| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Cell, Tumor, and Stem Cell Biology |
and Mitogen-Activated Protein/Extracellular SignalRegulated Kinase-1 Control GLI Activation in Hedgehog Signaling
1 Department of Cell and Developmental Biology, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania and 2 Boston Biomedical Research Institute, Watertown, Massachusetts
Requests for reprints: Charles P. Emerson, Jr., Boston Biomedical Research Institute, 64 Grove Street, Watertown, MA 02472. E-mail: emersonc{at}bbri.org.
| Abstract |
|---|
|
|
|---|
(PKC
) and mitogen-activated protein/extracellular signalregulated kinase-1 (MEK-1), fully stimulate the transcriptional activity of endogenous and overexpressed GLI proteins, as assessed by GLI-luciferase reporter assays, and induce the expression of endogenous GLI1 and PTCH-1 target genes, as assessed by reverse transcription-PCR. Moreover, activation of GLI elicited by Sonic Hedgehog also requires PKC
and MEK-1 function. Remarkably, coexpression of activated MEK-1 and GLI1 or GLI2 induced a 10-fold synergistic increase in GLI-luciferase activity that was totally blocked by PD98059. The NH2-terminal region of GLI1 (amino acids 1-130) is required for sensing the ERK pathway, as deletion of this domain produces active GLI1 protein with greatly reduced response to activation by MEK-1. Basic fibroblast growth factor activation of the ERK pathway also stimulated GLI1 activity through its NH2-terminal domain. Our results identify PKC
and MEK-1 as essential, positive regulators of GLI-mediated HH signaling. Furthermore, our findings suggest that tumors with deregulated HH and ERK synergize to stimulate cell proliferation pathways. (Cancer Res 2006; 66(2): 839-45) | Introduction |
|---|
|
|
|---|
Despite the central role of HH signaling in tissue development, repair, and cancer, the mechanisms of SMO signaling for GLI transcription factor activation are not well understood. Also, the molecular and cellular mechanisms for HH regulation of cell proliferation are unknown. The canonical HH pathway does not share common targets with mitogenic signaling pathways, with the exception of the recently described role of phosphoinositide-3-kinase and Akt in Gli activation.3 Conversely, it has been proposed that the proliferative effects of SHH in the ASZ001 BCC cell line are indirectly mediated through the synthesis of a secondary mitogenidentified as platelet-derived growth factor receptor
(PDGFR
)and activation of the ERK pathway (12). Indeed, induction of apoptosis in BCCs have been reported through a mechanism that blocks the Ras/ERK pathway (13), suggesting that overactivation of the HH pathway is not sufficient to drive tumoral fate. Activated ERK pathway is also required during embryonic development for SHH-induced differentiation of neocortical precursor cells into oligodendrocyte progenitors (14).
In the SHH/IHH ligand-dependent subset of cancers, protein kinase C (PKC) as an activator of the ERK pathway has a positive role in normal and tumor cell growth, and in the prevention of apoptosis. Some lines of SCLC, for instance, express oxytocin, vasopressin, and their receptors, and this autocrine loop stimulates proliferation in a calcium-, PKC-, and ERK-dependent manner (15). The effects of other mitogenic hormones, like GHRH and bombesin, are also blocked by PKC inhibitors (16). These evidences raise the possibility that PKC and SHH act cooperatively to promote tumorigenesis.
These observations lead us to investigate the regulatory interactions between HH and ERK pathways in the HH-responsive NIH 3T3 cell line. As PKC is a well-characterized activator of the ERK pathway, we investigated the role of PKC in GLI-mediated transcription. Here, we report that phorbol esters, acting through PKC
and the ERK pathway, can stimulate GLI transcriptional activity in the absence of HH ligand, and that mitogen-activated protein/extracellular signalregulated kinase-1 (MEK-1) is an obligatory downstream effector of PKC signaling that strongly synergizes with SHH to activate GLI. In addition, we show that SHH signaling is blocked by the disruption of PKC
function, either by pharmacologic inhibitors or by dominant-negative PKC
, and by inhibition of MEK-1, establishing a role for the PKC-MEK cascade in initiation and/or amplification of GLI-mediated HH signaling.
