| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Cell, Tumor, and Stem Cell Biology |
Departments of 1 Pathology and 2 Biochemistry and Molecular Biology, Keck School of Medicine, University of Southern California; 3 Department of Molecular and Medical Pharmacology, University of California Los Angeles, Los Angeles, California; and 4 Division of Human Biology, Fred Hutchinson Cancer Research Center, Seattle, Washington
Requests for reprints: Pradip Roy-Burman, Department of Pathology, Keck School of Medicine, University of Southern California, 2011 Zonal Avenue, Los Angeles, CA 90033. Phone: 323-442-1184; Fax: 323-442-3049; E-mail: royburma{at}usc.edu.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Although several studies have implicated osteopontin in prostate cancer progression and metastases, the functional significance of osteopontin expression by the prostate tumor cells is only scarcely elucidated. Chemotaxis and chemoinvasion analyses with PC-3 prostate cancer cells indicated a dose-dependent increase in PC-3 cell movement induced by osteopontin, whereas cell invasion was strictly dependent on 
vß3 integrin function (11). Osteopontin is also reported to enhance cell proliferation induced by the epidermal growth factor (EGF) in prostate cancer cells (12). In this report, we describe our studies of osteopontin expression in genetically engineered mouse models for prostatic disease, which included models displaying slow, temporal development of increasingly severe preneoplastic prostatic lesions (13, 14), and a model that progresses to primary invasive adenocarcinoma of the prostate with subsequent manifestation of metastases with defined kinetics (15, 16). We present evidence that osteopontin expression, detected in preneoplastic lesions, continues to increase in adenocarcinoma, and cancer cells exhibiting high osteopontin expression seem to be enriched in the metastatic deposits. We found that all human prostate cancer cell lines tested express osteopontin. Functional studies with manipulated overexpression of osteopontin in two prostate cancer cell lines (LNCaP and PC-3) reveal that osteopontin could lead to increased proliferation, invasion, and most remarkably, to the enhanced ability to intravasate blood vessels.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
(RXR) alleles (cRXR–/–) in the prostate (13). Littermates lacking the Fgf8b transgene or the Cre gene in the context of floxed alleles of RXR served as donors of the corresponding control tissues. The source of primary prostatic adenocarcinoma was the conditional Pten homozygous deletion (cPten–/–) mice (15). The whole prostates of two individual experimental and age-matched control animals were used without differentiating the prostatic lobes for the comparative RNA analysis of the adenocarcinoma. RNA from Fgf8b and cRXR–/– tissues were extracted using the Qiagen RNeasy Mini kit following the manufacturer's protocol, which included an on-column DNase I treatment for the removal of contaminating DNA (Qiagen, Valencia, CA). RNA from the cPten–/– tissues was extracted using TRIzol (Life Technologies, Rockville, MD). Microarray analysis. Comparison of gene expression profiles of the preneoplastic or neoplastic mouse prostate tissues with littermate controls was carried out as previously described (15). Each experiment was done in duplicate with reversal of the fluorescent label to account for dye effects.
Reverse transcription and semiquantitative PCR for osteopontin. RNA samples from prostate tissues and prostate cancer cell lines were reverse transcribed using ThermoScript Reverse Transcription-PCR (RT-PCR) System following manufacturer's protocol (Life Technologies, Buffalo, NY) as described (14). The primer sequences (forward and reverse), annealing temperature, and product size were as follows: for mouse osteopontin, TGAAAGTGACTGATTCTGGCA and GGACGATTGGAGTGAAAGTGT, 52°C, 375 bp; for human osteopontin, CATCTCAGAAGCAGAATCTCCTA and GGAAAGTTCCTGACTATCAATCA, 56°C, 617 bp. To determine the linear amplification range for each primer set, 1 µL of cDNA was amplified for 40 cycles for mouse osteopontin, 35 cycles for human osteopontin, and 30 cycles for ß-actin. Samples were removed every three cycles, and the optimum cycle number was determined as the approximate midpoint of the linear range of amplification. The semiquantitative PCR assays were carried out using the corresponding optimum cycle number.
