Cancer Research The Future of Cancer Research: Science and Patient Impact AACR Conference on Molecular Diagnostics - 2008
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
Cancer Research 66, 10024-10031, October 15, 2006. doi: 10.1158/0008-5472.CAN-06-0136
© 2006 American Association for Cancer Research
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cui, J.
Right arrow Articles by Wong, A. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cui, J.
Right arrow Articles by Wong, A. J.

Cell, Tumor, and Stem Cell Biology

c-Jun NH2-Terminal Kinase 2{alpha}2 Promotes the Tumorigenicity of Human Glioblastoma Cells

Jian Cui1, Shuang-Yin Han1, Congli Wang3, Wanwen Su3, Larry Harshyne3, Marina Holgado-Madruga1 and Albert J. Wong1,2

1 Department of Neurosurgery and 2 Cancer Biology Program, Stanford University Medical Center, Stanford, California; and 3 Kimmel Cancer Institute, Thomas Jefferson University, Philadelphia, Pennsylvania

Requests for reprints: Albert J. Wong, Department of Neurosurgery/Cancer Biology Program, Stanford University Medical Center, 300 Pasteur Drive, Edwards R221, Stanford, CA 94305-5327. Phone: 650-736-4220; Fax: 650-723-7813; E-mail: ajwong{at}stanford.edu.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
c-Jun NH2-terminal kinases (JNK) are members of the mitogen-activated protein kinase family and have been implicated in the formation of several human tumors, especially gliomas. We have previously shown that a 55 kDa JNK isoform is constitutively active in 86% of human brain tumors and then showed that it is specifically a JNK2 isoform and likely to be either JNK2{alpha}2 or JNK2ß2. Notably, we found that only JNK2 isoforms possess intrinsic autophosphorylation activity and that JNK2{alpha}2 has the strongest activity. In the present study, we have further explored the contribution of JNK2 isoforms to brain tumor formation. Analysis of mRNA expression by reverse transcription-PCR revealed that JNK2{alpha}2 is expressed in 91% (10 of 11) of glioblastoma tumors, whereas JNK2ß2 is found in only 27% (3 of 11) of tumors. Both JNK2{alpha}2 and JNK2ß2 mRNAs are expressed in normal brain (3 of 3). Using an antibody specific for JNK2{alpha} isoforms, we verified that JNK2{alpha}2 protein is expressed in 88.2% (15 of 17) of glioblastomas, but, interestingly, no JNK2{alpha}2 protein was found in six normal brain samples. To evaluate biological function, we transfected U87MG cells with green fluorescent protein–tagged versions of JNK1{alpha}1, JNK2{alpha}2, and JNK2{alpha}2APF (a dominant-negative mutant), and derived cell lines with stable expression. Each cell line was evaluated for various tumorigenic variables including cellular growth, soft agar colony formation, and tumor formation in athymic nude mice. In each assay, JNK2{alpha}2 was found to be the most effective in promoting that phenotype. To identify effectors specifically affected by JNK2{alpha}2, we analyzed gene expression. Gene profiling showed several genes whose expression was specifically up-regulated by JNK2{alpha}2 but down-regulated by JNK2{alpha}2APF, among which eukaryotic translation initiation factor 4E (eIF4E) shows the greatest change. Because AKT acts on eIF4E, we also examined AKT activation. Unexpectedly, we found that JNK2{alpha}2 could specifically activate AKT. Our data provides evidence that JNK2{alpha}2 is the major active JNK isoform and is involved in the promotion of proliferation and growth of human glioblastoma tumors through specific activation of AKT and overexpression of eIF4E. (Cancer Res 2006; 66(20): 10024-31)


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
The mitogen-activated protein kinase (MAPK) family constitutes one of the major signaling cascades from the cell surface to the nucleus. This family includes the extracellular signal-regulated kinase (ERK), c-Jun NH2-terminal kinases (JNK), and p38 signaling modules, and all of these components have been highly conserved throughout evolution. JNK, like all other MAPK members, requires phosphorylation on a serine/threonine-proline-tyrosine motif by an upstream kinase for activation. Once activated, JNK translocates to the nucleus where it, in turn, phosphorylates and activates transcription factors such as components of activator protein including c-Jun (1), JunB, and JunD, as well as other factors including ATF-2 (2) and STAT-3. Other cytoplasmic substrates of JNK have been found that are important in oncogenesis including c-myc (3), Bcl-2 (4), and p53 (5, 6). Ten major JNK isoforms created by alternative splicing from the three individual JNK genes have been cloned (7). The biological functions of these JNK isoforms have been intensely investigated and specific roles are now recognized for JNK isoforms in regulating cellular proliferation, apoptosis, differentiation, and development (8).

Although there are a limited number of JNK substrates, they mediate biologically pleiotropic activities that seem to be conflicting. For example, the genes encoding c-Jun and c-myc belong to the proto-oncogene family, whereas p53 is a tumor suppressor gene. A large number of studies have been published showing evidence that JNKs are important components in promoting apoptosis under normal physiologic conditions and in response to certain cytokines and environmental stimuli. However, more recent studies have indicated that JNKs play a significant role in promoting tumorigenesis.

It has been reported that Ras-induced transformation requires JNK-mediated phosphorylation of c-Jun (1, 9, 10), and that this transformation can be abrogated by mutation of the JNK phosphorylation sites on c-Jun (11). Furthermore, activation of c-Jun by JNK phosphorylation is required for transformation by other activated oncogenes such as c-fos, v-src, c-raf, v-sis, and Bcr-Ab1 (12–17). Transformation induced by Bcr-Abl is also accompanied by the activation of c-Jun-targeted genes resulting in increased drug resistance and rapid proliferation; these changes can be reversed by the expression of c-Jun-bearing mutations at Ser63 and Ser73 (17). Moreover, JNK can serve as an effector of phosphoinositide-3-kinase (PI3K), and in this context, promotes phenotypes related to transformation. For example, in the A549 lung carcinoma cell line, the JNK pathway is activated in a PI3K-dependent manner by the addition of epidermal growth factor and is important for cell proliferation (18). Similarly, we have found that transformation of NIH-3T3 cells induced by the expression of epidermal growth factor receptor variant type III can be reversed by the addition of a PI3K inhibitor, which in turn, inactivates the JNK pathway (19).