| Materials and Methods |
|---|
|
|
|---|
and anti-PKC
were from Cell Signaling (Beverly, MA) and horseradish peroxidaseconjugated antimouse and antirabbit antibodies (1:4,000) were from Jackson Immunolabs (West Grove, PA). Cell culture and transfection. NIH 3T3 mouse embryonic fibroblasts were purchased from the American Type Culture Collection (Manassas, VA) and a derived line, LIGHT2, was obtained from Dr. Phil Beachy (Johns Hopkins University, Baltimore, MD). Cells (passages 2-15) were cultured in DMEM supplemented with 10% FBS and penicillin (100 units/mL)-streptomycin (100 µg/mL) at 37°C in a humidified 5% CO2 atmosphere. For experiments with PMA or N-SHH stimulation, LIGHT2 cells were plated at high density and stimulated when they reached 100% confluency with 0.1 µmol/L PMA or 5 µg/mL N-SHH, unless otherwise indicated. Inhibitors were added 30 minutes prior to addition of PMA or N-SHH. For transfections, NIH 3T3 cells were seeded in 12-well plates at 70% confluence and transfected with different vectors (1-2 µg) using FuGENE 6 transfection reagent (Roche Applied Science, Indianapolis, IN) according to the manufacturer's protocol. After reaching 100% confluency, the medium was changed to 0.5% FBS DMEM for 24 hours. Luciferase (firefly) and Renilla luciferase activities were determined in lysates of LIGHT2 or transfected NIH 3T3 cells with the Dual Luciferase Reporter Assay System (Promega, Madison, WI) following the manufacturer's directions and expressed as relative luciferase units (RLU): [(luciferase / Renilla)sample (luciferase / Renilla)baseline], where baseline is the value of vehicle-stimulated control cells or cells transfected with pcDNA3.1+, depending on the experiment.
Plasmid constructs. Full-length mGLI1 and mGLI2 expression constructs and the reporter vectors 8xGBSwt-luc and 8xGBSmut-luc were provided by Dr. H. Sasaki.
N1GLI1 was generated by restriction with KpnI and religation of the construct, and the resulting deletion mutant was sequence-verified. The dnPKC
plasmid was a generous gift from Dr. Qiming Wang (University of Pittsburgh, Pittsburgh, PA). The mutationally activated MEK1 (S218E, S222E,
32-51) was from the PathDetect system (Stratagene, La Jolla, CA). pRL-TK, pSV-TK and pCMV-ßGal were obtained from Promega.
Generation and purification of recombinant N-SHH. Mouse N-SHH cDNA (nucleotides 72-593) was cloned by PCR amplification using complementary primers containing an Eam1104 site followed by two additional Ile codons in the 5' primer, and a stop codon followed by a HindIII site in the 3' primer. The PCR product was cloned into pcDNA3.1-TOPO, and the Eam1104-BamHI fragment was excised and subcloned into pCAL-n-EK (Stratagene) to generate the fusion pCBP-SHH. Expression of the fusion protein in BL21(DE3)-Gold cells (Stratagene) was induced with isopropyl-L-thio-ß-D-galactopyranoside (1 mmol/L, 3 hours). The CBP-SHH fusion protein was purified from the supernatant of the cell lysate with a calmodulin affinity resin as directed by the manufacturer. The CBP partner was excised with enterokinase (10 units/mg protein, 24 hours). After separation of enterokinase with STI-agarose, purified N-SHH was concentrated and stored at 80°C in 20% glycerol.
