
[Cancer Research 66, 646-648, January 15, 2006]
© 2006 American Association for Cancer Research
The Single Nucleotide Polymorphism IVS1+309 in Mouse Double Minute 2 Does Not Affect Risk of Familial Breast Cancer
Stefan Wilkening1,
Justo Lorenzo Bermejo1,
Barbara Burwinkel1,
Rüdiger Klaes2,
Claus R. Bartram2,
Alfons Meindl3,
Peter Bugert5,
Rita K. Schmutzler6,
Barbara Wappenschmidt6,
Michael Untch4,
Kari Hemminki1,7 and
Asta Försti1,7
1 Department of Molecular Genetic Epidemiology, German Cancer Research Center (Deutsches Krebsforschungszentrum); 2 Institute of Human Genetics, University of Heidelberg, Heidelberg, Germany; 3 Department of Gynaecology and Obstetrics, Division for Tumor Genetics, Klinikum rechts der Isar; 4 Department of Gynaecology and Obstetrics at the Ludwig-Maximilians-University, Munich, Germany; 5 Institute of Transfusion Medicine and Immunology, Red Cross Blood Service of Baden-Württemberg-Hessia, Faculty of Clinical Medicine, University of Heidelberg, Mannheim, Germany; 6 Division of Molecular Gynaeco-Oncology, Department of Gynaecology and Obstetrics, Clinical Center University of Cologne, Cologne, Germany; and 7 Department of Biosciences at Novum, Karolinska Institute, Huddinge, Sweden
Requests for reprints: Stefan Wilkening, Department of Molecular Genetic Epidemiology, German Cancer Research Center (Deutsches Krebsforschungszentrum), Im Neuenheimer Feld 580, 69120 Heidelberg, Germany. Phone: 49-6221-421803; Fax: 49-6221-421810; E-mail: s.wilkening{at}dkfz.de.
 |
Abstract
|
|---|
The mouse double minute 2 (MDM2) oncoprotein promotes cell survival and cell cycle progression by inhibiting the p53 tumor suppressor protein. Further, MDM2 overexpression can inhibit DNA double-strand break repair in a p53-independent manner. Recently, it was shown that a single nucleotide polymorphism (SNP) in the MDM2 promoter was associated with an accelerated tumor formation in individuals with a p53 mutation. The present case-control study investigated the association of this SNP (IVS1+309) with the risk and the age of onset of familial breast cancer in patients with unknown p53 mutation status. Data from 549 women affected by familial breast cancer and 1,065 healthy controls were analyzed. The cases did not carry BRCA1/2 mutations. Cases and controls showed a similar genotype distribution and the SNP did not seem to modify the age of onset of familial breast cancer. The data were also examined taking into account the presence of any additional cancer after breast cancer and the family history of cases; however, no association was found. These results suggest that the SNP IVS1+309 alone affects neither the risk nor the age of onset of heritable breast cancer. (Cancer Res 2006; 66(2): 646-8)
 |
Introduction
|
|---|
The human homologue of mouse double minute 2 (MDM2) is a negative regulator of the p53 tumor suppressor. The encoded protein is a nuclear phosphoprotein that binds to p53 and inhibits p53-dependent transcription (1). Overexpression of this gene can result in excessive inactivation of p53, diminishing its tumor suppressor function (2). MDM2 has also been shown to promote tumor growth in a p53-independent manner (3). The level of MDM2 protein is up-regulated in
40% of breast cancer specimens, although MDM2 gene amplification is uncommon in breast cancers (4, 5). Recently, Bond et al. (6, 7) analyzed the single nucleotide polymorphism (SNP) IVS1+309 (rs2279744), subsequently called SNP309, with a base change from T to G. The SNP is located in the intronic promoter of MDM2, which is used by both the p53 and ras pathways to activate MDM2 transcription (8, 9). The authors showed that, in cell lines, SNP309 increases the affinity of the transcription factor Sp1 to the MDM2 promoter and enhances the expression of MDM2 RNA and protein, which can lead to attenuation of the p53 stress response. In the study of Bond et al., 66 Li-Fraumeni patients with a germ line mutation in one allele of p53 were examined for their genotype at the position of SNP309. Their results showed SNP309 to be associated with an early onset of different cancers. In 17 breast cancers included in this study, the age of onset was on average 10 years earlier in cases carrying a G allele in SNP309. Furthermore, in Li-Fraumeni patients first diagnosed with soft tissue sarcoma, SNP309 was associated with the occurrence of subsequent tumors. Bond et al. also reported SNP309 to be significantly associated with an earlier age of onset in patients with soft tissue sarcoma who had no known germ line p53 mutation. This led to the assumption that, at least for soft tissue sarcoma development, SNP309 plays an important role for cancer onset, independently of germ line p53 mutations (as reviewed in ref. 7). In Li-Fraumeni families, breast cancer is the most prevalent cancer (10). Considering the profound transcriptional effects of SNP309 and its effect on the age of breast cancer onset in Li-Fraumeni patients, we wanted to examine whether it influences familial breast cancers not known to be linked to any gene mutation. Any inherited susceptibility allele would be expected to be enriched in familial cases (8, 9), prompting our choice of familial breast cancer patients for the study.
