Cancer Research Annual Meeting 2010  EMT and Cancer Progression and Treatment
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Riobo, N. A.
Right arrow Articles by Emerson, C. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Riobo, N. A.
Right arrow Articles by Emerson, C. P., Jr.
[Cancer Research 66, 839-845, January 15, 2006]
© 2006 American Association for Cancer Research


Cell, Tumor, and Stem Cell Biology

Protein Kinase C-{delta} and Mitogen-Activated Protein/Extracellular Signal–Regulated Kinase-1 Control GLI Activation in Hedgehog Signaling

Natalia A. Riobo1, Gwendolyn M. Haines1 and Charles P. Emerson, Jr.2

1 Department of Cell and Developmental Biology, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania and 2 Boston Biomedical Research Institute, Watertown, Massachusetts

Requests for reprints: Charles P. Emerson, Jr., Boston Biomedical Research Institute, 64 Grove Street, Watertown, MA 02472. E-mail: emersonc{at}bbri.org.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
One third of all lethal cancers are associated with excessive activation of the Hedgehog (HH) pathway by mutations of its signaling components or by increased responsiveness of cells to the HH ligand. HH signaling through the GLI transcription factors leads to increased cell proliferation by up-regulation of the extracellular regulated kinase (ERK) pathway and by expression of S phase cyclins. In this study, we have tested the hypothesis that the HH pathway can integrate ERK signaling to modulate the activity of GLI. Using NIH 3T3 cells, we show that phorbol esters, acting through protein kinase C-{delta} (PKC{delta}) and mitogen-activated protein/extracellular signal–regulated kinase-1 (MEK-1), fully stimulate the transcriptional activity of endogenous and overexpressed GLI proteins, as assessed by GLI-luciferase reporter assays, and induce the expression of endogenous GLI1 and PTCH-1 target genes, as assessed by reverse transcription-PCR. Moreover, activation of GLI elicited by Sonic Hedgehog also requires PKC{delta} and MEK-1 function. Remarkably, coexpression of activated MEK-1 and GLI1 or GLI2 induced a 10-fold synergistic increase in GLI-luciferase activity that was totally blocked by PD98059. The NH2-terminal region of GLI1 (amino acids 1-130) is required for sensing the ERK pathway, as deletion of this domain produces active GLI1 protein with greatly reduced response to activation by MEK-1. Basic fibroblast growth factor activation of the ERK pathway also stimulated GLI1 activity through its NH2-terminal domain. Our results identify PKC{delta} and MEK-1 as essential, positive regulators of GLI-mediated HH signaling. Furthermore, our findings suggest that tumors with deregulated HH and ERK synergize to stimulate cell proliferation pathways. (Cancer Res 2006; 66(2): 839-45)


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Hedgehog signaling has an essential role in the control of stem cell growth in embryonic and adult tissues and in the promotion of tumor growth in a diversity of malignancies (1). The mammalian hedgehog ligands, Sonic Hedgehog (SHH), Indian Hedgehog (IHH), and Desert Hedgehog (DHH, testis-specific) activate signaling in HH-responsive cells by binding to their receptor Patched (PTCH1 and 2) to relieve PTCH repression of the seven transmembrane protein Smoothened (SMO). Upon activation, SMO promotes the nuclear translocation of GLI (GLI1, 2, and 3), the transcription factor effectors of HH signaling (2). Excessive activation of the HH pathway has been observed in a vast majority of human and murine cancers, and inhibition of the pathway with a ligand-blocking antibody or with a SMO inhibitor, cyclopamine, has been proven to stop tumor growth and even regress tumor size (38). The presence of SHH or IHH ligands are required for continuous growth of small cell lung carcinoma (SCLC), pancreatic, stomach, biliary tract, and prostate carcinomas, all originating from endodermal stem cells. In a different way, mutations of components of the HH pathway such as loss of function of PTCH (in familial Gorlin's syndrome and in sporadic cancers), activating mutations of SMO, loss of function of Suppressor of Fused [SU(FU)] and GLI amplification are causative of a different set of malignancies, including medulloblastomas, gliomas, rhabdomyosarcomas, and basal cell carcinomas (BCC; refs. 911). Independent of how HH signaling is activated, all HH-dependent tumors display increased expression of the HH target gene GLI1.

Despite the central role of HH signaling in tissue development, repair, and cancer, the mechanisms of SMO signaling for GLI transcription factor activation are not well understood. Also, the molecular and cellular mechanisms for HH regulation of cell proliferation are unknown. The canonical HH pathway does not share common targets with mitogenic signaling pathways, with the exception of the recently described role of phosphoinositide-3-kinase and Akt in Gli activation.3 Conversely, it has been proposed that the proliferative effects of SHH in the ASZ001 BCC cell line are indirectly mediated through the synthesis of a secondary mitogen—identified as platelet-derived growth factor receptor {alpha} (PDGFR{alpha})—and activation of the ERK pathway (12). Indeed, induction of apoptosis in BCCs have been reported through a mechanism that blocks the Ras/ERK pathway (13), suggesting that overactivation of the HH pathway is not sufficient to drive tumoral fate. Activated ERK pathway is also required during embryonic development for SHH-induced differentiation of neocortical precursor cells into oligodendrocyte progenitors (14).