Semiquantitative reverse transcription-PCR. Total RNA was isolated from treated LIGHT2 cells with the RNeasy kit (Qiagen, Valencia, CA) as directed. An aliquot of 2 µg was DNase-treated and then subjected to reverse transcription with SuperScript II (Invitrogen, Carlsbad, CA) using hexarandom primers. One twentieth of the final cDNA was used in each PCR reaction. GLI1 cDNA was amplified using GGACTTTCTGGTCTGCCCTTTTG (forward primer) and ATGGAGAGAGCCCGCTTCTTTG (reverse primer), Patched-1 was amplified with TCAAACTGGGTCTCGTCTGCC (forward primer) and ATGTCCACACCGATACTT TCCAATC (reverse primer) and ß-actin with commercial primers.
| Results |
|---|
|
|
|---|
10- to 15-fold, which is inhibited by cyclopamine, a SMO inhibitor (17). In 6-hour acute treatments, PMA increased normalized GLI-luciferase activity in a dose-dependent manner (Fig. 1A), and GLI activity returned to baseline levels after 24 hours. Costimulation of LIGHT2 cells with 5 µg/mL N-SHH and PMA did not further increase the luciferase activity (Fig. 1A), indicating that PMA elicited the maximal activation of GLI transcription factor activity through a common pathway. PMA activation of GLI is mediated through PKC, as revealed by the finding that pan-PKC inhibitor GF109203X blocked PMA activity (PMA, 3.8 ± 0.5 versus PMA + GF109203X, 1.2 ± 0.3-fold luciferase; n = 3). We also examined the PMA-mediated induction of two endogenous GLI-regulated genes, PTCH-1 and GLI1. Reverse transcription-PCR (RT-PCR) assays show that PMA induces a dose-dependent increase in PTCH 1 and GLI1 mRNA levels, which is inhibited by GF109203X (Fig. 1B). To further test the specificity of GLI-dependent transcription by PMA, NIH 3T3 fibroblasts were transfected with a wild-type 8XGBS-luciferase reporter or a mutated 8XGBS luciferase reporter (8XGBSmut) harboring a point mutation that abolishes the binding of GLI, and the transfected cells were stimulated for 6 hours either with 0.1µmol/L PMA or with control vehicle. PMA stimulated luciferase activity under the control of wild-type, but not mutant, GBS (Fig. 1C), indicating that PMA activity is mediated through activation of GLI transcriptional activity. Moreover, 0.1 µmol/L PMA enhanced GLI-luciferase activity in NIH 3T3 cells overexpressing mGLI1 and mGLI2 under the control of a CMV promoter (Fig. 1D), without changing in the expression levels of GLI1 and GLI2, indicating that PKC activity is rate-limiting in the control of GLI activity.
|
mediates GLI activation by phorbol esters. PKC isoforms have been classified into three groups: the classical PKC
, ß1, ß2, and
, the novel PKC
,
,
,
and the atypical PKC
/
and
isoforms. Only the first two groups are responsive to phorbol ester stimulation (18). Among the phorbol esterresponsive PKC isoforms, fibroblasts express PKC
and PKC
, which belong to the classical (calcium-dependent) and the novel (calcium-independent) subfamilies, respectively. To determine which PKC isoform(s) mediate PMA stimulation of GLI signaling, we treated LIGHT2 cells with 0.1 µmol/L PMA for 6 hours in the presence of various concentrations of Gö6976 (inhibitor of classical PKCs) or rottlerin (inhibitor of novel PKCs). Stimulation of GLI-dependent transcription by PMA was prevented by rottlerin, indicating that its effect is mediated through a novel PKC, likely PKC
(Fig. 2A). Furthermore, transient transfection of a dominant-negative mutant of PKC
blocked the GLI-luciferase activity induced by PMA (Fig. 2B). Together, these results indicate that PMA activates GLI transcriptional activity through the novel PKC, PKC
.