Western blot analysis. The dorsolateral, ventral, and anterior prostatic lobes of Fgf8b or cPten–/– mice and age-matched controls were isolated and snap frozen. The tissues were ground in liquid nitrogen with previously autoclaved mortars and pestles. The pulverized tissues were dissolved in ice-cold buffer containing 10 mmol/L Tris-HCl (pH 7.4), 1 mmol/L EDTA, 1 mmol/L EGTA, 150 mmol/L NaCl, 0.5% NP40, and 1% Triton X-100. To prepare the cell culture conditioned medium, 80% to 90% confluent cells cultured in T-75 flask were washed with PBS, and 10-mL serum-free medium was added. After 24 hours, medium was collected into a 15-mL tube, centrifuged to remove the cell debris, and then concentrated by centrifuge at 7,000 rpm at 4°C for 30 minutes using a 20-mL Centrifugal Spin Concentrator (APOLLO, Continental Lab Products, San Diego, CA). Total tissue lysates or conditioned media were quantitated and fractionated by SDS-PAGE on a 10% gel and subjected to immunoblot analysis using a rabbit anti-mouse osteopontin antibody (Assay Designs, Ann Arbor, MI) in 5% bovine serum albumin. Detection for the Fgf8b set was achieved as described (17), whereas osteopontin expression in the cPten–/– set was detected with a fluorescein-conjugated secondary antibody and the Odyssey Infrared Imaging System (LI-COR Biotechnology, Lincoln, NE). To normalize sample loading, ß-actin (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) blot was done.
Immunohistochemistry. Prostate tissues were isolated and fixed in 10% buffered formalin. Following deparaffinization, the 5-µm tissue sections were rehydrated and subjected to antigen retrieval by microwaving in 0.01 mol/L sodium citrate (pH 6). Antigen unmasking was done 10 minutes for the osteopontin antibody, and 30 minutes for the androgen receptor antibody (PG-21; Upstate, Lake Placid, NY). Primary antibodies were incubated at 4°C overnight; primary antibodies were omitted on sections serving as negative control. The sections were treated with biotinylated secondary antibody and subsequent streptavidin-biotin-peroxidase. The signal was detected by 3,3'-diaminobenzidine as a chromogen substrate, and the tissues were counterstained with hematoxylin as described (13–15).
Construction of lentiviral vector. Human osteopontin cDNA was PCR amplified with primers containing XbaI and RsrII linkers and was inserted into the polycloning site of the transducing lentivirus vector pSIN-GFP (17, 18). Lentivirus production was achieved with the three-plasmid system. Using Superfect reagent, human 293T cells at about 80% confluency were transfected with 7.5 µg of the vesicular stomatitis virus Env-coding plasmid, pMD.G; 15 µg of the packaging plasmid, pCMV
8.91; and 15 µg of either the control vector pSIN-GFP or the transgene vector pSIN-GFP-osteopontin. The media containing the pseudotyped lentiviruses were harvested daily from the 3rd to 5th day after transfection.
Infection and cell sorting. Immortalized human prostate epithelial cell lines, LNCaP and PC-3, were cultured as previously described (18). At 80% confluency, the cells were inoculated with 1 mL of the conditioned medium containing lentiviruses in the presence of 5 µg/mL polybrene for 8 hours. The cells were sorted by flow cytometry based on green fluorescent protein (GFP) fluorescence 2 days after infection.
Proliferation assay. To evaluate cellular growth, 5 x 104 GFP vector or osteopontin-GFP transfected cells were plated in 60-mm dishes in triplicates and grown with full serum medium. The cells were counted every 2 days with the Coulter Counter (Beckman Coulter, Inc., Miami, FL). The medium was changed every 2 days.