In the SHH/IHH ligand-dependent subset of cancers, protein kinase C (PKC) as an activator of the ERK pathway has a positive role in normal and tumor cell growth, and in the prevention of apoptosis. Some lines of SCLC, for instance, express oxytocin, vasopressin, and their receptors, and this autocrine loop stimulates proliferation in a calcium-, PKC-, and ERK-dependent manner (15). The effects of other mitogenic hormones, like GHRH and bombesin, are also blocked by PKC inhibitors (16). These evidences raise the possibility that PKC and SHH act cooperatively to promote tumorigenesis.

These observations lead us to investigate the regulatory interactions between HH and ERK pathways in the HH-responsive NIH 3T3 cell line. As PKC is a well-characterized activator of the ERK pathway, we investigated the role of PKC in GLI-mediated transcription. Here, we report that phorbol esters, acting through PKC{delta} and the ERK pathway, can stimulate GLI transcriptional activity in the absence of HH ligand, and that mitogen-activated protein/extracellular signal–regulated kinase-1 (MEK-1) is an obligatory downstream effector of PKC signaling that strongly synergizes with SHH to activate GLI. In addition, we show that SHH signaling is blocked by the disruption of PKC{delta} function, either by pharmacologic inhibitors or by dominant-negative PKC{delta}, and by inhibition of MEK-1, establishing a role for the PKC-MEK cascade in initiation and/or amplification of GLI-mediated HH signaling.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Reagents. PKC inhibitors (GF109203X, Gö6976, rottlerin), basic fibroblast growth factor (bFGF), and the MEK inhibitors, PD98059 and U0126, were purchased from Calbiochem (San Diego, CA). KAAD-cyclopamine was obtained from TRC (Canada). Phorbol 12-myristate 13-acetate (PMA) was purchased from Sigma (St. Louis, MO). Cell culture reagents and media were from Life Technologies-BRL (Grand Island, NY). Mouse anti-PKC{alpha} and anti-PKC{delta} were from Cell Signaling (Beverly, MA) and horseradish peroxidase–conjugated antimouse and antirabbit antibodies (1:4,000) were from Jackson Immunolabs (West Grove, PA).

Cell culture and transfection. NIH 3T3 mouse embryonic fibroblasts were purchased from the American Type Culture Collection (Manassas, VA) and a derived line, LIGHT2, was obtained from Dr. Phil Beachy (Johns Hopkins University, Baltimore, MD). Cells (passages 2-15) were cultured in DMEM supplemented with 10% FBS and penicillin (100 units/mL)-streptomycin (100 µg/mL) at 37°C in a humidified 5% CO2 atmosphere. For experiments with PMA or N-SHH stimulation, LIGHT2 cells were plated at high density and stimulated when they reached 100% confluency with 0.1 µmol/L PMA or 5 µg/mL N-SHH, unless otherwise indicated. Inhibitors were added 30 minutes prior to addition of PMA or N-SHH. For transfections, NIH 3T3 cells were seeded in 12-well plates at 70% confluence and transfected with different vectors (1-2 µg) using FuGENE 6 transfection reagent (Roche Applied Science, Indianapolis, IN) according to the manufacturer's protocol. After reaching 100% confluency, the medium was changed to 0.5% FBS DMEM for 24 hours. Luciferase (firefly) and Renilla luciferase activities were determined in lysates of LIGHT2 or transfected NIH 3T3 cells with the Dual Luciferase Reporter Assay System (Promega, Madison, WI) following the manufacturer's directions and expressed as relative luciferase units (RLU): [(luciferase / Renilla)sample – (luciferase / Renilla)baseline], where baseline is the value of vehicle-stimulated control cells or cells transfected with pcDNA3.1+, depending on the experiment.

Plasmid constructs. Full-length mGLI1 and mGLI2 expression constructs and the reporter vectors 8xGBSwt-luc and 8xGBSmut-luc were provided by Dr. H. Sasaki. {Delta}N1GLI1 was generated by restriction with KpnI and religation of the construct, and the resulting deletion mutant was sequence-verified. The dnPKC{delta} plasmid was a generous gift from Dr. Qiming Wang (University of Pittsburgh, Pittsburgh, PA). The mutationally activated MEK1 (S218E, S222E, {Delta}32-51) was from the PathDetect system (Stratagene, La Jolla, CA). pRL-TK, pSV-TK and pCMV-ßGal were obtained from Promega.

Generation and purification of recombinant N-SHH. Mouse N-SHH cDNA (nucleotides 72-593) was cloned by PCR amplification using complementary primers containing an Eam1104 site followed by two additional Ile codons in the 5' primer, and a stop codon followed by a HindIII site in the 3' primer. The PCR product was cloned into pcDNA3.1-TOPO, and the Eam1104-BamHI fragment was excised and subcloned into pCAL-n-EK (Stratagene) to generate the fusion pCBP-SHH. Expression of the fusion protein in BL21(DE3)-Gold cells (Stratagene) was induced with isopropyl-L-thio-ß-D-galactopyranoside (1 mmol/L, 3 hours). The CBP-SHH fusion protein was purified from the supernatant of the cell lysate with a calmodulin affinity resin as directed by the manufacturer. The CBP partner was excised with enterokinase (10 units/mg protein, 24 hours). After separation of enterokinase with STI-agarose, purified N-SHH was concentrated and stored at –80°C in 20% glycerol.