|
. Having established that PMA activates GLI transcriptional activity through a PKC
-dependent mechanism, we next investigated whether signaling elicited by SHH at the membrane also requires the activity of PKC
. Induction of luciferase activity by SHH was insensitive to coincubation with Gö6976, but was completely prevented by rottlerin (Fig. 3A). We also evaluated the potency of these PKC familyspecific inhibitors to block the induction of PTCH-1 after 24 hours of N-SHH stimulation. Rottlerin, but not Gö6976, prevented PTCH-1 up-regulation by N-SHH to an extent comparable to inhibition of SMO by cyclopamine (Fig. 3A). Notably, however, SHH did not induce translocation to the plasma membrane of GFP-PKC
nor GFP-PKC
fusion proteins, as assessed by live fluorescence microscopy, whereas PMA promoted a strong and sustained translocation (data not shown). Therefore, these findings indicate that PKC
is not a downstream target of SHH signaling, but suggest that basal PKC
activity is essential for SHH signaling. In support of this possibility, down-regulation of PKCs after prolonged treatment with low doses of PMA totally impairs the responsiveness of the cells to SHH (Fig. 3B).
|
-mediated GLI activation, to control normal SHH signal transduction.
|
10-fold over the additive effect of GLI1 and MEK-1 alone; Fig. 5C). To control for nonspecific effects of activated MEK-1 on the TK-Renilla luciferase reporter, we normalized the GLI-luciferase activity to the activity two additional control reporters: SV40-Renilla and CMV-LacZ, with identical results (data not shown). Importantly, the inductive effect of activated MEK-1 was completely blocked by coincubation with the MEK-1 inhibitor, PD98059 (Fig. 5C), further supporting the conclusion that MEK-1 positively controls GLI activity. In order to map the GLI domain that senses the status of the ERK pathway, we compared the ability of activated MEK-1 to stimulate GLI-dependent luciferase in the presence of full-length GLI-1 protein or of a NH2-terminal deletion mutant of GLI1 (
N1GLI1; ref. 20), which retains its zinc fingers and is fully transcriptionally active (Fig. 5B). Activated MEK-1 is significantly less active on
N1GLI1 than on full-length GLI1 (Fig. 5C), indicating that the NH2-terminal domain of GLI1 is the target for MEK-1 signaling, perhaps through ERK activation. Significantly, coincubation with bFGF also stimulates GLI1-luciferase activity in a MEK-1-dependent manner because its effect is abolished by PD98059; whereas the
N1GLI1 mutant is insensitive to bFGF stimulation (Fig. 5D), further supporting the conclusion that the NH2 terminus of GLI1 acts as a sensor of the activation status of the ERK pathway.
|
| Discussion |
|---|
|
|
|---|
, subject to inhibition by rottlerin and by dnPKC
, but not by Gö6976. In agreement, mutationally activated PKC
was found to stimulate GLI transcriptional activity in 293T cells through an unknown mechanism, whereas PKC
was inhibitory (23).
Remarkably, we found that PMA induces full and specific activation of endogenous GLI function compared with N-SHH stimulation and could significantly potentiate the activity of overexpressed GLI1 and GLI2, indicating that PKC
function is rate-limiting for GLI function in 3T3 cells. The requirement for PKC
can be cell typedependent, raising the possibility that other novel PKC isoforms, like PKC
, might fulfill its role in some cell types. Perhaps the property of PKC
to localize to both nuclear and plasma membranes, in contrast with the preferential plasma membrane targeting of PKC
, is related to its role in GLI activation. Surprisingly, prolonged treatment of cells with PMA, which depletes the cells of phorbol esterresponsive PKCs, renders them unresponsive to SHH signaling. It is important to note that we did not detect any activation of PKC
or the ERK pathway by SHH, indicating that HH signaling requires basal activity of PKC
and MEK-1. Furthermore, we show that MEK-1 control of GLI1 transcriptional activity is mediated through the GLI1 NH2-terminal domain, which acts as a positive sensor of ERK signaling by mechanisms that remain to be defined. In this regard, in vitro phosphorylation experiments showed that GLI1 is not phosphorylated by ERK-2 (results not shown), suggesting that the NH2 terminus of GLI1 is a target for another kinase downstream of ERK.