Invasion assay. Matrigel invasion assays were done with transfected prostate cancer cells. The upper chamber of the 8.0-µm inserts with polyethylene terephthalate membrane was coated with Matrigel from BD Biosciences (Bedford, MA), and the lower chamber was filled with full serum medium. Following a 24-hour pretreatment in medium containing 0.5% serum in the presence or absence of 5 µg/mL osteopontin antibody (R&D Systems, Minneapolis, MN), the cells (105) were added to the upper chamber, correspondingly with or without 5 µg/mL osteopontin antibody, and incubated at 37°C for 24 hours. Invasion of the cells through the membrane was detected by staining with hematoxylin and counted as previously described (18, 19).
Intravasation assay. The intravasive potential of the transfected prostate cancer cells was assessed by a PCR-based assay (20). Longitudinally incubated in a rotating incubator, chicken embryos at 9 days of gestation were selected for introducing the artificial air sac and subsequently "dropping" the chorioallantoic membrane (21). Briefly, air was suctioned through a small puncture in the side of the egg to facilitate the detachment of the chorioallantoic membrane from the shell membrane. Avoiding major blood vessels, a 1-cm2 window was cut on the top surface, and the suspension of cancer cells was gently applied to the chorioallantoic membrane. Upon incubation at 37°C for 24, 48, and 72 hours, the lower chorioallantoic membrane was removed and snap frozen in liquid nitrogen. DNA was extracted using Puregene DNA extraction kit from Gentra Systems (Minneapolis, MN) following manufacturer's protocol. The samples were used in a subsequent nested PCR amplification for the GFP gene to confirm the presence of the cancer cells in the lower chorioallantoic membrane. The initial PCR products produced with GFP 1 primer set were diluted at a ratio of 1:50 and amplified with the second set (GFP 2) of primers. The experiments were repeated and confirmed with PCR amplification for Alu as previously described (20). The primer sequences, annealing temperatures, and product sizes were as follows: for GFP 1, CGACGTAAACGGCCACAAGT and GGTGCTCAGGTAGTGGTTGTCG, 62°C, 550 bp; for GFP 2, TACGGCAAGCTGACCCTGAA and TGATATAGACCTTGTGGCTGTTGTAGT, 62°C, 343 bp; and for Alu, ACGCCTGTAATCCCAGCACTT and TCGCCCAGGCTGGAGTGCA, 58°C, 224 bp.
Statistical analysis. All experiments were done in triplicates and repeated at least twice. Statistical comparisons were made using an unpaired, two-tailed t test.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
–/– mice (13, 22). Accordingly, prostate tissues from cRXR–/– mice were examined at 24 months of age, after the onset of HGPIN. Although not as remarkable of an increase as seen in the Fgf8b mice, there was also a noticeable elevation in osteopontin mRNA levels in the cRXR–/– ventral and lateral prostate relative to the age-matched controls. Recognizing that invasive adenocarcinoma of the prostate would have 100% penetrance in cPten–/– mice by 6 months of age, we used this age group for comparative microarray analysis (15). Compared with normal prostates, tumor-bearing prostates exhibited a 3.2-fold increase in osteopontin mRNA levels.
|
3- to 4-fold increase in the detection of one to two osteopontin protein bands at around 65 kDa in the dorsolateral and ventral prostate compared with their age-matched controls. In contrast, but consistent with microarray and RT-PCR analyses, there was no remarkable difference in osteopontin levels between control and experimental preneoplastic tissues from the anterior prostate. Similarly, prostatic lobes from the cPten–/– mice between 1.6 and 14 months of age were analyzed. As shown in Fig. 1B, the development of primary prostate tumors in the cPten–/– mice was associated with progressively increased expression of osteopontin protein over an age range of 3.0 to 11.0 months. From a 13-month-old animal, we also examined different lobes for osteopontin expression. The content of osteopontin in all the lobes was elevated in the cPten–/– mouse compared with the corresponding lobes of its age-matched control (Fig. 1C). The relative increase seemed to be at least 10-fold when the intensity of the protein bands detected at 65 to 70 kDa were compared with corresponding controls.
|
–/–, and cPten–/– mice, and primary adenocarcinoma and metastatic lesions in cPten–/– model. It was found that the osteopontin signal was mainly localized to the cytoplasm of prostatic epithelial cells similar to such immunostaining observed in lung cancer cells (24). Some reactivity was also detected in the inflammatory cells, consistent with the known expression of osteopontin in activated immune cells (3, 25). As illustrated by the representative immunostaining photomicrographs (Fig. 2) for which the H&E staining of the corresponding sections is included in the Supplementary Fig. S1A-D, osteopontin signal greater than the background level was generally associated with the development of prostatic lesions in all three transgenic mouse models. Variations in signal intensity were, however, noted among cells and lesions. The increased osteopontin signal in dysplastic epithelia of LGPIN lesions (Fig. 2A) of Fgf8b line became more prominent in HPGIN lesions (Fig. 2B). Clearly, in contrast to the adjacent normal prostatic epithelium, most dysplastic cells in the LGPIN or HGPIN lesions exhibited considerably stronger osteopontin staining. The findings were similar with these preneoplastic lesions of cRXR–/– mice.
|
–/– mice. An example of HGPIN is shown in Fig. 2C. The trend of increase in the intensity of osteopontin staining with further progression of the disease was noted in the primary adenocarcinoma. This is illustrated with a case of tumor characterized by local microinvasion (Fig. 2D). In addition, examination of metastatic deposits in the lung found elevated osteopontin expression relative to the primary prostatic lesions (Fig. 3). The prostatic origin of the metastasis was verified by staining for expression of the androgen receptor. Although there were some variations in osteopontin staining intensity among individual cells, the majority of the metastasized cancer cells displayed robust immunoreactivity that set them apart from the background.
|
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
–/– (13) preneoplastic disease, or the cPten–/– (15) neoplastic disease system, we found significant up-regulation of osteopontin RNA and protein levels in all, relative to the corresponding littermate controls. We attempted to localize the overexpression of osteopontin in the prostatic lesions by immunohistochemistry. The increased intensity of osteopontin staining readily visible in many of the dysplastic epithelial cells of LGPIN lesions seemed to become more prominent in HGPIN. Relative to these preneoplastic lesions of all three models, significantly higher staining was observed in the primary adenocarcinoma that developed in the cPten–/– model. When the metastatic lesions in the cPten–/– mice were examined, the intensity of staining seemed to be even higher. Together, the results imply that up-regulation of osteopontin expression in prostatic lesions is consistent in all three models and independent of how the models were generated. Although osteopontin is described to be a marker for the late stages of progression of various cancers (6, 7), our results which were not conflicting, do however, point to osteopontin dysregulation beginning at a much earlier time point (e.g., at LGPINs). With advancing time, osteopontin levels seem to continue increasing with progression from LGPIN to HGPIN to adenocarcinoma, and most remarkably, the cancer cells expressing the highest levels of osteopontin seem to be selected during metastatic progression. Our results indicate that osteopontin contributes to several steps in the process of prostate carcinogenesis and metastasis. Osteopontin seems to modulate cell proliferation and potentially the survival of the dysplastic and neoplastic prostatic cells, thus providing a selective advantage in early-stage lesions. The findings with manipulated overexpression in human prostate cancer cells as well as those of other published reports (11, 12) lend support to an autocrine effect of osteopontin overproduction on cell proliferation. This is shown with the LNCaP cells transduced with osteopontin expressing lentivirus vector. This effect was less pronounced on the PC-3 cells. PC-3 cells, however, are by nature, highly proliferative. We also used in vitro Matrigel invasion assay to assess the invasiveness of the cells. Although the control LNCaP cells were completely incapable of penetrating the membrane, there was a drastic enhancement in the invasive ability when osteopontin was overexpressed. A similar pattern, albeit relatively less pronounced, was produced by osteopontin overexpression in PC-3 cells in which, besides osteopontin, multiple other factors may be contributing to its naturally highly invasive character. The fact that osteopontin could be an important player is further shown by the ability of anti-osteopontin antibodies to significantly neutralize this biological response induced by osteopontin overexpression.
