Cancer Research SABCS  Protein Translation and Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

Cancer Research 66, 10760, November 15, 2006. doi: 10.1158/0008-5472.CAN-06-1111
© 2006 American Association for Cancer Research

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by van Gorp, A. G.M.
Right arrow Articles by Coffer, P. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by van Gorp, A. G.M.
Right arrow Articles by Coffer, P. J.

Molecular Biology, Pathobiology, and Genetics

Chronic Protein Kinase B (PKB/c-akt) Activation Leads to Apoptosis Induced by Oxidative Stress–Mediated Foxo3a Transcriptional Up-regulation

Ankie G.M. van Gorp1, Karen M. Pomeranz2, Kim U. Birkenkamp1, Rosaline C-Y. Hui2, Eric W-F. Lam2 and Paul J. Coffer1

1 Molecular Immunology Laboratory, Department of Immunology, University Medical Center Utrecht, Utrecht, the Netherlands and 2 Cancer Research-UK Laboratories and Section of Cancer Cell Biology, Department of Oncology, Imperial College School of Medicine, Hammersmith Hospital, London, United Kingdom

Requests for reprints: Paul J. Coffer, Molecular Immunology Laboratory, Department of Immunology, University Medical Center, KC.02.085.2, Lundlaan 6, 3584 CA Utrecht, the Netherlands. Phone: 31-30-250-7674; Fax: 31-30-250-4305; E-mail: P.J.Coffer{at}umcutrecht.nl.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Increased protein kinase B (PKB; c-Akt) activation is a hallmark of diverse neoplasias providing both proliferative and antiapoptotic survival signals. In this study, we investigated the effect of chronic PKB activation on cellular survival and proliferation using cytokine-dependent bone marrow–derived Ba/F3 cells, in which PKB{alpha} activation can be directly, and specifically, induced by addition of 4-hydroxytamoxifen (4-OHT). Direct activation of PKB rescued Ba/F3 cells from cytokine withdrawal–induced apoptosis; however, surprisingly, these antiapoptotic effects were short lived, cells only being protected for up to 48 hours. We observed that activation of PKB in survival factor–deprived cells led to a dramatic increase of Foxo3a on both the transcriptional and protein level leading to expression of its transcriptional targets Bim and p27kip1. High levels of PKB activity result in increased aerobic glycolysis and mitochondrial activity resulting in overproduction of reactive oxygen species. To determine whether oxidative stress might itself be responsible for Foxo3a up-regulation, we utilized hydrogen peroxide (H2O2) as an artificial inducer of oxidative stress and N-acetylcysteine (NAC), a thiol-containing radical oxygen scavenger. Addition of NAC to the culture medium prolonged the life span of cells treated with 4-OHT and prevented the up-regulation of Foxo3a protein levels caused by PKB activation. Conversely, treatment of Ba/F3 cells with H2O2 caused an increase of Foxo3a on both transcriptional and protein levels, suggesting that deregulated PKB activation leads to oxidative stress resulting in Foxo3a up-regulation and subsequently cell death. Taken together, our data provide novel insights into the molecular consequences of uncontrolled PKB activation. (Cancer Res 2006; 66(22): 10760-9)


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cytokines of the interleukin (IL)-3, IL-5, and granulocyte-macrophage colony-stimulating factor family play an important role as hematopoietic differentiation and survival factors (1). Critical antiapoptotic signals induced by these cytokines include activation of phosphatidylinositol 3-kinase (PI3K), which in turn promotes activation of protein kinase B (PKB; c-akt; ref. 2). In mammals, there are three PKB isoforms, PKB{alpha}, PKBß, and PKB{gamma}, which share a high degree of sequence homology. All three isoforms contain an NH2-terminal pleckstrin homology domain, a catalytic domain and a COOH-terminal regulatory domain (3). PKB{alpha} is the most ubiquitously expressed and studies in PKB{alpha}-deficient mice have shown it to be indispensable for normal cell growth (4). The expression of PKBß has its highest expression levels in insulin-responsive tissues. It is thus not surprising that PKBß-deficient mice suffer from diabetes (5). PKB{gamma} is expressed at the lowest levels, except for the brain and testes. PKB{gamma}-deficient mice show impaired brain development (6). PKB{alpha} and PKBß double knockout mice die shortly after birth (7).