Despite their apparently divergent signaling mechanisms, there is evidence of intracellular crosstalk between HH and ERK signaling pathways. For example, the GLI proteins seem to be able to integrate SHH and fibroblast growth factor (FGF) signaling in anterior-posterior patterning during embryonic development by mediating FGF signals to control posterior fates (24). Our findings complement those of Kessaris et al., that specification of oligodendrocyte progenitor cells by SHH is dependent on a basal ERK pathway activation. In their study, induction of OLIG-2 in neocortical precursors by SHH, but requires the constitutive activity of the FGFR to activate the ERK pathway in a cell-autonomous fashion because SHH signaling does not activate the ERK pathway by itself in these cells. One explanation is that the OLIG-2 promoter is controlled by input from two independent, convergent pathways, SHH and ERK. Another possibility is that a general property of GLI function is regulated by ERK. We provide evidence that the requirement for ERK signaling in the SHH pathway is integrated at the level of the GLI transcription factors. Moreover, it is notable that bFGF signaling through ERK synergizes with SHH to promote GLI transcriptional activity through the MEK-1 responsive GLI NH2-terminal domain, providing additional evidence for functional synergy between HH and FGF signaling through the ERK pathway.
Recently, it has been found that SMO is phosphorylated by G protein-coupled receptor kinase-2 upon activation to recruit ß-arrestin 2, leading to internalization of the signaling complex (25). ß-Arrestin 2 is a scaffold molecule that brings MEK and ERK, among others, in close proximity (26). Similar complexes of ß-arrestin 2 with other G protein coupled receptors are known to activate ERK at the endosome membranes, to drive different signaling outcomes than occur when ERK is activated in the cytosol (27). This raises the possibility that SHH signaling through SMO results in localized activation of MEK/ERK in specific subcellular domains undetectable by Western blot analysis of cell extracts. At this point, our findings do not distinguish whether regulation is mediated by subcellular localization regulation of the MEK/ERK signaling complex or by a simpler requirement of SMO function for basal PKC/MEK activity.
Activation of the ERK pathway, as a consequence of SHH-induced gene expression, occurs frequently in human BCC. In SHH-responsive C3H10T1/2 cells, as well as in cultured BCC, SHH signaling activates the Ras-ERK pathway via PDGFR
up-regulation (12). In the course of our study, we found that GLI1 overexpression causes a 7-fold increase in Elk-1 activity (data not shown), one of the numerous transcription factors that respond to the ERK. However, Elk-1 activity was totally dependent on MEK-1. Although beyond the scope of this study, one possibility is that GLI1 transcriptionally induces an autocrine factor, or receptor, that in turn activates the ERK pathway, like PDGFR
in BCC (12). Our results provide a new understanding of the complex crosstalk between the HH pathway and the PKC/ERK pathways activated by mitogenic factors (Fig. 6), by establishing that SHH signaling can be modulated by PKC
/ERK in addition to the better known regulation of the ERK pathway, through PDGFR
induction, as a consequence of GLI hyperactivation (12).
|
/ERK activity will likely play a major role in driving unregulated proliferation in tumors that are dependent on HH signaling, and suggests that these tumors will respond to specific PKC and MEK inhibitors to block HH-mediated cell growth. | Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| Footnotes |
|---|
Received 8/ 2/05. Revised 10/18/05. Accepted 10/26/05.
| References |
|---|
|
|
|---|
in basal cell carcinoma proliferation. Proc Natl Acad Sci U S A 2001;98:92559.