Semiquantitative reverse transcription-PCR. Total RNA was isolated from treated LIGHT2 cells with the RNeasy kit (Qiagen, Valencia, CA) as directed. An aliquot of 2 µg was DNase-treated and then subjected to reverse transcription with SuperScript II (Invitrogen, Carlsbad, CA) using hexarandom primers. One twentieth of the final cDNA was used in each PCR reaction. GLI1 cDNA was amplified using GGACTTTCTGGTCTGCCCTTTTG (forward primer) and ATGGAGAGAGCCCGCTTCTTTG (reverse primer), Patched-1 was amplified with TCAAACTGGGTCTCGTCTGCC (forward primer) and ATGTCCACACCGATACTT TCCAATC (reverse primer) and ß-actin with commercial primers.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Phorbol esters activate GLI transcriptional activity. We tested the effects of the diacylglycerol analogue PMA on GLI transcriptional activation using LIGHT2 cells, a HH-responsive 3T3 cell line stably transfected with a GLI-regulated luciferase reporter under the control of eight tandem copies of the HNF3-ß GLI binding site (8XGBS-luciferase) and the constitutively expressed CMV-Renilla luciferase (17). N-Sonic Hedgehog (N-SHH) treatment of LIGHT2 cells for 24 hours stimulates GLI-dependent luciferase activity ~10- to 15-fold, which is inhibited by cyclopamine, a SMO inhibitor (17). In 6-hour acute treatments, PMA increased normalized GLI-luciferase activity in a dose-dependent manner (Fig. 1A), and GLI activity returned to baseline levels after 24 hours. Costimulation of LIGHT2 cells with 5 µg/mL N-SHH and PMA did not further increase the luciferase activity (Fig. 1A), indicating that PMA elicited the maximal activation of GLI transcription factor activity through a common pathway. PMA activation of GLI is mediated through PKC, as revealed by the finding that pan-PKC inhibitor GF109203X blocked PMA activity (PMA, 3.8 ± 0.5 versus PMA + GF109203X, 1.2 ± 0.3-fold luciferase; n = 3). We also examined the PMA-mediated induction of two endogenous GLI-regulated genes, PTCH-1 and GLI1. Reverse transcription-PCR (RT-PCR) assays show that PMA induces a dose-dependent increase in PTCH 1 and GLI1 mRNA levels, which is inhibited by GF109203X (Fig. 1B). To further test the specificity of GLI-dependent transcription by PMA, NIH 3T3 fibroblasts were transfected with a wild-type 8XGBS-luciferase reporter or a mutated 8XGBS luciferase reporter (8XGBSmut) harboring a point mutation that abolishes the binding of GLI, and the transfected cells were stimulated for 6 hours either with 0.1µmol/L PMA or with control vehicle. PMA stimulated luciferase activity under the control of wild-type, but not mutant, GBS (Fig. 1C), indicating that PMA activity is mediated through activation of GLI transcriptional activity. Moreover, 0.1 µmol/L PMA enhanced GLI-luciferase activity in NIH 3T3 cells overexpressing mGLI1 and mGLI2 under the control of a CMV promoter (Fig. 1D), without changing in the expression levels of GLI1 and GLI2, indicating that PKC activity is rate-limiting in the control of GLI activity.


Figure 1
View larger version (37K):
[in this window]
[in a new window]
 
Figure 1. PMA activates GLI transcription factors. A, dose-dependence activation of GLI-luciferase in LIGHT2 cells incubated for 6 hours with PMA in the presence or absence of 5 µmol/L N-SHH (n = 3). B, representative experiment of the expression of endogenous GLI target genes assessed by RT-PCR (20 cycles) in LIGHT2 cells treated with increasing doses of PMA, and the effect of simultaneous addition of the pan-PKC inhibitor GF109203X at 4 µmol/L. ß-Actin expression is shown as a loading control. C, GLI-luciferase activation by treatment with PMA for 6 hours in NIH 3T3 transfected with a wild-type GLI reporter (wt 8XGBS) or a mutated reporter that does not bind GLI (mut 8XGBS; n = 3). D, effect of 18-hour treatment with PMA or vehicle (EtOH) on the expression of myc-tagged GLI1 and GLI2 and on their transcriptional activities in transiently transfected NIH 3T3 cells (n = 4).

 
PKC{delta} mediates GLI activation by phorbol esters. PKC isoforms have been classified into three groups: the classical PKC{alpha}, ß1, ß2, and {gamma}, the novel PKC{delta}, {varepsilon}, {eta}, {theta} and the atypical PKC{lambda}/{iota} and {zeta} isoforms. Only the first two groups are responsive to phorbol ester stimulation (18). Among the phorbol ester–responsive PKC isoforms, fibroblasts express PKC{alpha} and PKC{delta}, which belong to the classical (calcium-dependent) and the novel (calcium-independent) subfamilies, respectively. To determine which PKC isoform(s) mediate PMA stimulation of GLI signaling, we treated LIGHT2 cells with 0.1 µmol/L PMA for 6 hours in the presence of various concentrations of Gö6976 (inhibitor of classical PKCs) or rottlerin (inhibitor of novel PKCs). Stimulation of GLI-dependent transcription by PMA was prevented by rottlerin, indicating that its effect is mediated through a novel PKC, likely PKC{delta} (Fig. 2A). Furthermore, transient transfection of a dominant-negative mutant of PKC{delta} blocked the GLI-luciferase activity induced by PMA (Fig. 2B). Together, these results indicate that PMA activates GLI transcriptional activity through the novel PKC, PKC{delta}.