PKB has been reported to inhibit apoptosis through a variety of molecular mechanisms, including direct phosphorylation and inhibition of the proapoptotic Bcl-2 family member Bad (8), glycogen synthase kinase-3 (GSK-3; ref. 9), and caspase-9 (10). More recently, it also has been shown that PKB directly phosphorylates and inhibits members of the Foxo subfamily of forkhead transcription factors Foxo1, Foxo3a, and Foxo4 (11). Phosphorylation of the Foxo proteins by PKB results in their cytoplasmic retention by interaction with 14-3-3 proteins, thereby sequestering them from their target genes (12). Foxo transcription factors regulate a variety of genes that influence cellular proliferation (p27kip1 and cyclin D; refs. 13, 14), survival (FasL and Bim; refs. 15, 16), metabolism (PEPCK and G6Pase; ref. 17), and responses to stress [manganese superoxide dismutase (MnSOD) and catalase; ref. 18]. Therefore, regulation of Foxo activity is a critical means through which PKB modulates cellular homeostasis.

In a variety of human neoplasias, PKB activity is up-regulated. This up-regulation can be due to a variety of causes, including mutation of its intracellular activators, such as Ras or PI3K (19, 20), mutation or deletion of the tumor suppressor phosphatase and tensin homologue deleted on chromosome 10 (21, 22), or enhanced expression of one or more of the PKB isoforms (23). Besides inhibition of apoptosis and uncontrolled cell growth, enhanced PKB activity can also cause another feature commonly seen in malignancies, increased aerobic glycolysis (24). PKB directly regulates aerobic glycolysis by increasing surface expression of glucose transporters (25), by stimulating the mitochondrial association of hexokinase (26), and by phosphorylation of PFK2 (27). The fact that tumor cells enhance their aerobic glycolytic metabolism is seen as one of the primary hallmarks of cancer, a phenomenon termed the Warburg effect (28). It has been shown that, after withdrawal of growth factors, cells rapidly lose surface expression of nutrient transporters, such as Glut-1 and Glut-4 (29), leading to a rapid decline in glycolysis and a decrease in mitochondrial potential, resulting ultimately in the release of cytochrome c and the initiation of apoptosis (30). The heightened levels of glycolysis and mitochondrial activity enforced by PKB activation could therefore be an important mediator of the enhanced resistance to apoptosis. However, glycolysis also results in the production of reactive oxygen species (ROS) in cells. Whereas ROS levels fluctuate during the cell cycle and are suggested to be necessary as second messengers, in excess they can result in oxidative stress causing damage to lipids, proteins, and DNA (31). To counteract the effects of oxidative stress, cells have developed defense mechanisms in the form of intracellular antioxidants molecules, such as reduced glutathione (GSH), catalase, SOD, and thioredoxin, which protect cells from oxidative damage.

In this study, we have investigated the effect of chronic PKB activation on cellular survival and proliferation using cytokine-dependent bone marrow–derived Ba/F3 cells. For this purpose, we developed a system where PKB{alpha} can be inducibly activated. Surprisingly, we found that chronic PKB activation was unable to maintain long-term cell survival. Higher levels of oxidative stress caused by prolonged PKB activation resulted in increased expression of Foxo3a leading to expression of its transcriptional targets Bim and p27kip1. Up-regulation of these proteins ultimately results in cell cycle arrest and apoptosis. Taken together, our data suggest that chronic PKB activation is in itself insufficient for hematopoietic cell survival. These findings have important consequences for our understanding of the processes leading to cellular transformation.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell culture. Ba/F3 cells were cultured in RPMI 1640 with 8% Hyclone serum (Life Technologies, Paisley, United Kingdom) and recombinant mouse IL-3 produced in COS cells (32). For the generation of clonal Ba/F3 cells stably expressing myrPKB:ER*, the SR{alpha}-myrPKB:ER* construct was electroporated into Ba/F3 cells together with pSG5 conferring neomycin resistance and maintained in the presence of 1 mg/mL G418 (Life Technologies) and IL-3. Clonal cell lines were generated by limited dilution. For cytokine withdrawal experiments, cells were washed twice with PBS and resuspended in AimV medium (Life Technologies).