Although JNK1 and JNK2 have considerable homology at the amino acid level, and in some cases, have been shown to be functionally redundant, recent research has identified contexts in which JNK1 and JNK2 play distinct roles. JNK1 was found to preferentially mediate apoptosis (20–22), whereas JNK2 tends to contribute more to proliferation (23). Consistent with its role in proliferation, JNK2-deficient mice were observed to be resistant to the induction of skin papillomas, indicating that JNK2 plays a more critical role in tumor formation (24). Using antisense DNA to down-regulate expression, it was found that a decrease of JNK2 has a more profound inhibition on cell growth than a decrease of JNK1 in both the human T98G glioblastoma cell line and the PC3 prostate cancer cell line (18, 25).

Our observations have led us to focus on a role for JNK in promoting glial tumorigenesis. We first noted that 86% of primary glioblastoma tumors show activation of a 54 kDa form of JNK, whereas only 34% show activation of ERK, indicating that this MAPK member may be more relevant to tumor formation (26). A subsequent study from our laboratory not only provided evidence that the activated 54 kDa isoform is either JNK2{alpha}2 or JNK2ß2, but also showed that the JNK2 isoforms are unique among all MAPKs in that they possess autophosphorylation activity (27) and constitutive substrate kinase activity in vitro and in vivo. Most recently, we identified a specific region ranging from amino acids 218 to 226 in JNK2{alpha}2 that is required for its autophosphorylation in vivo and in vitro (28), and can confer autophosphorylation activity to non–constitutively active JNK isoforms. A similar region is also important for JNK2ß2 autophosphorylation, although JNK2{alpha}2 and JNK2ß2 do not share a common amino acid sequence at this region.4 Collectively, these data strongly support the notion that JNK function should be investigated at the isoform level instead of merely on the subtype level.

In this work, we have further pursued the relevance of a specific JNK isoform to human brain tumors. We have found that JNK2{alpha}2 is the major JNK isoform that is activated in human brain glioblastoma and provide further evidence that JNK2{alpha}2 promotes phenotypes associated with tumorigenesis through the promotion of proliferation and tumor formation. Moreover, we find that this isoform specifically interacts with two genes/proteins frequently implicated in oncogenesis. We find that JNK2{alpha}2 autoactivation leads to the activation of AKT and that it up-regulates the transcription and expression of eukaryotic translation initiation factor 4E (eIF4E).


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Tumor tissues and cell lines. Human primary brain tumors were obtained from the Thomas Jefferson University Hospital under Institutional Review Board–approved protocols. Human glioblastoma cell line U87MG (American Type Culture Collection, Manassas, VA) was cultured in DMEM supplemented with 10% FCS (heat-inactivated at 56°C for 30 minutes), 2 mmol/L of L-glutamine, and 100 units/mL of penicillin/streptomycin/kanamycin at 37°C in humidified air with 5% CO2. JNK1{alpha}1, JNK2{alpha}2, and JNK2{alpha}2APF (a mutant JNK2{alpha}2 bearing APF instead of TPY at amino acids 183-185) were cloned into pEGFPC1 (Clontech, Palo Alto, CA) or pET42a+ (Novagen, Madison, WI). U87MG cells were transfected by pEGFPC1-JNK1{alpha}1, pEGFPC1-JNK2{alpha}2, pEGFPC1-JNK2{alpha}2APF, or pEGFPC1 using the Effectene reagent (Qiagen, Valencia, CA). Stable transfectants expressing the green fluorescent protein (GFP)-JNKs were selected and maintained in the same base medium supplemented with 500 µg/mL of G418.

Reverse transcription-PCR. Total RNA from human brain tumors and normal brain tissues, as well as U87MG cells, were extracted using Trizol reagent (Promega, Madison, WI) according to the protocol recommended by the manufacturer. The concentration and purity of total RNA were estimated by the A260/A280 reading, and quality was assessed on agarose/formaldehyde gels. Primers for reverse transcription-PCR (RT-PCR) were designed specifically for either the JNK2{alpha}2 or JNK2ß2 mRNA. Their sequences were: JNK2{alpha}2 (forward), 5'CTGGTGAAAGGTTGTG TGATA3'; JNK2{alpha}2 (reverse), 5'GCAGAGCTTCGTCTACAGAGATC3'; JNK2ß2 (forward), 5' ATGGTCCTCCATAAAGTCCTGTT3'; JNK2ß2 (reverse), 5'GCAGAGCTTCGTCTACAGAGATC3'. Each reverse transcription mixture contained 1 µg of total RNA, deoxyribonucleotide triphosphates at 300 µmol/L each, 1 µL of superscript reverse transcriptase (Invitrogen, Carlsbad, CA), and 0.5 µg of oligo(dT) 12 to 18 in a total volume of 30 µL (Invitrogen). The mixture was first incubated at 50°C for 60 minutes to obtain cDNA. The PCR mixture, containing 100 pmol of each primer, deoxyribonucleotide triphosphates at 200 µmol/L each, 1.5 mmol/L of MgCl2, 2 units of Taq polymerase (Takara, Madison, WI), and 0.5 µg of cDNA templates were adjusted to 50 µL by adding double-distilled water. The mixture was then subjected to amplification for 40 cycles. Each cycle consisted of 95°C for 10 seconds, 55°C for 30 seconds, and 72°C for 2 minutes with a final extension at 72°C for 10 minutes.

Western blotting. Cells or frozen tumor tissues were lysed with cold PBS/TDS buffer (PBS with 1% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS, 1 mmol/L EDTA, 1 mmol/L phenylmethylsulfonyl fluoride, complete inhibitor cocktail; Roche Applied Science, Indianapolis, IN), and the total lysate was harvested, centrifuged, and used immediately or stored at –80°C. Glutathione S-transferase (GST) fusion proteins were expressed in Escherichia coli and purified using immobilized glutathione beads (Pierce, Rockford, IL) according to the manufacturer's protocols. Purified proteins were stored at –80°C. The quality and quantity of proteins was confirmed by SDS-PAGE and Coomassie blue staining. Equal amounts of proteins were loaded and run on 4% to 20% SDS-PAGE gel and transferred to nitrocellulose membranes. The membranes were blocked with Blotto for 1 hour and then incubated with primary antibody at 4°C overnight (for anti-phosphoantibodies) or room temperature for 1 hour. The membranes were washed thrice with Tris/Tween 20/buffered saline, 20 mmol/L of Tris-HCl (pH 7.5), 0.5 mol/L of NaCl, 0.1% Tween 20 and then incubated with the corresponding horseradish peroxidase–conjugated secondary antibody. The signal was detected using the ECL system (Amersham Biosciences, Piscataway, NJ).