 |
Materials and Methods
|
|---|
Study population. The familial breast cancer cases consisted of 549 German women lacking BRCA1 and BRCA2 mutations. The cases were unrelated individuals (i.e., only one member of the family was included in the study). They were classified in four classes according to family history: F1, families with two or more breast cancer cases, including at least two cases with onset before age 50 years; F2, families with at least one breast cancer and at least one ovarian cancer; F3, families with at least two breast cancer cases not included in F1 or F2; F4, families with a single case of breast cancer diagnosed before age 35 years. The proportion of excluded patients with BRCA1 or BRCA2 mutations was 37% for F1, 53% for F2, and <10% for F3 + F4 (11). The probability to get breast cancer by the age of 70 years was 68% to 84% for women belonging to families in F1, 69% in F2, 69% to 79% in F3, and 61% in F4 (12). The samples were collected during the years 1997 to 2004 by the Institute of Human Genetics (Heidelberg, Germany), the Department of Gynaecology and Obstetrics (Cologne, Germany), and the Department of Medical Genetics (Munich, Germany). The control samples were collected by the Institute of Transfusion Medicine and Immunology (Mannheim, Germany) and included 1,065 healthy and unrelated blood donors (26-68 years of age) who shared the ethnic background with the breast cancer cases. The study was approved by the Ethics Committee of the University of Heidelberg (Heidelberg, Germany).
Genotyping. The MDM2 SNP309 (rs2279744) was genotyped in cases and controls using a custom TaqMan genotyping assay (Applied Biosystems, Foster City, CA). Sequences are for forward primer CGGGAGTTCAGGGTAAAGGT, reverse primer GCGCAGCGTTCACACTAG, vic-labeled probe CTCCCGCGCCGAAG, and fam-labeled probe: TCCCGCGCCGCAG. For TaqMan PCR, 5 ng of genomic DNA isolated from blood was used in a total volume of 5 µL. To verify the TaqMan results, 10% of the samples were sequenced in an automated ABI PRISM 3100 genetic analyzer. Sequencing primers (forward CGGGAGTTCAGGGTAAAGGT and reverse AGCAAGTCGGTGCTTACCTG) were purchased from Thermo Electron GmbH (Ulm, Germany).
Statistical analysis. To test if the genotype distribution followed Hardy-Weinberg equilibrium, we used the public software (http://ihg.gsf.de/cgi-bin/hw/hwa1.pl). Odds ratios (OR) with the corresponding 95% confidence intervals (95% CI) and P values were calculated using logistic regression adjusting for age. The logistic regression analysis was done using SAS Version 8.2. Genotype-specific distributions of age of tumor onset were compared by median tests.
 |
Results
|
|---|
The genotype distribution in our sample set followed the Hardy-Weinberg equilibrium (P = 0.133). Table 1 shows the genotype distribution for cases and controls, which was similar to previously published frequencies (6, 1315). The overall OR for familial breast cancer of patients with the G/G genotype of SNP309 was 1.23 (95% CI, 0.90-1.68). To investigate the association of SNP309 with different types of heritable breast cancer, we subdivided the cases into following groups: cases with any second cancer and cases with a specific family history (F1-F3, for explanation see Materials and Methods). No significant association was found between the risk of breast cancer and the SNP309 genotype in any of the groups. To check whether the SNP is associated with an earlier onset of familial breast cancer, we plotted the cumulative number of cases with genotypes G/G, G/T, and T/T against the onset age of breast cancer (Fig. 1). In contrast to the results from Bond et al., the genotype G/G (
) was rather associated with a later onset of breast cancer. However, the difference between the median ages of onset was not significant (P = 0.17). The differences in age of onset among genotypes did not reach statistical significance in any of the groups.
View this table:
[in this window]
[in a new window]
|
Table 1. Analysis of the effect of MDM2 genotype on breast cancer risk and median age of tumor onset in groups of personal and family history of breast cancer
|
|

View larger version (13K):
[in this window]
[in a new window]
|
Figure 1. Cumulative number of breast cancer patients with different genotypes plotted against the age of onset.
|
|
 |
Discussion
|
|---|
Bond et al. (6, 7) found SNP309 to be associated with an early onset of cancer in 66 Li-Fraumeni individuals, 17 of whom had breast cancer. Individuals who carried the G allele in SNP309 developed the first tumor 9 years earlier than individuals without this allele; for breast cancer, the difference in onset age was 10 years on average. A recent study by Bougead et al. (13) confirmed the effect of the MDM2 SNP309 on the age of tumor onset in germ line p53 mutation carriers. An earlier age of onset was further reported by Bond et al. for individuals with soft tissue sarcoma and no known p53 mutation. Therefore, we hypothesized that SNP309 is also associated with the age of onset in our large collection of familial breast cancer cases, all of whom were negative for BRCA1/2 mutations. DNA samples of patients used for this study were not scanned for p53 mutations. However, germ line mutations in p53 account for <1% of cases with familial breast cancer (16).
Our results suggest that SNP309 alone has little importance for the development of familial breast cancer and that additional genetic variants that weaken the p53 pathway like a p53 mutation are needed for a significant effect. Further recent studies also showed that SNP309 alone does not have an effect on the risk or the onset of different cancers (15, 17), including breast cancer (14). Bond et al. (7) reported a significant association with SNP309 and the onset of sporadic soft tissue sarcoma in 105 individuals with no known germ line p53 mutation. The specific association of SNP309 with soft tissue sarcoma but not with breast cancer would be indicative of a tissue-specific effect. The strength of our study was the use of DNA samples from women selected for familial breast cancer, because in these individuals the chance to find heritable cancer susceptibility alleles is much higher than in cases unselected for family history (8, 9). With our sample size, considering that
14% of the controls carried the G/G genotype, we had an 80% power to detect an OR
1.5 (P = 0.05; ref. 18). In conclusion, our large familial case-control study suggests that SNP309 in the intronic promoter region of MDM2 alone does not influence the risk of breast cancer.
 |
Acknowledgments
|
|---|
Grant support: Deutsche Krebshilfe (for collection of German breast cancer samples) and European Union grant LSHC-CT-2004-503465.
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 9/ 7/05.
Revised 11/15/05.
Accepted 11/19/05.