Figure 2
View larger version (14K):
[in this window]
[in a new window]
 
Figure 2. PMA-activation of GLI is mediated by PKC{delta}. A, GLI-luciferase activity in LIGHT2 cells stimulated with 0.1 µmol/L PMA for 6 hours in the presence of increasing concentrations of the classical PKC inhibitor Gö6976 ({circ}) or the PKC{delta} inhibitor rottlerin (bullet). Results are expressed as a percentage of the activity in the absence of inhibitors, as the mean ± SE of three experiments. B, GLI-luciferase activity in NIH 3T3 cells transiently transfected with pcDNA3.1 (vector) or dnPKC{delta}, and stimulated for 6 hours with ethanol (EtOH) or 0.1 µmol/L PMA (n = 3).

 
Sonic Hedgehog signaling is dependent upon PKC{delta}. Having established that PMA activates GLI transcriptional activity through a PKC{delta}-dependent mechanism, we next investigated whether signaling elicited by SHH at the membrane also requires the activity of PKC{delta}. Induction of luciferase activity by SHH was insensitive to coincubation with Gö6976, but was completely prevented by rottlerin (Fig. 3A). We also evaluated the potency of these PKC family–specific inhibitors to block the induction of PTCH-1 after 24 hours of N-SHH stimulation. Rottlerin, but not Gö6976, prevented PTCH-1 up-regulation by N-SHH to an extent comparable to inhibition of SMO by cyclopamine (Fig. 3A). Notably, however, SHH did not induce translocation to the plasma membrane of GFP-PKC{delta} nor GFP-PKC{alpha} fusion proteins, as assessed by live fluorescence microscopy, whereas PMA promoted a strong and sustained translocation (data not shown). Therefore, these findings indicate that PKC{delta} is not a downstream target of SHH signaling, but suggest that basal PKC{delta} activity is essential for SHH signaling. In support of this possibility, down-regulation of PKCs after prolonged treatment with low doses of PMA totally impairs the responsiveness of the cells to SHH (Fig. 3B).


Figure 3
View larger version (31K):
[in this window]
[in a new window]
 
Figure 3. SHH signaling requires PKC{delta}. A, LIGHT2 cells were stimulated with 5 µg/mL N-SHH in low serum medium (see Materials and Methods for details) in the presence of control vehicle (DMSO), Gö6976, rottlerin, or cyclopamine at the indicated concentrations. After 24 hours, cells were lysed for determination of GLI-luciferase activity (top) or for determination of PTCH-1 and ß-actin expression by RT-PCR (bottom). B, GLI-luciferase response to stimulation with 5 µmol/L N-SHH for 24 hours, after overnight incubation with 100 nmol/L PMA (PMA) or vehicle (EtOH; top). Depletion of endogenous PKCs by overnight treatment of LIGHT2 cells with 100 nmol/L PMA leads to a significant decrease in PKC-{alpha} and PKC{delta}, as determined by Western blot of total cell homogenates with the indicated antibodies at 1:1,000 dilution (bottom).

 
PMA- and SHH-dependent GLI activation are mediated by MEK-1. We next investigated whether PKC activates GLI activity directly or indirectly through the ERK pathway. PMA-induced GLI-luciferase reporter activity at 3 hours was blocked by coincubation with the selective MEK-1 inhibitor PD98059 at 50 µmol/L or with the dual MEK-1/2 inhibitor U0126 at 10 µmol/L (Fig. 4A). These results place MEK-1 downstream of PKC in the activation of GLI. When cells were stimulated by SHH, a dose-dependent inhibition of MEK-1 or MEK-1/2 reduced induction of GLI-luciferase activity up to 75% (Fig. 4B). Accordingly, induction of PTCH-1 mRNA at 24 hours by N-SHH stimulation was reduced to nearly baseline levels (Fig. 4C). These results show that MEK-1 is an obligatory intermediate in PKC{delta}-mediated GLI activation, to control normal SHH signal transduction.


Figure 4
View larger version (17K):
[in this window]
[in a new window]
 
Figure 4. PMA and SHH activation of GLI requires active MEK-1. A, GLI-luciferase activity in LIGHT2 cell lysates stimulated for 6 hours with 100 nmol/L PMA alone or in combination with 30 µmol/L U0126 or 50 µmol/L PD98059. B, dose-dependent inhibition of GLI-luciferase activation stimulated by 5 µg/mL N-SHH at 24 hours by coincubation with the indicated MEK inhibitors. C, reduction of endogenous PTCH-1 expression after 24 hours of N-SHH stimulation by cotreatment with 30 µmol/L U0126 or 50 µmol/L PD98059. Results are representative of three experiments.