Antibodies and reagents. Polyclonal antibodies against total and phosphorylated PKB (Ser473) were from Cell Signaling Technologies (Hitchin, United Kingdom). Anti-p27kip1 was from Transduction Laboratories (Lexington, Kentucky). Anti-Bim was from Affinity BioReagents (Golden, CO). Foxo3a, phosphorylated c-Jun NH2-terminal kinase (JNK; Thr183/Tyr185), actin, and estrogen receptor (ER) were from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). The phosphorylated Foxo3a (Thr32) was from Upstate Biotechnology, Inc. (Lake Placid, NY). Phosphorylated GSK-3{alpha}/ß (Ser21/Ser9), phosphorylated signal transducer and activator of transcription 5 (STAT5; Tyr694), phosphorylated p38 (Thr180/Tyr182), and phosphorylated mitogen-activated protein kinase (MAPK) 42/44 (Thr202/Tyr204) were from New England Biolabs (Hitchin, United Kingdom). Carboxylfluorescein diacetate succinimidyl ester (CFSE) was from Molecular Probes (Carlsbad, CA). Buthionine sulfoximine (BSO) and DTT were from Sigma (Seelze, Germany). Thiolyte Monochlorobimane Reagent was from Calbiochem (Darmstadt, Germany). N-acetylcysteine (NAC) was from Zambon (Amersfoort, the Netherlands).

Western blotting. Cells were lysed in Laemmli buffer [0.12 mol/L Tris-HCL (pH 6.8), 4% SDS, 20% glycerol, 0.05 µg/µL bromphenol blue, 35 mmol/L ß-mercaptoethanol] and boiled for 5 minutes and the protein concentration was determined. Equal amounts of sample were analyzed by SDS PAGE, electrophoretically transferred to polyvinylidene difluoride membrane (Millipore, Bedford, MA), and probed with the respective antibodies. Immunocomplexes were detected using enhanced chemiluminescence (Amersham, Buckinghamshire, United Kingdom).

Apoptosis assays. Cells were counted, washed twice with PBS, resuspended in AimV medium, and seeded in six-well dishes (5 x 104 mL). Then, the cells were cultured in the presence or absence of IL-3 and/or 4-hydroxytamoxifen (4-OHT; 100 nmol/L), with the indicated amounts of NAC (250 µmol/L), BSO (1.0 or 0.1 mmol/L), or hydrogen peroxide (H2O2) added to the medium. Cells were then harvested at the indicated time points and washed with PBS. Samples were subsequently incubated for 15 minutes with Annexin V-FITC (Bender MedSystems, Vienna, Austria) in binding buffer [10 mmol/L HEPES-NaOH (pH 7.4), 150 mmol/L NaCL, 2.5 mmol/L CaCl2]. Cells were washed and resuspended in binding buffer containing 1 µg/mL propidium iodide (Bender MedSystems). Fluorescence-activated cell sorting (FACS) analysis was done on a FACSCalibur at a wavelength of 550 nm.

Proliferation assays. Cells were counted, washed with PBS, and incubated in prewarmed PBS containing 2.5 µmol/L CFSE for 15 minutes. Cells were subsequently washed and resuspended in AimV medium with or without IL-3 and/or 4-OHT (100 nmol/L) and seeded in six-well dishes (105 per mL). Proliferation was visualized as the decrease of fluorescent CFSE probe per cell as measured by flow cytometry analysis in the FL-1 channel.