Cell growth analysis. Stably transfected U87 cells were plated in six-well plates (1.0 x 104 cells/well) and cultured in DMEM supplemented with 1% fetal bovine serum (heat-inactivated at 56°C for 30 minutes), 2 mmol/L of L-glutamine, and 100 units/mL of penicillin/streptomycin/kanamycin. The number of live cells were counted daily by means of trypan blue exclusion assay. Results were expressed as mean ± SD.

Flow cytometry analysis. Cells were grown in serum-free DMEM for 48 hours to synchronize the cells and attained ~50% to 60% confluence. Cells were released by changing the medium to DMEM supplemented with 1% fetal bovine serum (heat-inactivated at 56°C for 30 minutes), 2 mmol/L of L-glutamine, and 100 units/mL of penicillin/streptomycin/kanamycin. The cells were then harvested immediately, 8, 16, and 24 hours after release using a trypsin-EDTA solution followed by resuspension in PBS to produce a single cell suspension. Cells were centrifuged, washed twice in cold PBS, and the pellets were suspended and fixed in 5 mL of 70% ethanol at 4°C overnight. Fixed cells were centrifuged and the pellets were washed in cold PBS and resuspended in 1 mL of PBS containing 0.1% (v/v) of Triton X-100, 200 µg/mL of RNase A, and 10 µg/mL of propidium iodide at room temperature in the dark for 1 hour. Staining intensity was analyzed with a FACScan flow cytometer (Becton Dickinson, San Jose, CA) interfaced with a Hewlett-Packard computer (Palo Alto, CA). Cell cycle data were analyzed using the FlowJo program (Ashland, OR).

Generation of a JNK2{alpha}-specific polyclonal antibody. We generated an antibody that recognizes JNK2{alpha} isoforms by immunizing rabbits with the peptide, LVKGCVIFQGTDH, which corresponds to amino acids 218 to 226 of human JNK2{alpha}2. This peptide was conjugated 1:1 (wt/wt) to keyhole limpet hemocyanin and then used to immunize rabbits by a commercial service (Genemed Synthesis, Inc., South San Francisco, CA). Western blot analysis with this antisera at a 1:4,000 dilution showed that it was monospecific for JNK2{alpha} isoforms and did not cross-react with any other JNK isoform.

Soft agar assay. Cells were harvested, washed, and 1 x 105 cells were suspended in DMEM containing 0.3% of agarose and 1% fetal bovine serum and overlaid onto a bottom layer of solidified 0.7% agarose in DMEM containing 10% fetal bovine serum. Two milliliters of DMEM supplemented with 1% FCS (heat-inactivated at 56°C for 30 minutes), 2 mmol/L of L-glutamine, and 100 units/mL of penicillin/streptomycin/kanamycin were added once the cells/agarose had solidified. The presence of colonies was scored after 2 weeks.

In vivo tumor formation of tumors in nude mice. For implantation, cells were first washed with cold PBS and then harvested by trypsin-EDTA treatment. The dispersed cells were resuspended in cold PBS and adjusted to 2 x 107 cells/mL. One hundred microliters (2 x 106 cells) of the cell suspension was injected s.c. in the middle of the back of male 6- to 8-week-old athymic mice BALB/c nu/nu (NIH). Tumor size after injection was measured by a dial-caliper and the volumes were calculated as length x width x height x 0.52.

Gene expression analysis. cDNA microarray analysis for gene expression was done in the Microarray Facility of the Thomas Jefferson University. cRNA was prepared from 5 µg of total tumor RNA using either Cy3 or Cy5 labeling and hybridized to an oligonucleotide array containing 13,059 Homo sapiens transcripts constructed by the facility. Scanning and analysis was done according to ScannArray (Santa Clara, CA) protocols. Scanned image files were visually inspected for artifacts and normalized by using QuantArray with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as the internal control. Comparisons were made for each transfected cell line using U87MG cell mRNA expression as the reference. The fold change values, indicating the relative change in the expression levels between JNK-transfected cells and parental U87MG cells, were used to identify genes differentially expressed as further described in Results.

Real-time quantitative RT-PCR. Real-time RT-PCR was done using ABI TaqMan TAMRA chemistries and an ABI 7000 light thermocycler (Applied Biosystems, Foster City, CA). Briefly, the primers and the TaqMan probe used for eIF4E were according to a recently published article (29). Total RNA (0, 4, 20, 100, and 500 ng) was reverse-transcribed in an 11 µL reaction mixture using an AB reverse transcription kit (Applied Biosystems) containing dUTP to prevent the carry-over of contaminating DNA. After 5 minutes of denaturation, PCR was carried out using the following cycling conditions: 48°C for 10 minutes and 95°C for 10 minutes, followed by 40 cycles of 95°C for 15 seconds and 60°C for 1 minute. No template control and GAPDH endogenous control analyses were run for each cell line. All reactions were done in triplicate, and expression levels were normalized to the average level of GAPDH mRNA in each cell line.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
JNK2{alpha}2 is the predominant JNK isoform that is activated in human glioblastomas. There are three JNK genes that are alternatively spliced leading to 10 major JNK isoforms. However, the presently available commercial anti-JNK antibodies can only allow us to distinguish among the three JNK gene families, albeit with slight cross-reactivities when certain antibodies are used. Using these antibodies in conjunction with two-dimensional gel electrophoresis, we were able to determine that the JNK isoform highly activated in human glioblastoma is a JNK2 isoform (27). Because this is a 55 kDa protein, the isoform is likely to be either JNK2{alpha}2 or JNK2ß2, but further differentiation by Western blotting was not possible with the available reagents. Although sharing largely identical amino acid sequences, JNK isoforms have more divergent nucleotide sequences. This allowed us to design isoform-specific primers to examine the mRNA expression of JNK2{alpha}2 and JNK2ß2 by RT-PCR. We found that the expression of JNK2{alpha}2 was detected in 91% (10 of 11) of brain tumors, but surprisingly, JNK2ß2 was detectable in only 27% (3 of 11) of tumors. Both the JNK2{alpha}2 and JNK2ß2 transcript are expressed in normal human brain samples (3 of 3). In U87MG cells, the levels of JNK2{alpha}2 were also substantially greater than JNK2ß2 (Fig. 1A ).


Figure 1
View larger version (48K):
[in this window]
[in a new window]
  		Figure 1. JNK2{alpha}2 is the major JNK isoform expressed in human glioblastomas. A, expression of JNK2{alpha}2 and JNK2ß2 mRNA in normal brain and in brain tumors. PCR primers were used that were specific for either JNK2{alpha}2 or JNK2ß2 and then used in RT-PCR on a series of glioblastoma tumors or normal brain. Note the strong expression of JNK2{alpha}2 in 10 of 11 brain tumors. B, sequence for amino acids 218 to 230 in JNK2{alpha}2 which was used as the peptide antigen to produce the polyclonal antibody. These nine amino acids are present only in JNK2{alpha}2 and JNK2{alpha}1. C, specificity of the customized polyclonal antibody. Top, Western blots containing GST fusion proteins with the indicated JNK isoforms were incubated with the polyclonal antiserum. This antibody specifically detects GST-JNK2{alpha}2 or GST-JNK2{alpha}1 in vitro. Bottom, U87MG cells were transfected with GFP fusion protein constructs with the indicated JNK isoform. This reveals that the antibody specifically detects GFP-JNK2{alpha}2 or GFP-JNK2{alpha}1 expressed in transfected U87MG cells. D, expression of JNK2{alpha}2 in human brain tumor tissues. Western blots containing either glioblastoma tumor samples or normal brain were incubated with the JNK2{alpha}-specific antisera. Note the expression of JNK2{alpha}2 and the corresponding JNK activation in brain tumors. However, in normal brain specimens, the expression of JNK2{alpha}2 was not detected.

 
We wished to confirm the protein levels of JNK2{alpha}2 in brain tumors versus normal brain by Western blotting. Because commercially available antibodies cannot readily distinguish JNK2{alpha}2 versus JNK2ß2, we generated a polyclonal rabbit antisera using a peptide containing the sequences specific to JNK2{alpha} isoforms (see Fig. 1B). These sequences are only found in JNK2{alpha}1 and JNK2{alpha}2, whose sizes are 46 and 55 kDa, respectively. We first examined the sensitivity and specificity of the customized rabbit antiserum in vitro and in vivo. This antibody was shown to specifically recognize GST-JNK2{alpha}2 or GFP-JNK2{alpha}2 with no cross-reactivity towards any of the other nine JNK isoforms (Fig. 1C) except JNK2{alpha}1, which is expected because it is identical to JNK2{alpha}2 except for the difference in the COOH-terminal domain. However, JNK2{alpha}2 can be readily differentiated from JNK2{alpha}1 on Western blots by their size difference. Using this reagent, we examined the expression of JNK2{alpha}2 in a total of 6 normal brain specimens as well as 17 brain tumors. Fifteen of 17 (88.2%) of the tumors showed detectable JNK2{alpha}2 expression but only 2 of 17 (11.8%) of the tumors showed expression of the 46 kDa band corresponding to JNK2{alpha}1. Moreover, it was noted that JNK2{alpha}2 was not detected in any of the six normal brain samples despite the presence of transcript suggesting that there are translational or posttranslational mechanisms to regulate its expression. A representative Western blot is shown in Fig. 1D. In agreement with our previous results (26, 27), 14 of 17 tumors showed phosphorylation of the 55 kDa isoform of JNK but no phosphorylation of the 46 kDa band (data not shown). These results strongly indicate that JNK2{alpha}2 is the isoform that is preferentially activated in tumors and is overexpressed relative to normal brain.

JNK2{alpha}2 promotes the proliferation of glioma cells in vitro. Based on our finding that JNK2{alpha}2 is the major JNK isoform activated in human gliomas, we then asked if JNK2{alpha}2 plays a tumor-promoting role or a tumor suppressor role during human glioma formation. We cloned JNK2{alpha}2 and JNK2{alpha}2APF into the pGFPC1 mammalian expression vector (Clontech). JNK2{alpha}2APF has mutations at the dual phosphorylation sites and has been shown to abolish the autophosphorylation activity of JNK2{alpha}2 (27). Thus, it serves as the functional negative control for JNK2{alpha}2. We also wished to perform a biologically relevant comparison, and for these reasons, we chose to overexpress JNK1{alpha}1 because other studies, as well as our own, have shown that JNK1{alpha}1 is one of the predominant isoforms expressed in normal brain (27). We transfected pEGFPC1-JNK1{alpha}1, pEGFPC1-JNK2{alpha}2, pEGFPC1-JNK2{alpha}2APF, and pEGFPC1 into U87MG cells to obtain cell lines stably expressing the GFP fusion proteins (Fig. 2 ). Although JNK2{alpha}2 mRNA can be detected in U87MG cells, these cells normally have a rather weak or undetectable phospho-JNK signal under serum starvation conditions, which we also noted in our previous work. This property makes the U87MG cell line a good model for the study of JNK autophosphorylation as there would be no confusion with endogenously activated JNK. Following serum starvation, as expected, pEGFPC1-JNK2{alpha}2/U87MG showed autophosphorylation of this JNK isoform compared with the other transfected cell lines (Fig. 2).


Figure 2
View larger version (56K):
[in this window]
[in a new window]
  		Figure 2. Stable transfection of U87MG cells with pEGFPC1-JNKs. Cell lysates were collected from U87MG cells stably transfected with different pEGFPC1-JNKs plasmids. The resulting Western blots were incubated with antibodies against either GFP or the phosphorylated form of JNK. Arrows, position of the GFP-JNK fusion constructs or GFP alone. Note that when cells are cultured in 1% serum, only pEGFPC1-JNK2{alpha}2/U87MG cells show phosphorylation of the JNK signal.