 
Activated MEK-1 stimulates GLI1 transcriptional activity. We next evaluated the requirement of MEK-1 for GLI transcription factors activity. PD98059 (50 µmol/L) administered during the last 18 hours of the transfection period reduces the transcriptional activities of overexpressed GLI1 and GLI2 in NIH 3T3 cells by 50% to 60% (Fig. 5A), indicating that MEK-1 controls SHH signaling at the level of GLI activity. In support of this conclusion, we found that coexpression of GLI1 and a constitutively active mutant of MEK-1 (19) in NIH 3T3 cells stimulated GLI1 transcriptional activity synergistically (~10-fold over the additive effect of GLI1 and MEK-1 alone; Fig. 5C). To control for nonspecific effects of activated MEK-1 on the TK-Renilla luciferase reporter, we normalized the GLI-luciferase activity to the activity two additional control reporters: SV40-Renilla and CMV-LacZ, with identical results (data not shown). Importantly, the inductive effect of activated MEK-1 was completely blocked by coincubation with the MEK-1 inhibitor, PD98059 (Fig. 5C), further supporting the conclusion that MEK-1 positively controls GLI activity. In order to map the GLI domain that senses the status of the ERK pathway, we compared the ability of activated MEK-1 to stimulate GLI-dependent luciferase in the presence of full-length GLI-1 protein or of a NH2-terminal deletion mutant of GLI1 ({Delta}N1GLI1; ref. 20), which retains its zinc fingers and is fully transcriptionally active (Fig. 5B). Activated MEK-1 is significantly less active on {Delta}N1GLI1 than on full-length GLI1 (Fig. 5C), indicating that the NH2-terminal domain of GLI1 is the target for MEK-1 signaling, perhaps through ERK activation. Significantly, coincubation with bFGF also stimulates GLI1-luciferase activity in a MEK-1-dependent manner because its effect is abolished by PD98059; whereas the {Delta}N1GLI1 mutant is insensitive to bFGF stimulation (Fig. 5D), further supporting the conclusion that the NH2 terminus of GLI1 acts as a sensor of the activation status of the ERK pathway.


Figure 5
View larger version (13K):
[in this window]
[in a new window]
 
Figure 5. A, NIH 3T3 cells were transiently transfected with pcDNA3.1 empty vector, GLI1 or GLI2, and 24 hours later were supplemented with control vehicle (DMSO) or 50 µmol/L PD98059 for 18 hours, after which GLI-luciferase activity was determined. B, schematic representation of full-length GLI1 and NH2-terminal deletion mutant. Black box, relative position of the zinc fingers required for DNA binding activity. C, NIH 3T3 cells were transfected with pcDNA3.1, GLI1 or {Delta}N1GLI1 alone (black columns) or in combination with constitutively active MEK-1 (gray columns). Twenty four hours after transfection, PD98059 (50 µmol/L) was added for an additional 18 hours (white columns), and GLI-luciferase was determined for seven independent experiments. D, NIH 3T3 cells were transfected with pcDNA3.1, GLI1 or {Delta}N1GLI1 and left for 48 hours (black columns) or supplemented after 24 hours with 10 ng/mL bFGF (gray columns) or bFGF plus 50 µmol/L PD98059 (white columns) for an additional 24 hours. GLI-luciferase activity was then determined as above.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Our data identify an essential positive regulatory role for the ERK signaling pathway in the control of GLI transcription factor function in SHH signaling, which can be stimulated by exogenous ligands (like bFGF), comparable to the negative modulation of GLI function by PKA signaling (21, 22). Phorbol ester stimulation of NIH 3T3 cells rapidly induces GLI transcriptional function on GLI-luciferase reporters and on endogenous PTCH-1 and GLI1, which are direct GLI target genes. PMA activity is exerted through PKC{delta}, subject to inhibition by rottlerin and by dnPKC{delta}, but not by Gö6976. In agreement, mutationally activated PKC{delta} was found to stimulate GLI transcriptional activity in 293T cells through an unknown mechanism, whereas PKC{alpha} was inhibitory (23).

Remarkably, we found that PMA induces full and specific activation of endogenous GLI function compared with N-SHH stimulation and could significantly potentiate the activity of overexpressed GLI1 and GLI2, indicating that PKC{delta} function is rate-limiting for GLI function in 3T3 cells. The requirement for PKC{delta} can be cell type–dependent, raising the possibility that other novel PKC isoforms, like PKC{varepsilon}, might fulfill its role in some cell types. Perhaps the property of PKC{delta} to localize to both nuclear and plasma membranes, in contrast with the preferential plasma membrane targeting of PKC{alpha}, is related to its role in GLI activation. Surprisingly, prolonged treatment of cells with PMA, which depletes the cells of phorbol ester–responsive PKCs, renders them unresponsive to SHH signaling. It is important to note that we did not detect any activation of PKC{delta} or the ERK pathway by SHH, indicating that HH signaling requires basal activity of PKC{delta} and MEK-1. Furthermore, we show that MEK-1 control of GLI1 transcriptional activity is mediated through the GLI1 NH2-terminal domain, which acts as a positive sensor of ERK signaling by mechanisms that remain to be defined. In this regard, in vitro phosphorylation experiments showed that GLI1 is not phosphorylated by ERK-2 (results not shown), suggesting that the NH2 terminus of GLI1 is a target for another kinase downstream of ERK.