induces Fas expression and apoptosis in hedgehog pathway activated BCC cells through inhibiting Ras-Erk signaling. Oncogene 2004;23:160817.[CrossRef][Medline]
expression may enhance the tumorigenic potential of Gli1 in basal cell carcinoma. Cancer Res 2003;63:46927.This article has been cited by other articles:
![]() |
D F Calvisi, F Pinna, S Ladu, R Pellegrino, M M Simile, M Frau, M R De Miglio, M L Tomasi, V Sanna, M R Muroni, et al. Forkhead box M1B is a determinant of rat susceptibility to hepatocarcinogenesis and sustains ERK activity in human HCC Gut, May 1, 2009; 58(5): 679 - 687. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Cai, J. Li, T. Gao, J. Xie, and B. M. Evers Protein Kinase C{delta} Negatively Regulates Hedgehog Signaling by Inhibition of Gli1 Activity J. Biol. Chem., January 23, 2009; 284(4): 2150 - 2158. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kasai, S. Inaguma, A. Yoneyama, K. Yoshikawa, and H. Ikeda SCL/TAL1 Interrupting Locus Derepresses GLI1 from the Negative Control of Suppressor-of-Fused in Pancreatic Cancer Cell Cancer Res., October 1, 2008; 68(19): 7723 - 7729. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Ninkovic, C. Stigloher, C. Lillesaar, and L. Bally-Cuif Gsk3{beta}/PKA and Gli1 regulate the maintenance of neural progenitors at the midbrain-hindbrain boundary in concert with E(Spl) factor activity Development, September 15, 2008; 135(18): 3137 - 3148. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Varjosalo and J. Taipale Hedgehog: functions and mechanisms Genes & Dev., September 15, 2008; 22(18): 2454 - 2472. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Eichberger, A. Kaser, C. Pixner, C. Schmid, S. Klingler, M. Winklmayr, C. Hauser-Kronberger, F. Aberger, and A.-M. Frischauf GLI2-specific Transcriptional Activation of the Bone Morphogenetic Protein/Activin Antagonist Follistatin in Human Epidermal Cells J. Biol. Chem., May 2, 2008; 283(18): 12426 - 12437. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. W. Neill, W. J. Harrison, M. S. Ikram, T. D.L. Williams, L. S. Bianchi, S. K. Nadendla, J. L. Green, L. Ghali, A.-M. Frischauf, E. A. O'Toole, et al. GLI1 repression of ERK activity correlates with colony formation and impaired migration in human epidermal keratinocytes Carcinogenesis, April 1, 2008; 29(4): 738 - 746. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Heo, M. Y. Lee, and H. J. Han Sonic Hedgehog Stimulates Mouse Embryonic Stem Cell Proliferation by Cooperation of Ca2+/Protein Kinase C and Epidermal Growth Factor Receptor As Well as Gli1 Activation Stem Cells, December 1, 2007; 25(12): 3069 - 3080. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Ji, F. C. Mei, J. Xie, and X. Cheng Oncogenic KRAS Activates Hedgehog Signaling Pathway in Pancreatic Cancer Cells J. Biol. Chem., May 11, 2007; 282(19): 14048 - 14055. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Stecca, C. Mas, V. Clement, M. Zbinden, R. Correa, V. Piguet, F. Beermann, and A. Ruiz i Altaba Melanomas require HEDGEHOG-GLI signaling regulated by interactions between GLI1 and the RAS-MEK/AKT pathways PNAS, April 3, 2007; 104(14): 5895 - 5900. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Dwyer, N. Sever, M. Carlson, S. F. Nelson, P. A. Beachy, and F. Parhami Oxysterols Are Novel Activators of the Hedgehog Signaling Pathway in Pluripotent Mesenchymal Cells J. Biol. Chem., March 23, 2007; 282(12): 8959 - 8968. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. A. Riobo, B. Saucy, C. DiLizio, and D. R. Manning Activation of heterotrimeric G proteins by Smoothened PNAS, August 15, 2006; 103(33): 12607 - 12612. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kasper, H. Schnidar, G. W. Neill, M. Hanneder, S. Klingler, L. Blaas, C. Schmid, C. Hauser-Kronberger, G. Regl, M. P. Philpott, et al. Selective Modulation of Hedgehog/GLI Target Gene Expression by Epidermal Growth Factor Signaling in Human Keratinocytes. Mol. Cell. Biol., August 1, 2006; 26(16): 6283 - 6298. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |