother 2003;26:451–60.
  9. Breckpot K, Dullaers M, Bonehill A, et al. Lentivirally transduced dendritic cells as a tool for cancer immunotherapy. J Gene Med 2003;5:654–67.[CrossRef][Medline]
  10. Esslinger C, Romero P, MacDonald HR. Efficient transduction of dendritic cells and induction of a T-cell response by third-generation lentivectors. Hum Gene Ther 2002;13:1091–100.[CrossRef][Medline]
  11. Metharom P, Ellem KA, Schmidt C, Wei MQ. Lentiviral vector-mediated tyrosinase-related protein 2 gene transfer to dendritic cells for the therapy of melanoma. Hum Gene Ther 2001;12:2203–13.[CrossRef][Medline]
  12. Dyall J, Latouche J-B, Schnell S, Sadelain M. Lentivirus-transduced human monocyte-derived dendritic cells efficiently stimulate antigen-specific cytotoxic T lymphocytes. Blood 2001;97:114–21.[Abstract/Free Full Text]
  13. Esslinger C, Chapatte L, Finke D, et al. In vivo administration of a lentiviral vaccine targets dendritic cells and induces efficient CD8+ T cell responses. J Clin Invest 2003;111:1673–81.[CrossRef][Medline]
  14. Romero P, Valmori D, Pittet MJ, et al. Antigenicity and immunogenicity of Melan-A/MART-1 derived peptides as targets for tumor reactive CTL in human melanoma. Immunol Rev 2002;188:81–96.[CrossRef][Medline]
  15. Valmori D, Fonteneau J-F, Lizana CM, et al. Enhanced generation of specific tumor-reactive CTL in vitro by selected Melan-A/MART-1 immunodominant peptide analogues. J Immunol 1998;160:1750–8.[Abstract/Free Full Text]
  16. Ayyoub M, Zippelius A, Pittet MJ, et al. Activation of human melanoma reactive CD8+ T cells by vaccination with an immunogenic peptide analog derived from Melan-A/melanoma antigen recognized by T cells-1. Clin Cancer Res 2003;9:669–77.[Abstract/Free Full Text]
  17. Speiser DE, Lienard D, Rufer N, et al. Rapid and strong human CD8+ T cell responses to vaccination with peptide, IFA, and CpG oligodeoxynucleotide 7909. J Clin Invest 2005;115:739–46.[CrossRef][Medline]
  18. Huster KM, Busch V, Schiemann M, et al. Selective expression of IL-7 receptor on memory T cells identifies early CD40L-dependent generation of distinct CD8+ memory T cell subsets. Proc Natl Acad Sci U S A 2004;101:5610–5.[Abstract/Free Full Text]
  19. Kaech SM, Tan JT, Wherry EJ, Konieczny BT, Surh CD, Ahmed R. Selective expression of the interleukin 7 receptor identifies effector CD8 T cells that give rise to long-lived memory cells. Nat Immunol 2003;4:1191–8.[CrossRef][Medline]
  20. Vitiello A, Marchesini D, Furze J, Sherman LA, Chesnut RW. Analysis of the HLA-restricted influenza-specific cytotoxic T lymphocyte response in transgenic mice carrying a chimeric human-mouse class I major histocompatibility complex. J Exp Med 1991;173:1007–15.[Abstract/Free Full Text]
  21. Chapatte L, Servis C, Valmori D, et al. Final antigenic Melan-A peptides produced directly by the proteasomes are preferentially selected for presentation by HLA-A*0201 in melanoma cells. J Immunol 2004;173:6033–40.[Abstract/Free Full Text]
  22. Lévy F, Johnsson N, Rümenapf T, Varshavsky A. Using ubiquitin to follow the metabolic fate of a protein. Proc Natl Acad Sci U S A 1996;93:4907–12.[Abstract/Free Full Text]
  23. Valmori D, Lévy F, Miconnet I, et al. Induction of potent anti tumor CTL responses by recombinant vaccinia encoding melan-A peptide analogue. J Immunol 2000;164:1125–31.[Abstract/Free Full Text]
  24. Miconnet I, Koenig S, Speiser D, et al. CpG are efficient adjuvants for specific CTL induction against tumor antigen-derived peptide. J Immunol 2002;168:1212–8.[Abstract/Free Full Text]
  25. Walunas T, Bruce D, Dustin L, Loh D, Bluestone J. Ly-6C is a marker of memory CD8+ T cells. J Immunol 1995;155:1873–83.[Abstract]
  26. Hermans IF, Silk JD, Yang J, et al. The VITAL assay: a versatile fluorometric technique for assessing CTL- and NKT-mediated cytotoxicity against multiple targets in vitro and in vivo. J Immunol Methods 2004;285:25–40.[CrossRef][Medline]