Despite their apparently divergent signaling mechanisms, there is evidence of intracellular crosstalk between HH and ERK signaling pathways. For example, the GLI proteins seem to be able to integrate SHH and fibroblast growth factor (FGF) signaling in anterior-posterior patterning during embryonic development by mediating FGF signals to control posterior fates (24). Our findings complement those of Kessaris et al., that specification of oligodendrocyte progenitor cells by SHH is dependent on a basal ERK pathway activation. In their study, induction of OLIG-2 in neocortical precursors by SHH, but requires the constitutive activity of the FGFR to activate the ERK pathway in a cell-autonomous fashion because SHH signaling does not activate the ERK pathway by itself in these cells. One explanation is that the OLIG-2 promoter is controlled by input from two independent, convergent pathways, SHH and ERK. Another possibility is that a general property of GLI function is regulated by ERK. We provide evidence that the requirement for ERK signaling in the SHH pathway is integrated at the level of the GLI transcription factors. Moreover, it is notable that bFGF signaling through ERK synergizes with SHH to promote GLI transcriptional activity through the MEK-1 responsive GLI NH2-terminal domain, providing additional evidence for functional synergy between HH and FGF signaling through the ERK pathway.

Recently, it has been found that SMO is phosphorylated by G protein-coupled receptor kinase-2 upon activation to recruit ß-arrestin 2, leading to internalization of the signaling complex (25). ß-Arrestin 2 is a scaffold molecule that brings MEK and ERK, among others, in close proximity (26). Similar complexes of ß-arrestin 2 with other G protein coupled receptors are known to activate ERK at the endosome membranes, to drive different signaling outcomes than occur when ERK is activated in the cytosol (27). This raises the possibility that SHH signaling through SMO results in localized activation of MEK/ERK in specific subcellular domains undetectable by Western blot analysis of cell extracts. At this point, our findings do not distinguish whether regulation is mediated by subcellular localization regulation of the MEK/ERK signaling complex or by a simpler requirement of SMO function for basal PKC/MEK activity.

Activation of the ERK pathway, as a consequence of SHH-induced gene expression, occurs frequently in human BCC. In SHH-responsive C3H10T1/2 cells, as well as in cultured BCC, SHH signaling activates the Ras-ERK pathway via PDGFR{alpha} up-regulation (12). In the course of our study, we found that GLI1 overexpression causes a 7-fold increase in Elk-1 activity (data not shown), one of the numerous transcription factors that respond to the ERK. However, Elk-1 activity was totally dependent on MEK-1. Although beyond the scope of this study, one possibility is that GLI1 transcriptionally induces an autocrine factor, or receptor, that in turn activates the ERK pathway, like PDGFR{alpha} in BCC (12). Our results provide a new understanding of the complex crosstalk between the HH pathway and the PKC/ERK pathways activated by mitogenic factors (Fig. 6), by establishing that SHH signaling can be modulated by PKC{delta}/ERK in addition to the better known regulation of the ERK pathway, through PDGFR{alpha} induction, as a consequence of GLI hyperactivation (12).


Figure 6
View larger version (28K):
[in this window]
[in a new window]
 
Figure 6. Model for integration of the HH and ERK pathways. Activation of SMO leading to nuclear translocation of active GLI1 and GLI2 requires a basal PKC{delta} and MEK-1 activity, probably as a result of mitogenic factors, stimulation of G protein coupled receptors (GPCR) coupled to Gq and generation of diacylglycerol (DAG) to activate PKC{delta} and/or stimulation of receptor tyrosine kinases (RTK) by bFGF and other growth factors. The effect of MEK-1 is at the level of the NH2-terminal domain of GLI1, either directly or through ERK or another target protein (dotted arrows). The transcriptional targets of GLI contribute to the maintenance of both pathways (broken arrows) and promote proliferation.

 
The remarkable synergy between MEK-1 and GLI1 resulting in highly stimulated GLI activity above the already high activity of overexpressed GLI1 supports the notion that HH cancers are a multistage, polygenic disease of tumor development via a succession of genetic changes, each conferring some growth advantage, leading to the progressive conversion of normal human cells into cancer cells. Specifically, cancer stem cells that depend on HH could become oncogenic by mutational activation of the ERK pathway, which would reduce the requirement for HH ligand through its synergistic effect on GLI. The cooperative and necessary PKC{delta}/ERK activity will likely play a major role in driving unregulated proliferation in tumors that are dependent on HH signaling, and suggests that these tumors will respond to specific PKC and MEK inhibitors to block HH-mediated cell growth.


    Acknowledgments
 
Grant support: This work was supported by a research grant from the National Cancer Institute (C.P. Emerson).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    Footnotes
 
3 N.A. Riobo, K. Lu, X.B. Ai, G.M. Haines, C.P. Emerson, Jr. PI3 kinase and Akt are essential for Sonic Hedgehog signaling, submitted for publication. Back

Received 8/ 2/05. Revised 10/18/05. Accepted 10/26/05.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Beachy PA, Karhadkar SS, Berman DM. Tissue repair and stem cell renewal in carcinogenesis. Nature 2004;432:324–31.[CrossRef][Medline]
  2. Ingham PW, McMahon AP. Hedgehog signaling in animal development: paradigms and principles. Genes Dev 2001;15:3059–87.[Free Full Text]
  3. Sanchez P, Ruiz i Altaba A. In vivo inhibition of endogenous brain tumors through systemic interference of Hedgehog signaling in mice. Mech Dev 2005;122:223–30.[CrossRef][Medline]
  4. Karhadkar SS, Bova GS, Abdallah N, et al. Hedgehog signalling in prostate regeneration, neoplasia and metastasis. Nature 2004;431:707–12.[CrossRef][Medline]
  5. Watkins DN, Berman DM, Burkholder SG, Wang B, Beachy PA, Baylin SB. Hedgehog signalling within airway epithelial progenitors and in small-cell lung cancer. Nature 2003;422:313–7.[CrossRef][Medline]
  6. Berman DM, Karhadkar SS, Maitra A, et al. Widespread requirement for Hedgehog ligand stimulation in growth of digestive tract tumours. Nature 2003;425:846–51.[CrossRef][Medline]
  7. Berman DM, Karhadkar SS, Hallahan AR, et al. Medulloblastoma growth inhibition by hedgehog pathway blockade. Science 2002;297:1559–61.[Abstract/Free Full Text]
  8. Sanchez P, Hernandez AM, Stecca B, et al. Inhibition of prostate cancer proliferation by interference with Sonic Hedgehog-GLI1 signaling. Proc Natl Acad Sci U S A 2004;101:12561–6.[Abstract/Free Full Text]
  9. Hahn H, Wicking C, Zaphiropoulous PG, et al. Mutations of the human homolog of Drosophila patched in the nevoid basal cell carcinoma syndrome. Cell 1996;85:841–51.[CrossRef][Medline]
  10. Xie J, Murone M, Luoh SM, et al. Activating Smoothened mutations in sporadic basal-cell carcinoma. Nature 1998;391:90–2.[CrossRef][Medline]
  11. Taylor MD, Liu L, Raffel C, et al. Mutations in SUFU predispose to medulloblastoma. Nat Genet 2002;31:306–10.[CrossRef][Medline]
  12. Xie J, Aszterbaum M, Zhang X, et al. A role of PDGFR{alpha} in basal cell carcinoma proliferation. Proc Natl Acad Sci U S A 2001;98:9255–9.[Abstract/Free Full Text]
  13. Li C, Chi S, He N, et al. IFN{alpha} induces Fas expression and apoptosis in hedgehog pathway activated BCC cells through inhibiting Ras-Erk signaling. Oncogene 2004;23:1608–17.[CrossRef][Medline]
  14. Kessaris N, Jamen F, Rubin LL, Richardson WD. Cooperation between Sonic hedgehog and fibroblast growth factor/MAPK signalling pathways in neocortical precursors. Development 2004;131:1289–98.[Abstract/Free Full Text]
  15. Pequeux C, Breton C, Hendrick JC, et al. Oxytocin synthesis and oxytocin receptor expression by cell lines of human small cell carcinoma of the lung stimulate tumor growth through autocrine/paracrine signaling. Cancer Res 2002;62:4623–9.[Abstract/Free Full Text]
  16. Kanashiro CA, Schally AV, Zarandi M, Hammann BD, Varga JL. Suppression of growth of H-69 small cell lung carcinoma by antagonists of growth hormone releasing hormone and bombesin is associated with an inhibition of protein kinase C signaling. Intl J Cancer 2004;112:570–6.[CrossRef][Medline]
  17. Taipale J, Chen JK, Cooper MK, et al. Effects of oncogenic mutations in Smoothened and Patched can be reversed by cyclopamine. Nature 2000;406:1005–9.[CrossRef][Medline]
  18. Ron D, Kazanietz MG. New insights into the regulation of protein kinase C and novel phorbol ester receptors. FASEB J 1999;13:1658–76.[Abstract/Free Full Text]
  19. Jaaro H, Rubinfeld H, Hanoch T, Seger R. Nuclear translocation of mitogen-activated protein kinase kinase (MEK1) in response to mitogenic stimulation. Proc Natl Acad Sci U S A 1997;94:3742–7.[Abstract/Free Full Text]
  20. Sasaki H, Nishizaki Y, Hui C, Nakafuku M, Kondoh H. Regulation of Gli2 and Gli3 activities by an amino-terminal repression domain: implication of Gli2 and Gli3 as primary mediators of Shh signaling. Development 1999;126:3915–24.[Abstract]
  21. Wang G, Wang B, Jiang J. Protein kinase A antagonizes Hedgehog signaling by regulating both the activator and repressor forms of cubitus interruptus. Genes Dev 1999;13:2828–37.[Abstract/Free Full Text]
  22. Epstein DJ, Marti E, Scott MP, McMahon AP. Antagonizing cAMP-dependent protein kinase A in the dorsal CNS activates a conserved Sonic hedgehog signaling pathway. Development 1996;122:2885–94.[Abstract]
  23. Neill GW, Ghali LR, Green JL, Ikram MS, Philpott MP, Quinn AG. Loss of protein kinase C{alpha} expression may enhance the tumorigenic potential of Gli1 in basal cell carcinoma. Cancer Res 2003;63:4692–7.[Abstract/Free Full Text]
  24. Brewster R, Mullor JL, Ruiz i Altaba A. Gli2 functions in FGF signaling during antero-posterior patterning. Development 2000;127:4395–405.[Abstract]