Considering that intravasation is an early required event for the multistep process leading to metastasis, we also checked a potential role of osteopontin in intravasation in vivo. A model system, first developed by Kim et al. (20) and based on blood vessel penetration of xenotransplanted mammalian cancer cells on the chicken embryo chorioallantoic membrane assay, was used. Consistent with published work (20), PC-3 cells but not LNCaP cells were determined to be capable of intravasation in the chorioallantoic membrane model using qualitative PCR-based assays. Importantly, analysis of osteopontin-transduced LNCaP cells revealed that overexpression of osteopontin alone was sufficient to induce the ability to intravasate. The change in invasive ability in vivo, potentiated by the excess osteopontin production, was less pronounced in PC-3 cells compared with LNCaP. In PC-3 cells, however, higher osteopontin expression seems to affect the kinetics of intravasation apparently by accelerating the rate at which the cells access the blood vessels, as evident from the reduced time required for detectable intravasation from 48 to 24 hours of inoculation. An important question at this point is how osteopontin might be involved in facilitating tumor cell invasion. Osteopontin binds with several integrins and CD44 variants in both RGD sequence-dependent and sequence-independent manner (3). The resulting signal transduction pathways that may be activated by osteopontin are complex by nature and only poorly understood. There is, however, some relevant emerging information in this regard. For example, it has been shown that osteopontin induces activator protein (AP-1) transactivation in breast cancer cells through vß3 integrin–mediated c-Src kinase activity and EGF receptor (EGFR) phosphorylation, c-Src kinase being required for osteopontin-induced EGFR phosphorylation (26). AP-1 is then linked to urokinase-type plasminogen activator (uPA) production and secretion that results in stimulation of cell motility and invasion. In other work, osteopontin has been shown to stimulate LNCaP proliferation in serum-free medium but only in the presence of EGF (12). The induced proliferation is accompanied by a sustained activation of EGFR. It is also noteworthy that previous studies using the chorioallantoic membrane model showed that breaching of the vascular wall by the cancer cells is a rate-limiting step for intravasation and that cooperation between uPA/uPA receptor (uPAR) and matrix metalloproteinases (MMP) is required to complete this step (20). Thus, crucial molecules, such as uPA, uPAR, and activated MMPs, await further studies in relation to osteopontin overexpression in prostatic cancer in the context of breaching native biological barriers preventing cancer cell metastasis.
|
Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Liliana Ossowski (Mount Sinai School of Medicine, New York, NY) and James P. Quigley and Elena Deryugina (The Scripps Research Institute, La Jolla, CA) for advice and assistance with the chorioallantoic membrane assay; Cheng-Ming Chuong and Randall Widelitz (Department of Pathology) for the use of their facility for the chorioallantoic membrane work; Marian Young (NIH) for the gift of human osteopontin cDNA; Simon Hayward (Vanderbilt University, Nashville, TN) for the BPH-1 cell line; Marc Guerra (LI-COR Biotechnology) for his assistance with the osteopontin Western blot; and all the members of the Roy-Burman laboratory for their assistance in various aspects of the work.
|
Footnotes |
|---|
A.C. Khodavirdi, Z. Song, and S. Yang contributed equally to this work.