  27. Palmowski MJ, Lopes L, Ikeda Y, Salio M, Cerundolo V, Collins MK. Intravenous injection of a lentiviral vector encoding NY-ESO-1 induces an effective CTL response. J Immunol 2004;172:1582–7.[Abstract/Free Full Text]
  28. Bradley LM, Haynes L, Swain SL. IL-7: maintaining T-cell memory and achieving homeostasis. Trends Immunol 2005;26:172–6.[CrossRef][Medline]
  29. Schluns KS, Lefrancois L. Cytokine control of memory T-cell development and survival. Nat Rev Immunol 2003;3:269–79.[CrossRef][Medline]
  30. Schluns KS, Kieper WC, Jameson SC, Lefrancois L. Interleukin-7 mediates the homeostasis of naive and memory CD8 T cells in vivo. Nat Immunol 2000;1:426–32.[CrossRef][Medline]
  31. Maraskovsky E, Teepe M, Morrissey P, et al. Impaired survival and proliferation in IL-7 receptor-deficient peripheral T cells. J Immunol 1996;157:5315–23.[Abstract]
  32. Wherry EJ, Teichgraber V, Becker TC, et al. Lineage relationship and protective immunity of memory CD8 T cell subsets. Nat Immunol 2003;4:225–34.[CrossRef][Medline]
  33. Fuller MJ, Hildeman DA, Sabbaj S, et al. Cutting edge: emergence of CD127 high functionally competent memory T cells is compromised by high viral loads and inadequate T cell help. J Immunol 2005;174:5926–30.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Virol.Home page
A.-S. Beignon, K. Mollier, C. Liard, F. Coutant, S. Munier, J. Riviere, P. Souque, and P. Charneau
Lentiviral Vector-Based Prime/Boost Vaccination against AIDS: Pilot Study Shows Protection against Simian Immunodeficiency Virus SIVmac251 Challenge in Macaques
J. Virol., November 1, 2009; 83(21): 10963 - 10974.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
S. Colombetti, F. Levy, and L. Chapatte
IL-7 adjuvant treatment enhances long-term tumor antigen-specific CD8+ T-cell responses after immunization with recombinant lentivector
Blood, June 25, 2009; 113(26): 6629 - 6637.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
K. Karwacz, S. Mukherjee, L. Apolonia, M. P. Blundell, G. Bouma, D. Escors, M. K. Collins, and A. J. Thrasher
Nonintegrating Lentivector Vaccines Stimulate Prolonged T-Cell and Antibody Responses and Are Effective in Tumor Therapy
J. Virol., April 1, 2009; 83(7): 3094 - 3103.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
H. M. Rowe, L. Lopes, N. Brown, S. Efklidou, T. Smallie, S. Karrar, P. M. Kaye, and M. K. Collins
Expression of vFLIP in a Lentiviral Vaccine Vector Activates NF-{kappa}B, Matures Dendritic Cells, and Increases CD8+ T-Cell Responses
J. Virol., February 15, 2009; 83(4): 1555 - 1562.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
L. Lopes, M. Dewannieux, U. Gileadi, R. Bailey, Y. Ikeda, C. Whittaker, M. P. Collin, V. Cerundolo, M. Tomihari, K. Ariizumi, et al.
Immunization with a Lentivector That Targets Tumor Antigen Expression to Dendritic Cells Induces Potent CD8+ and CD4+ T-Cell Responses
J. Virol., January 1, 2008; 82(1): 86 - 95.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
M. Inokuma, C. dela Rosa, C. Schmitt, P. Haaland, J. Siebert, D. Petry, M. Tang, M. A. Suni, S. A. Ghanekar, D. Gladding, et al.
Functional T Cell Responses to Tumor Antigens in Breast Cancer Patients Have a Distinct Phenotype and Cytokine Signature
J. Immunol., August 15, 2007; 179(4): 2627 - 2633.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
L. Chapatte, M. Ayyoub, S. Morel, A.-L. Peitrequin, N. Levy, C. Servis, B. J. Van den Eynde, D. Valmori, and F. Levy
Processing of Tumor-Associated Antigen by the Proteasomes of Dendritic Cells Controls In vivo T-Cell Responses.
Cancer Res., May 15, 2006; 66(10): 5461 - 5468.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chapatte, L.
Right arrow Articles by Lévy, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chapatte, L.
Right arrow Articles by Lévy, F.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online