  25. Chen W, Ren XR, Nelson CD, et al. Activity-dependent internalization of smoothened mediated by ß-arrestin 2 and GRK2. Science 2004;306:2257–60.[Abstract/Free Full Text]
  26. Lefkowitz RJ, Shenoy SK. Transduction of receptor signals by ß-arrestins. Science 2005;308:512–7.[Abstract/Free Full Text]
  27. Shenoy SK, Lefkowitz RJ. Receptor-specific ubiquitination of ß-arrestin directs assembly and targeting of seven-transmembrane receptor signalosomes. J Biol Chem 2005;280:15315–24.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Circ. Res.Home page
M.-A. Renault, J. Roncalli, J. Tongers, S. Misener, T. Thorne, K. Jujo, A. Ito, T. Clarke, C. Fung, M. Millay, et al.
The Hedgehog Transcription Factor Gli3 Modulates Angiogenesis
Circ. Res., October 9, 2009; 105(8): 818 - 826.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. M. Hyman, A. J. Firestone, V. M. Heine, Y. Zhao, C. A. Ocasio, K. Han, M. Sun, P. G. Rack, S. Sinha, J. J. Wu, et al.
Small-molecule inhibitors reveal multiple strategies for Hedgehog pathway blockade
PNAS, August 18, 2009; 106(33): 14132 - 14137.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
D F Calvisi, F Pinna, S Ladu, R Pellegrino, M M Simile, M Frau, M R De Miglio, M L Tomasi, V Sanna, M R Muroni, et al.
Forkhead box M1B is a determinant of rat susceptibility to hepatocarcinogenesis and sustains ERK activity in human HCC
Gut, May 1, 2009; 58(5): 679 - 687.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Q. Cai, J. Li, T. Gao, J. Xie, and B. M. Evers
Protein Kinase C{delta} Negatively Regulates Hedgehog Signaling by Inhibition of Gli1 Activity
J. Biol. Chem., January 23, 2009; 284(4): 2150 - 2158.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. Kasai, S. Inaguma, A. Yoneyama, K. Yoshikawa, and H. Ikeda
SCL/TAL1 Interrupting Locus Derepresses GLI1 from the Negative Control of Suppressor-of-Fused in Pancreatic Cancer Cell
Cancer Res., October 1, 2008; 68(19): 7723 - 7729.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
J. Ninkovic, C. Stigloher, C. Lillesaar, and L. Bally-Cuif
Gsk3{beta}/PKA and Gli1 regulate the maintenance of neural progenitors at the midbrain-hindbrain boundary in concert with E(Spl) factor activity
Development, September 15, 2008; 135(18): 3137 - 3148.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
M. Varjosalo and J. Taipale
Hedgehog: functions and mechanisms
Genes & Dev., September 15, 2008; 22(18): 2454 - 2472.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Eichberger, A. Kaser, C. Pixner, C. Schmid, S. Klingler, M. Winklmayr, C. Hauser-Kronberger, F. Aberger, and A.-M. Frischauf
GLI2-specific Transcriptional Activation of the Bone Morphogenetic Protein/Activin Antagonist Follistatin in Human Epidermal Cells
J. Biol. Chem., May 2, 2008; 283(18): 12426 - 12437.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
G. W. Neill, W. J. Harrison, M. S. Ikram, T. D.L. Williams, L. S. Bianchi, S. K. Nadendla, J. L. Green, L. Ghali, A.-M. Frischauf, E. A. O'Toole, et al.
GLI1 repression of ERK activity correlates with colony formation and impaired migration in human epidermal keratinocytes
Carcinogenesis, April 1, 2008; 29(4): 738 - 746.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Z. Ji, F. C. Mei, J. Xie, and X. Cheng
Oncogenic KRAS Activates Hedgehog Signaling Pathway in Pancreatic Cancer Cells
J. Biol. Chem., May 11, 2007; 282(19): 14048 - 14055.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
B. Stecca, C. Mas, V. Clement, M. Zbinden, R. Correa, V. Piguet, F. Beermann, and A. Ruiz i Altaba
Melanomas require HEDGEHOG-GLI signaling regulated by interactions between GLI1 and the RAS-MEK/AKT pathways
PNAS, April 3, 2007; 104(14): 5895 - 5900.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. R. Dwyer, N. Sever, M. Carlson, S. F. Nelson, P. A. Beachy, and F. Parhami
Oxysterols Are Novel Activators of the Hedgehog Signaling Pathway in Pluripotent Mesenchymal Cells
J. Biol. Chem., March 23, 2007; 282(12): 8959 - 8968.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
N. A. Riobo, B. Saucy, C. DiLizio, and D. R. Manning
Activation of heterotrimeric G proteins by Smoothened
PNAS, August 15, 2006; 103(33): 12607 - 12612.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. Kasper, H. Schnidar, G. W. Neill, M. Hanneder, S. Klingler, L. Blaas, C. Schmid, C. Hauser-Kronberger, G. Regl, M. P. Philpott, et al.
Selective Modulation of Hedgehog/GLI Target Gene Expression by Epidermal Growth Factor Signaling in Human Keratinocytes.
Mol. Cell. Biol., August 1, 2006; 26(16): 6283 - 6298.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Riobo, N. A.
Right arrow Articles by Emerson, C. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Riobo, N. A.
Right arrow Articles by Emerson, C. P., Jr.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online