 
We first analyzed cellular growth when cells were cultured in DMEM supplemented with 1% fetal bovine serum. This concentration has been found to maintain the cellular growth of U87 cells but eliminates growth factor triggering of endogenous JNK. We found that pEGFPC1-JNK2{alpha}2/U87MG cells had a significantly faster growth rate among all the transfected cells, whereas pEGFPC1-JNK2{alpha}2APF/U87MG cells had the slowest growth rate (Fig. 3A ). We then examined the cell cycle distribution of U87MG cells expressing different pEGFPC1-JNKs. In the first 24 hours after the cells were released, pEGFPC1-JNK2{alpha}2/U87MG entered the cell cycle within 8 hours and re-entered the cell cycle at 24 hours as shown by the percentage of cells in S phase. U87 and pEGFPC1-JNK2{alpha}2APF/U87MG cells also entered the cell cycle within 8 hours after release but were much slower in cycling. pEGFPC1-JNK1{alpha}1/U87MG cells actually showed a steady block between the G1 and S stage (Fig. 3B).


Figure 3
View larger version (46K):
[in this window]
[in a new window]
  		Figure 3. JNK2{alpha}2 promotes the tumorigenic phenotype in vitro and in vivo. A, in vitro growth rate comparison of U87MG cells transfected with different pEGFPC1-JNK constructs. Stably transfected cells (1 x 105) were seeded and cultured in DMEM supplemented with 1% fetal bovine serum. Cell numbers were counted daily. Results from two separate experiments done in triplicate. *, P < 0.05, a statistically significant difference compared with the other four cell lines. B, cell cycle analysis of U87MG cells stably transfected with various pEGFPC1-JNK constructs as analyzed by flow cytometry. Top, bar chart of the cell cycle distribution at various time points after synchronization in a representative experiment. The distribution of cell cycle phases is expressed as a percentage (%) of total cells. Bottom, example of a cell cycle distribution plot at 8 hours. Results are typical of two separate experiments done in triplicate. C, anchorage-independent growth of stably transfected U87MG cell lines in soft agar. Columns, mean results from two separate experiments done in triplicate; bars, ±SE. *, P < 0.05 compared with other four cell lines. D, athymic mice were injected s.c. with the various pEGFPC1-JNK constructs transfected U87MG cells, empty vector or untransfected cells (n = 10 for each group). Tumor volumes on day 21 are shown. Columns, mean per group; bars, ±SE. *, P < 0.05, compared with other groups.

 
The anchorage-independent growth of U87MG cells transfected by pEGFPC1-JNKs also yielded similar results. Compared with untransfected U87MG cells, JNK2{alpha}2 induced greater colony formation when the cells were grown in soft agar (P < 0.05), whereas the other transfected cell lines showed a similar number of colonies on soft agar when compared with the control cells. These results indicate that JNK2{alpha}2 can further enhance the anchorage-independent growth of U87MG cells (Fig. 3C).

JNK2{alpha}2 promotes tumorigenicity in athymic mice. Because our data supported a role for JNK2{alpha}2 in promoting the proliferation of human glioblastoma cells in vitro, we extended our study in vivo by testing whether this gene could enhance tumor formation. Mice were divided into five groups (n = 10 for each group) and 2 x 106 of either pGFPC1-JNK1{alpha}1/U87MG, pGFPC1-JNK2{alpha}2/U87MG, pGFPC1-JNK2{alpha}2APF/U87MG, pGFPC1/U87MG, or U87MG cells were injected s.c. on the back of the mice. U87MG cells are known to be tumorigenic and tumors formed for all groups within 7 to 10 days after injection. However, by day 21, mice injected with pGFPC1-JNK2{alpha}2/U87MG cells showed a statistically significant increase in average tumor size compared with all other groups. Conversely, the impairment of constitutive JNK activation by pGFPC1-JNK2{alpha}2APF caused a significant suppression of tumor formation in vivo (Fig. 3D). These data indicate that the constitutive activation of JNK2{alpha}2 could accelerate tumor formation.

JNK2{alpha}2 promotes the up-regulation of eIF4E and activation of AKT. Because one of the primary functions of JNK is to activate transcription factors, in order to elucidate the downstream events induced by JNK2{alpha}2 autophosphorylation and activation, we did a cDNA microarray analysis. We compared the gene profiles of pGFPC1-JNK2{alpha}2/U87MG and pGFPC1-JNK2{alpha}2APF/U87MG against U87MG cells using a cDNA microarray that contains 13,059 H. sapiens transcripts. We first focused on genes that showed a >2-fold induction by JNK2{alpha}2 and identified 15 such genes. To confirm that expression was due to the kinase activity of JNK2{alpha}2, we further filtered this set by looking for genes that showed repression by JNK2{alpha}2APF (Table 1 ). Using these criteria, eIF4E showed the greatest overall change affected by JNK2{alpha}2 and JNK2{alpha}2APF. We confirmed the change in expression of eIF4E using a real-time PCR assay (Fig. 4A ). This revealed a 6-fold increase in eIF4E expression in pGFPC1-JNK2{alpha}2/U87MG in comparison to U87MG cells but a 3.5-fold repression in pGFPC1-JNK2{alpha}2APF/U87MG cells. These data show that JNK2{alpha}2 can regulate eIF4e transcription via its constitutive activation.


View this table:
[in this window]
[in a new window]
  		Table 1. List of genes whose expression is JNK2{alpha}2 activation–dependent

 

Figure 4
View larger version (23K):
[in this window]
[in a new window]
  		Figure 4. Autophosphorylation of JNK2{alpha}2 specifically leads to eIF4E overexpression and AKT activation. A, mRNA expression of eIF4E of stably transfected U87MG cells as revealed by real-time PCR. The expression level of eIF4E in untransfected U87MG cells is arbitrarily defined as 1 and the levels of expression in the other stably transfected U87MG cells are expressed as the fold changed compared with that of untransfected. Results are an average of fold changed from real-time RT-PCR from four different total RNA concentrations in triplicate. B, AKT phosphorylation and eIF4E expression are dependent on the presence of constitutively active JNK in stably transfected U87MG cells. U87MG cells transfected with the indicated pEGFPC1-JNK constructs were serum-starved for 24 hours and cell lysates were collected for Western blots using the indicated antibodies. C, schematic diagram of JNK1{alpha}2, JNK2{alpha}2, and two JNK1{alpha}2/JNK2{alpha}2 chimeras, chimera 5 and chimera 7. The roman numerals above JNK1{alpha}2 indicate the subdomains recognized within JNK. The gray areas in JNK2{alpha}2 indicate the regions that contain amino acid substitutions relative to JNK1{alpha}2. Chimera 5 is essentially composed of JNK1{alpha}2 but containing amino acids 218 to 226 from JNK2{alpha}2, which renders it constitutively active. Chimera 7 is based on a JNK2{alpha}2 backbone, but contains amino acids 218 to 226 from JNK1{alpha}2, which results in it being inactive. D, AKT phosphorylation and eIF4E expression are induced by transient transfection of constitutively active JNK isoforms. Sixteen hours after transfection, cells were cultured in serum-free medium and the cells were harvested 8 hours later for Western blotting. Note the correlation between the presence of amino acids 218 to 226 from JNK2{alpha}2 (present in chimera 5 and JNK2{alpha}2, absent in chimera 7 and JNK1{alpha}2), JNK activation, AKT activation, and eIF4E overexpression.

 
Because activated AKT has been shown to regulate eIF4E (30, 31), this prompted us to analyze the expression of phospho-AKT in these cell lines. Interestingly, we found that AKT is activated in JNK2{alpha}2/U87MG cells, but not in JNK1{alpha}2/U87MG or JNK1{alpha}1/U87MG cells (Fig. 4B). Because the cells used were stable transfectants, we also wished to exclude that this effect was due to random JNK gene insertion or long-term changes induced by JNK gene expression by studying transiently transfected cells. For further confirmation, we also took advantage of two JNK1{alpha}2/JNK2{alpha}2 chimeras that we previously used to establish the autoactivation domain in JNK2{alpha} isoforms (Fig. 4C). Chimera 5 has the backbone of the non–constitutively active JNK1{alpha}2 but possesses amino acids 218 to 226 of JNK2{alpha}2, which renders it constitutively active in vivo and in vitro. Chimera 7 has a JNK2{alpha}2 backbone but with amino acids 218 to 226 replaced by its counterpart from JNK1{alpha}2, resulting in loss of autophosphorylation activity (28). U87MG cells were transiently transfected with these GFPC1-JNK constructs and the cells were then cultured in serum-free medium to allow autoactivation of JNK. Within 8 hours after serum starvation, cells transfected with chimera 5 and JNK2{alpha}2 showed profound AKT activation and eIF4E overexpression. On the other hand, U87MG cells transfected with chimera 7, JNK1{alpha}2, or JNK2{alpha}2APF do not show activation of Akt nor eIF4E overexpression (Fig. 4D). Collectively, these results establish that the constitutive activity of JNK2{alpha}2 can specifically up-regulate AKT activation and could result in eIF4E overexpression.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Whether JNKs play a strictly proapoptotic or antiapoptotic function has recently been debated. Strong evidence has now been gathered that under certain circumstances, JNK does promote cell survival and proliferation. In this report, we have not only confirmed the notion that certain JNKs can promote proliferation, but also for the first time, we have pinpointed that a specific JNK isoform, JNK2{alpha}2, promotes tumor formation and proliferation for human glioblastoma.

Although both JNK1 and JNK2 are ubiquitously expressed, highly similar at the amino acid level, and in some assays, can be functionally replaced by the other gene, there is evidence for unique roles for each form. JNK1 is thought to be more involved in the proapoptotic functions triggered by an extracellular stimulus. For example, tumor necrosis factor {alpha}–induced apoptosis is suppressed in Jnk1 null fibroblasts but is increased in Jnk2 null cells (32). An interesting phenomenon that we have previously noted is that in normal brain, the JNK isoform that is predominantly expressed and activated is a 46 kDa protein, most likely JNK1{alpha}1 or JNK2{alpha}1 (26); however, in glioblastomas, there is a switching of the activation pattern of JNKs. The major JNK isoform that is phosphorylated is the 55 kDa isoform of JNK, although both 46 and 55 kDa JNK isoforms are expressed at similar levels. The 55 kDa isoform was shown to be either JNK2{alpha}2 or JNK2ß2. In this study, we have used a combination of Western blots and RT-PCR to clarify that this isoform is specifically JNK2{alpha}2.

Of note, JNK2{alpha}2 is the isoform that possesses the strongest autophosphorylation activity in vitro and in vivo among all JNKs (27, 28). We have also provided strong evidence in this study that JNK2{alpha}2 is an oncogenic JNK isoform that enhances proliferation and tumorigenicity. Because JNK2{alpha}2 could activate multiple pathways simply by expression of the protein, it seems likely that there are mechanisms in the normal brain to regulate JNK2{alpha}2 expression to prevent abnormal signaling. We noticed the discordance between the presence of the JNK2{alpha}2 transcript and the lack of protein expression in the normal brain. This is not altogether surprising in light of a recent study which showed that mRNA expression levels have a very poor correlation with protein levels, especially when the protein is not abundantly expressed (33), which may be either due to regulation at the translational level or enhanced posttranslational degradation. It would be of interest to see if the normal mechanisms to control JNK2{alpha}2 protein levels are dysregulated in glioblastoma.

We have shown that JNK2{alpha}2 enhances cellular proliferation as well as anchorage-independent growth and tumorigenicity in athymic mice. All of these properties are impaired in cells expressing the dominant-negative form, JNK2{alpha}2APF, confirming that these phenotypes are induced by this constitutively active JNK isoform. To define the potential downstream effectors, we analyzed genes that are regulated by JNK2{alpha}2 activation. Microarray analysis revealed that among the genes, the expression of eIF4E was most dependent on JNK2{alpha}2 activity. The dependence of eIF4E mRNA expression on JNK2{alpha}2 activity was further confirmed using real-time RT-PCR.

Although its precise role in oncogenesis is not understood, eIF4E has emerged as having a key role in cancer. It serves as the central regulator of protein translation and has both transforming and antiapoptotic activity in vitro and in vivo (30, 34–37). Overexpression of eIF4E has been found in a series of human cancers (38). Thus, it seems to be an important effector for JNK2{alpha}2. Of even greater interest is the potential connection of both molecules with AKT signaling. Activation of AKT results in eIF4E activation and is a known effector in AKT signaling. In order to find a potential mechanism involved in the cross-talk between JNK2{alpha}2 and eIF4E, we studied AKT activation in cells expressing various JNK constructs. In cell lines with stable expression of JNK2{alpha}2, we found strong constitutive activation of AKT and overexpression of eIF4E, which were not found in cells expressing JNK1{alpha}1 or JNK2{alpha}2APF, suggesting that it is the constitutive activation of JNK2{alpha}2 that leads to AKT activation. Because this effect could be due to long-term changes in gene expression, we transiently transfected U87MG cells with these same constructs and found the same effect. To further support this notion, we took advantage of a JNK1{alpha}2 chimera that had the autoactivation domain from JNK2{alpha}2 which renders this construct constitutively active. The transfection of this molecule also resulted in the activation of AKT and overexpression of eIF4E accordingly. The expression of a JNK2{alpha}2 construct that was rendered inactive by the expression of the analogous domain from JNK1{alpha}2 showed no AKT activation and almost undetectable eIF4E expression. These results support the rather surprising conclusion that JNK2{alpha}2 can activate AKT specifically. This is a new finding as JNK has long been considered a downstream effector of AKT. Our data, for the first time, provides evidence for a novel pathway where JNK2{alpha}2 activation leads to AKT signaling, which in turn, leads to eIF4E activation and overexpression and increased malignancy.

Our results have important implications for the design of novel therapeutics for glioblastoma. Presently, all JNK inhibitors are isoform-nonspecific, although there is some differential targeting of different JNK family genes. Our demonstration that JNK2{alpha}2 is the main activated form in human glioblastoma suggests that targeting this isoform would be the most relevant. The fact that the nine unique amino acids present in JNK2{alpha}2 confer activity immediately suggests a region which generates inhibitors. We have found that unique amino acids at 218 to 226 are not only required for its autophosphorylation (28), but are also required for JNK2{alpha}2 molecule dimerization before autophosphorylation.4 Other findings from this article point to eIF4E as a downstream target and that inhibitors of translational initiation may also be effective in impairing brain tumor formation. Finally, the unexpected activation of AKT by JNK2{alpha}2 reinforces AKT as a viable therapeutic target, as many have already suggested, but also highlights a potential new complexity in AKT regulation. Future work will be dedicated to disabling the JNK2{alpha}2 pathway as well as revealing how JNK2{alpha}2 activates AKT.


   Acknowledgments
 
Grant support: NIH grants CA69495 and CA96539 (A.J. Wong).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


   Footnotes
 
4 J. Cui and A. Wong, unpublished data. Back

Received 1/12/06. Revised 7/27/06. Accepted 8/ 1/06.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Pulverer BJ, Kyriakis JM, Avruch J, Nikolakaki E, Woodgett JR. Phosphorylation of c-jun mediated by MAP kinases. Nature 1991;353:670–4.[CrossRef][Medline]
  2. Ip YT, Davis RJ. Signal transduction by the c-Jun N-terminal kinase (JNK)-from inflammation to development. Curr Opin Cell Biol 1998;10:205–19.[CrossRef][Medline]
  3. Noguchi K, Kitanaka C, Yamana H, Kokubu A, Mochizuki T, Kuchino Y. Regulation of c-Myc through phosphorylation at Ser-62 and Ser-71 by c-Jun N-terminal kinase. J Biol Chem 1999;274:32580–7.[Abstract/Free Full Text]
  4. Yamamoto K, Ichijo H, Korsmeyer SJ. BCL-2 is phosphorylated and inactivated by an ASK1/Jun N-terminal protein kinase pathway normally activated at G2/M. Mol Cell Biol 1999;19:8469–78.[Abstract/Free Full Text]
  5. Milne DM, Campbell LE, Campbell DG, Meek DW. p53 is phosphorylated in vitro and in vivo by an ultraviolet radiation-induced protein kinase characteristic of the c-Jun kinase, JNK1. J Biol Chem 1995;270:5511–8.[Abstract/Free Full Text]
  6. Fuchs SY, Adler V, Buschmann T, et al. JNK targets p53 ubiquitination and degradation in nonstressed cells. Genes Dev 1998;12:2658–63.[Abstract/Free Full Text]
  7. Gupta S, Barrett T, Whitmarsh AJ, et al. Selective interaction of JNK protein kinase isoforms with transcription factors. EMBO J 1996;15:2760–70.[Medline]
  8. Davis RJ. Signal transduction by the JNK group of MAP kinases. Cell 2000;103:239–52.[CrossRef][Medline]
  9. Johnson R, Spiegelman B, Hanahan D, Wisdom R. Cellular transformation and malignancy induced by ras require c-jun. Mol Cell Biol 1996;16:4504–11.[Abstract]
  10. Smeal T, Binetruy B, Mercola DA, Birrer M, Karin M. Oncogenic and transcriptional cooperation with Ha-Ras requires phosphorylation of c-Jun on serines 63 and 73. Nature 1991;354:494–6.[CrossRef][Medline]
  11. Behrens A, Jochum W, Sibilia M, Wagner EF. Oncogenic transformation by ras and fos is mediated by c-Jun N-terminal phosphorylation. Oncogene 2000;19:2657–63.[CrossRef][Medline]
  12. Minden A, Lin A, Claret FX, Abo A, Karin M. Selective activation of the JNK signaling cascade and c-Jun transcriptional activity by the small GTPases Rac and Cdc42Hs. Cell 1995;81:1147–57.[CrossRef][Medline]
  13. Clark GJ, Westwick JK, Der CJ. p120 GAP modulates Ras activation of Jun kinases and transformation. J Biol Chem 1997;272:1677–81.[Abstract/Free Full Text]
  14. Franklin CC, Sanchez V, Wagner F, Woodgett JR, Kraft AS. Phorbol ester-induced amino-terminal phosphorylation of human JUN but not JUNB regulates transcriptional activation. Proc Natl Acad Sci U S A 1992;89:7247–51.[Abstract/Free Full Text]
  15. Smeal T, Binetruy B, Mercola D, et al. Oncoprotein-mediated signalling cascade stimulates c-Jun activity by phosphorylation of serines 63 and 73. Mol Cell Biol 1992;12:3507–13.[Abstract/Free Full Text]
  16. Burgess GS, Williamson EA, Cripe LD, et al. Regulation of the c-jun gene in p210 BCR-ABL transformed cells corresponds with activity of JNK, the c-jun N-terminal kinase. Blood 1998;92:2450–60.[Abstract/Free Full Text]
  17. Cripe LD, Gelfanov VM, Smith EA, et al. Role for c-jun N-terminal kinase in treatment-refractory acute myeloid leukemia (AML):signaling to multidrug-efflux and hyperproliferation. Leukemia 2002;16:799–812.[CrossRef][Medline]
  18. Bost F, McKay R, Bost M, Potapova O, Dean NM, Mercola D. The Jun kinase 2 isoform is preferentially required for epidermal growth factor-induced transformation of human A549 lung carcinoma cells. Mol Cell Biol 1999;19:1938–49.[Abstract/Free Full Text]
  19. Antonyak MA, Moscatello DK, Wong AJ. Constitutive activation of c-Jun N-terminal kinase by a mutant epidermal growth factor receptor. J Biol Chem 1998;273:2817–22.[Abstract/Free Full Text]
  20. Butterfield L, Storey B, Maas L, Heasley LE. c-Jun NH2-terminal kinase regulation of the apoptotic response of small cell lung cancer cells to ultraviolet radiation. J Biol Chem 1997;272:10110–6.[Abstract/Free Full Text]
  21. Cioffi CL, Monia BP. Evaluation of biological role of c-Jun N-terminal kinase using an antisense approach. Methods Enzymol 2000;314:363–78.[Medline]
  22. Hreniuk D, Garay M, Gaarde W, Monia BP, McKay RA, Cioffi CL. Inhibition of c-Jun N-terminal kinase 1, but not c-Jun N-terminal kinase 2, suppresses apoptosis induced by ischemia/reoxygenation in rat cardiac myocytes. Mol Pharmacol 2001;59:867–74.[Abstract/Free Full Text]
  23. Arbour N, Naniche D, Homann D, Davis RJ, Flavell RA, Oldstone MB. c-Jun NH(2)-terminal kinase (JNK)1 and JNK2 signaling pathways have divergent roles in CD8(+) T cell-mediated antiviral immunity. J Exp Med 2002;195:801–10.[Abstract/Free Full Text]
  24. Chen N, Nomura M, She QB, et al. Suppression of skin tumorigenesis in c-Jun NH(2)-terminal kinase-2-deficient mice. Cancer Res 2001;61:3908–12.[Abstract/Free Full Text]
  25. Yang YM, Bost F, Charbono W, et al. C-Jun NH(2)-terminal kinase mediates proliferation and tumor growth of human prostate carcinoma. Clin Cancer Res 2003;9:391–401.[Abstract/Free Full Text]
  26. Antonyak MA, Kenyon LC, Godwin AK, et al. Elevated JNK activation contributes to the pathogenesis of human brain tumors. Oncogene 2002;21:5038–46.[CrossRef][Medline]
  27. Tsuiki H, Tnani M, Okamoto I, et al. Constitutively active forms of c-Jun NH2-terminal kinase are expressed in primary glial tumors. Cancer Res 2003;63:250–5.[Abstract/Free Full Text]
  28. Cui J, Holgado-Madruga M, Su W, Tsuiki H, Wedegaertner P, Wong AJ. Identification of a specific domain responsible for JNK2{alpha}2 autophosphorylation. J Biol Chem 2005;280:9913–20.[Abstract/Free Full Text]
  29. Van Trappen PO, Ryan A, Carroll M, et al. A model for co-expression pattern analysis of genes implicated in angiogenesis and tumour cell invasion in cervical cancer. Br J Cancer 2002;87:537–44.[CrossRef][Medline]
  30. Wendel HG, De Stanchina E, Fridman JS, et al. Survival signalling by Akt and eIF4E in oncogenesis and cancer therapy. Nature 2004;428:332–7.[CrossRef][Medline]
  31. Gingras A-C, Kennedy SG, O'Leary MA, Sonenberg N, Hay N. 4E-BP1, a repressor of mRNA translation, is phosphorylated and inactivated by the Akt (PKB) signaling Pathway. Genes Dev 1998;12:502–13.[Abstract/Free Full Text]
  32. Liu J, Minemoto Y, Lin A. c-Jun N-terminal protein kinase 1 (JNK1), but not JNK2, is essential for tumor necrosis factor {alpha}-induced c-Jun kinase activation and apoptosis. Mol Cell Biol 2004;24:10844–56.[Abstract/Free Full Text]
  33. Chen G, Gharib TG, Huang C-C, et al. Discordant protein and mRNA expression in lung adenocarcinomas. Mol Cell Proteomics 2002;1:304–13.[Abstract/Free Full Text]
  34. Lazaris-Karatzas A, Montine KS, Sonenberg N. Malignant transformation by a eukaryotic initiation factor subunit that binds to mRNA 5' cap. Nature 1990;345:544–7.[CrossRef][Medline]
  35. Polunovsky VA, Gingras AC, Sonenberg N, et al. Translational control of the antiapoptotic function of Ras. J Biol Chem 2000;275:24776–80.[Abstract/Free Full Text]
  36. Avdulov S, Li S, Van Michalek, et al. Activation of translation complex eIF4F is essential for the genesis and maintenance of the malignant phenotype in human mammary epithelial cells. Cancer Cell 2004;5:553–63.[CrossRef][Medline]
  37. Ruggero D, Montanaro L, Ma L, et al. The translation factor eIF-4E promotes tumor formation and cooperates with c-Myc in lymphomagenesis. Nat Med 2004;10:484–6.[CrossRef][Medline]
  38. Rosenwald IB. The role of translation in neoplastic transformation from a pathologist's point of view. Oncogene 2004;23:3230–47.[CrossRef][Medline]



This article has been cited by other articles:


Home page
 Clin. Cancer Res.Home page
A. Mangiola, G. Lama, C. Giannitelli, P. De Bonis, C. Anile, L. Lauriola, G. La Torre, G. Sabatino, G. Maira, M. Jhanwar-Uniyal, et al.
Stem Cell Marker Nestin and c-Jun NH2-Terminal Kinases in Tumor and Peritumor Areas of Glioblastoma Multiforme: Possible Prognostic Implications
Clin. Cancer Res., December 1, 2007; 13(23): 6970 - 6977.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
V. Leventaki, E. Drakos, L. J. Medeiros, M. S. Lim, K. S. Elenitoba-Johnson, F. X. Claret, and G. Z. Rassidakis
NPM-ALK oncogenic kinase promotes cell-cycle progression through activation of JNK/cJun signaling in anaplastic large-cell lymphoma
Blood, September 1, 2007; 110(5): 1621 - 1630.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cui, J.
Right arrow Articles by Wong, A. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cui, J.
Right arrow Articles by Wong, A. J.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online