Received 8/ 8/05. Revised 11/ 7/05. Accepted 11/10/05.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
allele in the prostate epithelium. Cancer Res 2002;62:4812–9., in prostate cancer. Cancer Biol Ther 2003;2:179–84.[Medline]This article has been cited by other articles:
|
|
 |
|
  A. Jain, D. A. McKnight, L. W. Fisher, E. B. Humphreys, L. A. Mangold, A. W. Partin, and N. S. Fedarko Small Integrin-Binding Proteins as Serum Markers for Prostate Cancer Detection Clin. Cancer Res., August 15, 2009; 15(16): 5199 - 5207. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Castellano, G. Malaponte, M. C. Mazzarino, M. Figini, F. Marchese, P. Gangemi, S. Travali, F. Stivala, S. Canevari, and M. Libra Activation of the Osteopontin/Matrix Metalloproteinase-9 Pathway Correlates with Prostate Cancer Progression Clin. Cancer Res., November 15, 2008; 14(22): 7470 - 7480. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. T. Caswell, M. Chan, A. J. Lindsay, M. W. McCaffrey, D. Boettiger, and J. C. Norman Rab-coupling protein coordinates recycling of {alpha}5{beta}1 integrin and EGFR1 to promote cell migration in 3D microenvironments J. Cell Biol., October 6, 2008; 183(1): 143 - 155. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Chu, C.-J. Cheng, X. Ye, Y.-C. Lee, A. J. Zurita, D.-T. Chen, L.-Y. Yu-Lee, S. Zhang, E. T. Yeh, M. C-T. Hu, et al. Cadherin-11 Promotes the Metastasis of Prostate Cancer Cells to Bone Mol. Cancer Res., August 1, 2008; 6(8): 1259 - 1267. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. J. Caruso, A. J.K. Carmack, V. B. Lokeshwar, R. C. Duncan, M. S. Soloway, and B. L. Lokeshwar Osteopontin and Interleukin-8 Expression is Independently Associated with Prostate Cancer Recurrence Clin. Cancer Res., July 1, 2008; 14(13): 4111 - 4118. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C.-P. Liao, C. Zhong, G. Saribekyan, J. Bading, R. Park, P. S. Conti, R. Moats, A. Berns, W. Shi, Z. Zhou, et al. Mouse Models of Prostate Adenocarcinoma with the Capacity to Monitor Spontaneous Carcinogenesis by Bioluminescence or Fluorescence Cancer Res., August 1, 2007; 67(15): 7525 - 7533. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Chen, X.-C. Ye, K. Chu, N. M. Navone, E. H. Sage, L.-Y. Yu-Lee, C. J. Logothetis, and S.-H. Lin A Secreted Isoform of ErbB3 Promotes Osteonectin Expression in Bone and Enhances the Invasiveness of Prostate Cancer Cells Cancer Res., July 15, 2007; 67(14): 6544 - 6548. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Y. T. Inoue, M. Neira, C. Nelson, M. Gleave, and R. Etzioni Cluster-based network model for time-course gene expression data Biostat., July 1, 2007; 8(3): 507 - 525. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-L. Lee, M.-J. Wang, P.-R. Sudhir, G.-D. Chen, C.-W. Chi, and J.-Y. Chen Osteopontin Promotes Integrin Activation through Outside-In and Inside-Out Mechanisms: OPN-CD44V Interaction Enhances Survival in Gastrointestinal Cancer Cells Cancer Res., March 1, 2007; 67(5): 2089 - 2097. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Zhou, A. Flesken-Nikitin, D. C. Corney, W. Wang, D. W. Goodrich, P. Roy-Burman, and A. Yu. Nikitin Synergy of p53 and Rb Deficiency in a Conditional Mouse Model for Metastatic Prostate Cancer Cancer Res., August 15, 2006; 66(16): 7889 - 7898. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Yang, M. Lim, L. K. Pham, S. E. Kendall, A. H. Reddi, D. C. Altieri, and P. Roy-Burman Bone Morphogenetic Protein 7 Protects Prostate Cancer Cells from Stress-Induced Apoptosis via Both Smad and c-Jun NH2-Terminal Kinase Pathways. Cancer Res., April 15, 2006; 66(8): 4285 - 4290. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
). Some inflammatory cells that stained positive for osteopontin were noted (*). B, anti-osteopontin immunostaining of a HGPIN lesion in the lateral prostatic lobe of an Fgf8b animal. The intensity of osteopontin signal in the dysplastic cells (arrows) is significantly higher than that of the normal cells (