 |
References
|
|---|
- Momand J, Zambetti GP, Olson DC, George D, Levine AJ. The mdm-2 oncogene product forms a complex with the p53 protein and inhibits p53-mediated transactivation. Cell 1992;69:123745.[CrossRef][Medline]
- Michael D, Oren M. The p53-Mdm2 module and the ubiquitin system. Semin Cancer Biol 2003;13:4958.[CrossRef][Medline]
- Zhang Z, Zhang R. p53-independent activities of MDM2 and their relevance to cancer therapy. Curr Cancer Drug Targets 2005;5:920.[CrossRef][Medline]
- McCann AH, Kirley A, Carney DN, et al. Amplification of the MDM2 gene in human breast cancer and its association with MDM2 and p53 protein status. Br J Cancer 1995;71:9815.[Medline]
- Quesnel B, Preudhomme C, Fournier J, Fenaux P, Peyrat JP. MDM2 gene amplification in human breast cancer. Eur J Cancer 1994;30A:9824.[CrossRef]
- Bond GL, Hu W, Bond EE, et al. A single nucleotide polymorphism in the MDM2 promoter attenuates the p53 tumor suppressor pathway and accelerates tumor formation in humans. Cell 2004;119:591602.[CrossRef][Medline]
- Bond GL, Hu W, Levine A. A single nucleotide polymorphism in the MDM2 gene: from a molecular and cellular explanation to clinical effect. Cancer Res 2005;65:54814.[Abstract/Free Full Text]
- Antoniou AC, Easton DF. Polygenic inheritance of breast cancer: implications for design of association studies. Genet Epidemiol 2003;25:190202.[CrossRef][Medline]
- Houlston RS, Peto J. The future of association studies of common cancers. Hum Genet 2003;112:4345.[Medline]
- Birch JM, Alston RD, McNally RJ, et al. Relative frequency and morphology of cancers in carriers of germline TP53 mutations. Oncogene 2001;20:46218.[CrossRef][Medline]
- Meindl A. Comprehensive analysis of 989 patients with breast or ovarian cancer provides BRCA1 and BRCA2 mutation profiles and frequencies for the German population. Int J Cancer 2002;97:47280.[CrossRef][Medline]
- Lorenzo Bermejo J, Hemminki K. A population-based assessment of the clustering of breast cancer in families eligible for testing of BRCA1 and BRCA2 mutations. Ann Oncol 2005;16:3229.[Abstract/Free Full Text]
- Bougeard G, Baert-Desurmont S, Tournier I, et al. Impact of the MDM2 SNP309 and TP53 Arg72Pro polymorphism on age of tumour onset in Li-Fraumeni syndrome. J Med Genet 2005. [Epub ahead of print].
- Campbell IG, Eccles DM, Choong DY. No association of the MDM2 SNP309 polymorphism with risk of breast or ovarian cancer. Cancer Lett 2005. [Epub ahead of print].
- Sotamaa K, Liyanarachchi S, Mecklin JP, et al. p53 codon 72 and MDM2 SNP309 polymorphisms and age of colorectal cancer onset in Lynch syndrome. Clin Cancer Res 2005;11:68404.[Abstract/Free Full Text]
- Wooster R, Weber BL. Breast and ovarian cancer. N Engl J Med 2003;348:233947.[Free Full Text]
- Alhopuro P, Ylisaukko-Oja SK, Koskinen WJ, et al. The MDM2 promoter polymorphism SNP309T
G and the risk of uterine leiomyosarcoma, colorectal cancer, and squamous cell carcinoma of the head and neck. J Med Genet 2005;42:6948.[Abstract/Free Full Text] - Dupont WD, Plummer WD, Jr. Power and sample size calculations for studies involving linear regression. Control Clin Trials 1998;19:589601.[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
T. Zenz, S. Habe, A. Benner, D. Kienle, H. Dohner, and S. Stilgenbauer
The MDM2 -309 T/G promoter single nucleotide polymorphism does not alter disease characteristics in chronic lymphocytic leukemia
Haematologica,
July 1, 2008;
93(7):
1111 - 1113.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Hu, G. Jin, L. Wang, F. Chen, X. Wang, and H. Shen
MDM2 Promoter Polymorphism SNP309 Contributes to Tumor Susceptibility: Evidence from 21 Case-Control Studies
Cancer Epidemiol. Biomarkers Prev.,
December 1, 2007;
16(12):
2717 - 2723.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Wilkening, J. L. Bermejo, and K. Hemminki
MDM2 SNP309 and cancer risk: a combined analysis
Carcinogenesis,
November 1, 2007;
28(11):
2262 - 2267.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. K. Schmidt, S. Reincke, A. Broeks, L. M. Braaf, F. B.L. Hogervorst, R. A.E.M. Tollenaar, N. Johnson, O. Fletcher, J. Peto, J. Tommiska, et al.
Do MDM2 SNP309 and TP53 R72P Interact in Breast Cancer Susceptibility? A Large Pooled Series from the Breast Cancer Association Consortium
Cancer Res.,
October 1, 2007;
67(19):
9584 - 9590.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. J. Boersma, T. M. Howe, J. E. Goodman, H. G. Yfantis, D. H. Lee, S. J. Chanock, and S. Ambs
Association of Breast Cancer Outcome With Status of p53 and MDM2 SNP309.
J Natl Cancer Inst,
July 5, 2006;
98(13):
911 - 919.
[Abstract]
[Full Text]
[PDF]
|
 |
|