Measurement of GSH levels. Cells were cultured in the presence or absence of IL-3 and/or 4-OHT (100 nmol/L), together with NAC (250 µmol/L), DTT (100 µmol/L), GSH (250 µmol/L), or BSO (1.0 or 0.1 mmol/L) for the indicated time. To determine the total intracellular GSH content, samples (5 x 106 cells) were washed and resuspended in 400 µL PBS containing 2 mmol/L monochlorobimane. On incubation for 30 minutes at 37°C, cells were centrifuged and resuspended in 400 µL PBS. Aliquots of 100 µL were taken to measure the fluorescence, either using the Fluoroskan Ascent from ThermoLabsystems (Almere, the Netherlands) at excitation wavelength of 385 nm and emission wavelength of 450 nm or by FACS analysis on a FACSCalibur in the FL-1 channel.

Transient electroporations and luciferase assay. For transient transfections, Ba/F3 cells were electroporated by using a Bio-Rad (Veenendaal, the Netherlands) Gene Pulser at 350 V and 950 µF with 10 µg of the pGL3-Foxo3a promoter reporter construct plus 1 µg pRLTK Renilla plasmid (Promega, Leiden, the Netherlands) to normalize for transfection efficiency. The Foxo3a promoter construct contains 1,146 bp upstream of the mouse Foxo3a coding region cloned into the KpnI and XhoI sites in pGL3-basic. After transfection, cells were cultured in RPMI 1640 containing 8% serum and IL-3 and left to recover for 16 hours. Then, cells were washed, transferred to cytokine-free medium, and treated with 200 nmol/L tamoxifen. At the indicated time points, the cells were washed twice with PBS and lysed in 100 µL passive lysis buffer for 5 minutes. After one freeze and thaw cycle, insoluble cell debris were spun down and the supernatant fraction was assayed for luciferase activity using Dual-Luciferase Reporter Assay System (Promega).

RNA isolation and real-time quantitative PCR. Total RNA was isolated using the RNeasy kit (Qiagen, Venlo, the Netherlands), and the concentration and purity of each sample were assessed by absorbance at 260 nm and by the 260 nm/280 nm ratio, respectively. The integrity of the RNA was verified by observing the rRNA bands in ethidium bromide–stained gel under UV irradiation.

Equal amounts of total RNA (2 µg) were reversed transcribed with SuperScript III reverse transcriptase (Invitrogen, Breda, the Netherlands). The resulting cDNA was amplified using an ABI Prism 7700 Sequence Detection System (Applied Biosystems, Foster City, CA) with the following primer pairs: mouse FOXO3A, TCCCAGATCTACGAGTGGATGG (sense) and CCTTCATTCTGAACGCGCAT (antisense) and mouse L19 GGAAAAAGAAGGTCTGGTTGGA (sense) and TGATCTGCTGACGGGAGTTG (antisense). L19, a nonregulated ribosomal housekeeping gene, was used as an internal control to normalize input RNA.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PKB activation is insufficient for long-term survival. To explore the mechanisms by which PKB regulates cytokine-mediated survival and proliferation in hematopoietic cells, we generated bone marrow–derived Ba/F3 cells stably expressing an inducible active PKB{alpha} (myrPKB:ER). The activation of the myristylated PKB{alpha} is, in the absence of 4-OHT, inhibited by heat-shock and chaperone proteins that associate with the fused ER hormone-binding domain. In the presence of 4-OHT, these proteins dissociate, allowing PKB to become phosphorylated and activated. Thus, in these cells, PKB activation can be directly, and specifically, induced by addition of 4-OHT (Fig. 1A, top ). 4-OHT-mediated PKB activation was sufficient to rapidly induce the phosphorylation of Foxo3a and GSK-3 (Fig. 1A). In contrast to stimulation of the cells with IL-3, 4-OHT treatment was unable to induce phosphorylation of extracellular signal-regulated kinase 1/2 (ERK1/2) MAPK, p38 MAPK, STAT5, or JNK (Fig. 1A, bottom). The stability and activity of myrPKB:ER was followed over a longer period. myrPKB:ER cells were cytokine starved and then treated with 4-OHT for up to 96 hours. As a control, cells were either cytokine starved or stimulated with IL-3 for 24 hours. Stimulation of Ba/F3 myrPKB:ER cells with 4-OHT resulted in phosphorylation of the myrPKB:ER protein itself as well as Foxo3a and GSK-3 for at least 96 hours (Fig. 1B). Prolonged activation of the myrPKB:ER protein did not result in its down-regulation (Fig. 1B, top).


Figure 1
View larger version (22K):
[in this window]
[in a new window]
 
Figure 1. 4-OHT specifically activates myrPKB:ER. A, Ba/F3-myrPKB:ER* cells were treated with either IL-3 or 4-OHT (100 nmol/L) for the indicated times and lysed and equal amounts of protein were analyzed for levels of phosphorylated PKB (p-PKB; Ser473), phosphorylated Foxo3a (p-Foxo3a; Thr32), phosphorylated GSK-3{alpha}/ß (p-GSK-3{alpha}/ß; Ser21/Ser9), phosphorylated ERK1/2 (p-ERK1/2; Thr202/Tyr204), phosphorylated STAT5 (p-STAT5; Tyr694), phosphorylated JNK (p-JNK; Thr183/Tyr185), and phosphorylated p38 (p-P38; Thr180/Tyr182). B, Ba/F3-myrPKB:ER* cells were cytokine starved or treated with either IL-3 or 4-OHT for the indicated times and lysed and equal amounts of protein were analyzed for levels of myrPKB:ER*, phosphorylated PKB (p-PKB; Ser473), phosphorylated Foxo3a (p-Foxo3a; Thr32), phosphorylated GSK-3{alpha}/ß (p-GSK3{alpha}/ß; Ser21/Ser9).

 
Subsequently, we investigated whether PKB activation alone was sufficient to induce proliferation. We cytokine-starved myrPKB:ER cells and left them untreated or treated with IL-3, 4-OHT, or both for up to 96 hours. Using CFSE, we measured the decrease in fluorescence per cell every 24 hours, an indication of proliferation. In addition, proliferation was monitored by counting cells. Both methods showed that PKB activation alone was sufficient for cells to proliferate (Fig. 2A, 4-OHT ), albeit not to the same extent as cells stimulated with IL-3 (Fig. 2A, IL-3). Cytokine-induced proliferation capacity was not perturbed when cells were stimulated with 4-OHT and IL-3 simultaneously (Fig. 2A, IL-3/4-OHT). Because activation of PKB is thought to be an important factor contributing to cell survival, we wished to establish the effect of chronic PKB activation on survival. We again cytokine starved the myrPKB:ER cell line and left them untreated or treated them with IL-3, 4-OHT, or both for up to 96 hours and measured the percentage of living cells every 24 hours. 4-OHT-mediated PKB activation rescued Ba/F3 cells from cytokine withdrawal–induced apoptosis (Fig. 2B). Surprisingly, these antiapoptotic effects were relatively short lived; cells initiated programmed cell death after 48 hours (Fig. 2B). These apoptotic events were not due to reduced expression of myrPKB:ER nor due to inactivation of PKB judging from the phosphorylation status of myrPKB:ER and its substrates GSK-3 and Foxo3a (Fig. 1B). Importantly, chronic PKB activation in combination with IL-3 did not cause apoptosis (Fig. 2B). Because previously observed effects of PKB activation on survival and metabolism have been attributed to mammalian target of rapamycin (mTOR) activity, we were interested if the transient antiapoptotic activity of PKB was indeed mTOR dependent. To investigate this, we measured apoptosis after 4-OHT stimulation in the absence or presence of rapamycin, a specific mTOR inhibitor. In contrast to IL-3, we observed that mTOR inhibition was able to almost completely block the rescue of cytokine-starved cells by PKB activation (Fig. 2C). These data show that the transient antiapoptotic activity of PKB is dependent on mTOR activity; however, PKB activation alone is insufficient to maintain long-term cell survival in the absence of additional factors.


Figure 2
View larger version (20K):
[in this window]
[in a new window]
 
Figure 2. Chronic PKB activation induces apoptosis in cytokine-starved Ba/F3 cells. A, left, Ba/F3 myrPKB:ER* cells were cytokine starved or treated with either 4-OHT, IL-3, or both IL-3 and 4-OHT for the indicated times; 24 (solid line), 48 (dashed line), 72 (dotted line), and 96 (dash-dotted line) hours. Proliferation was visualized as the decrease of fluorescent CFSE probe per cell as measured by FACS analysis; right, Ba/F3 myrPKB:ER* cells were cytokine starved or treated with either 4-OHT or IL-3 for the indicated times. Proliferation was monitored by counting cells at the indicated time points. Data are representative of at least three independent experiments and these results were observed in at least two independent clonal cell lines. B, Ba/F3-myrPKB:ER* cells were cytokine starved or treated with either IL-3, 4-OHT, or both for the indicated times. The percentage of living cells was determined by FACS analysis of the percentage of Annexin V–negative cells. Columns, average of three independent experiments; bars, SE. C, Ba/F3-myrPKB:ER* cells were cytokine starved or treated with either IL-3 or 4-OHT for 48 hours in the presence or absence of rapamycin (20 ng/mL). The percentage of living cells was determined by FACS analysis of the percentage of Annexin V–negative cells. Columns, average of three independent experiments; bars, SE.

 
Foxo3a expression is induced by prolonged activation of PKB. Because chronic PKB activation was insufficient for long-term survival, we sought to establish the mechanism underlying cell death. The myrPKB:ER cell line was cytokine starved and subsequently left untreated or treated with either IL-3 or 4-OHT for up to 96 hours. During prolonged 4-OHT treatment, we observed that Foxo3a remains phosphorylated (Fig. 1B); however, Foxo3a protein levels increase dramatically (Fig. 3A ). This increase in Foxo3a protein levels is already clearly visible within 24 hours of PKB activation (Fig. 3B). Quantitive analysis of the amounts of phosphorylated and unphosphorylated Foxo3a protein showed that the ratio between the two rapidly decreased after 48 hours of PKB activation (data not shown). Because chronic PKB activation in combination with cytokine treatment did not cause apoptosis or a delay in proliferation, we were interested if the presence of cytokine would have an effect on Foxo3a up-regulation. Cells were cytokine starved and left untreated or treated with IL-3, 4-OHT, or both for 24 hours. Foxo3a protein was only up-regulated when PKB was activated in the absence of cytokine (Fig. 3C). These experiments indicate that PKB activation in the absence of additional survival factors results in up-regulation of Foxo3a expression levels.


Figure 3
View larger version (17K):
[in this window]
[in a new window]
 
Figure 3. Chronic PKB activation leads to up-regulation of Foxo3a protein. A, Ba/F3-myrPKB:ER* cells were cytokine starved or treated with either IL-3 or 4-OHT for the indicated times and lysed and equal amounts of protein were analyzed for levels of Foxo3a and actin. B, Ba/F3-myrPKB:ER* cells were treated with 4-OHT for the indicated times and lysed and equal amounts of protein were analyzed for levels Foxo3a and actin. C, Ba/F3-myrPKB:ER* cells were cytokine starved or treated with either IL-3, 4-OHT, or both for 24 hours and lysed and equal amounts of protein were analyzed for levels of Foxo3a and actin. Data are representative of at least three independent experiments and these results were observed in at least two independent clonal cell lines.

 
Expression of Foxo3a transcriptional targets induced by long-term PKB activation. Because the up-regulation of Foxo3a protein levels observed during chronic PKB activation leads to a decrease in the ratio of phosphorylated compared with total Foxo3a protein, we sought to establish if this leads to increased transcriptional activity. Indeed, we found that, together with the up-regulation of Foxo3a, transcriptional targets Bim and p27kip1 were also up-regulated (Fig. 4 ). Up-regulation of Foxo3a protein already occurs within the first 24 hours of PKB activation (Fig. 3B), whereas the up-regulation of p27kip1 and Bim expression occurs somewhat later. During prolonged PKB activation, down-regulation of Bcl-xl was also observed (Fig. 4). The up-regulation of Bim and p27kip1 and the down-regulation of Bcl-xl are indicative for the fact that Foxo3a activity is no longer inhibited and provide an explanation as to why these cells are apoptotic after chronic PKB activation.


Figure 4
View larger version (14K):
[in this window]
[in a new window]
 
Figure 4. Chronic PKB activation and H2O2 lead to changes in expression of Foxo3a transcriptional targets. A, Ba/F3-myrPKB:ER* cells were cytokine starved or treated with either IL-3 or 4-OHT for the indicated times and lysed and equal amounts of protein were analyzed for levels of p27kip1, Bim, Bcl-xl, MnSOD, and actin. Data are representative of at least three independent experiments and these results were observed in at least two independent clonal cell lines. B, Ba/F3-myrPKB:ER* cells were cultured for 24 hours in the presence of IL-3 with or without NAC (250 µmol/L) and with or without H2O2 (200 µmol/L) added to the medium. The cells treated with NAC were pretreated for 24 hours in normal culture medium supplemented with this radical oxygen scavenger. The percentage of living cells was determined by FACS analysis of the percentage of Annexin V–negative cells. Columns, average of three independent experiments; bars, SE. Data were analyzed using one-way ANOVA corrected with Bonferroni's post-test for multiple comparisons. C, Ba/F3 wild-type (WT) cells were cultured in the presence of IL-3 and 100 µmol/L H2O2 for the indicated times and lysed and equal amounts of protein were analyzed for levels of Foxo3a, phosphorylated Foxo3a (p-Foxo3a; Thr32), phosphorylated PKB (p-PKB; Ser473), and PKB. Data are representative of at least three independent experiments.

 
Oxidative stress leads to an up-regulation of Foxo3a protein. We have established that, during prolonged PKB activation, Foxo3a expression is up-regulated resulting in transcription of proapoptotic target genes. However, we were interested in determining the molecular mechanism underlying this up-regulation. It has been observed in various tumors, in which PKB activity is enhanced, that there is a concomitant increase in aerobic glycolysis and mitochondrial activity. This increase in metabolic activity in the cell can lead to increased levels of ROS resulting in oxidative stress. Cells have specific mechanisms to protect themselves against ROS, including the up-regulation of MnSOD. However, although MnSOD has been reported to be a transcriptional target of Foxo3a (18), surprisingly we observed that after long-term PKB activation, MnSOD levels actually decrease (Fig. 4A), indicating that at least one important protective mechanism against oxidative stress is impaired.

To determine whether an increase in intracellular oxidative stress might be responsible for increased Foxo3a expression, we used H2O2 and NAC, a widely used thiol-containing oxygen radical scavenger. Addition of H2O2 to the culture medium induced apoptosis in Ba/F3 cells, which was prevented by the addition of NAC (Fig. 4B). To determine if an increase in ROS can indeed lead to increased levels of Foxo3a protein, Ba/F3 cells were treated with H2O2 and subsequently cell lysates were prepared and analyzed for Foxo3a expression. Similar to chronic PKB activation, H2O2 treatment was also able to elevate levels of Foxo3a protein (Fig. 4C). To investigate whether increased oxidation results in the death of Ba/F3 myrPKB:ER cells after prolonged PKB activation, we measured apoptosis after 4-OHT stimulation in the absence or presence of NAC. We observed that addition of NAC was able to significantly decrease the amount of apoptosis observed after PKB activation (Fig. 5A ).


Figure 5
View larger version (20K):
[in this window]
[in a new window]
 
Figure 5. NAC prolongs survival and inhibits Foxo3a up-regulation induced by chronic PKB activation. A, Ba/F3-myrPKB:ER* cells were treated with 4-OHT in the absence or presence of the NAC (250 µmol/L) for the indicated times. The percentage of living cells was determined by FACS analysis of the percentage of Annexin V–negative cells. Columns, average of three independent experiments; bars, SE. Data were analyzed using one-way ANOVA corrected with Bonferroni's post-test for multiple comparisons. B, left, Ba/F3-myrPKB:ER* cells were treated with IL-3 or 4-OHT in the absence or presence of 250 µmol/L NAC for 48 hours. Relative intracellular GSH levels were measured by flow cytometry. The values are expressed in relation to cells treated with IL-3 alone, which received the arbitrary value of one. Columns, mean of three determinations; bars, SD. Middle, Ba/F3-myrPKB:ER* cells were treated with IL-3 in the absence or presence of 1.0 or 0.1 mmol/L BSO for 48 hours. Relative intracellular GSH levels were measured by a Fluoroskan Ascent. The values are expressed in relation to cells treated with IL-3 alone, which received the arbitrary value of one. Columns, mean of three determinations; bars, SD. Right, Ba/F3-myrPKB:ER* cells were treated with IL-3 in the absence or presence of 1.0 or 0.1 mmol/L BSO for 48 hours. The percentage of living cells was determined by FACS analysis of the percentage of Annexin V–negative cells. Columns, average of three independent experiments; bars, SE. C, Ba/F3-myrPKB:ER* cells were treated with 4-OHT in the absence or presence of GSH (250 µmol/L) or DTT (100 µmol/L) for the indicated times. The percentage of living cells was determined by FACS analysis of the percentage of Annexin V–negative cells. Columns, average of three independent experiments; bars, SE. Data were analyzed using one-way ANOVA corrected with Bonferroni's post-test for multiple comparisons. D, top, Ba/F3-myrPKB:ER* cells were treated with 4-OHT, IL-3 alone, or IL-3 in the presence of 0.1 or 1.0 mmol/L BSO for 48 hours and lysed and equal amounts of protein were analyzed for levels of Foxo3a and actin. Data are representative of at least three independent experiments and these results were observed in at least two independent clonal cell lines. Bottom, Ba/F3-myrPKB:ER* cells were treated with 4-OHT in the absence or presence of NAC (250 µmol/L) for 24 hours and lysed and equal amounts of protein were analyzed for levels of Foxo3a and actin. Data are representative of at least three independent experiments and these results were observed in at least two independent clonal cell lines.

 
Although NAC is a free radical scavenger, it can also act as an aminothiol and a precursor of intracellular cysteine and GSH. GSH, the most abundant thiol antioxidant in mammalian cells, directly reacts with ROS, functions as a cofactor for antioxidant enzymes, such as gluthatione preroxidases, and maintains thiol redox potential in cells. Under normal circumstances, biological environments and reducing thiol buffers, such as GSH, within cells are predominantly in a reduced state. However, under conditions of oxidative stress, the endogenous pool of reduced thiols can become depleted. To test if thiol buffers are reduced after prolonged PKB activation, we measured GSH levels using the GSH-sensitive probe monochlorobimane. BSO, a selective GSH biosynthesis inhibitor was used as a negative control (Fig. 5B, left). GSH levels are significantly decreased in both cytokine-starved cells and in cells that have PKB chronically activated. We also observed that GSH depletion through BSO treatment (Fig. 5B, middle) results in apoptosis in the Ba/F3 cells either in the presence of cytokine or together with chronic PKB activation (Fig. 5B, right). Addition of NAC to the medium is able to significantly replenish the depleted pool of GSH (Fig. 5B, left). To investigate if NAC may function by replenishing a depleted pool of reducing thiols, we measured apoptosis after 4-OHT stimulation in the absence or presence of GSH or DTT, a general thiol reductant. We observed that addition of either GSH or DTT significantly decreased the amount of apoptosis observed after PKB activation (Fig. 5C), revealing the key role of oxidation in the apoptotic effect of chronic PKB activation.

Furthermore, we investigated if GSH depletion by BSO has an effect on Foxo3a protein levels. As shown in Fig. 5D (top), GSH depletion caused similar up-regulation of Foxo3a as was observed with chronic PKB activation. Moreover, addition of NAC to the culture medium was able to prevent the up-regulation of Foxo3a protein compared with cells treated with 4-OHT alone (Fig. 5D, bottom). Thus, Ba/F3 cells are sensitive to increased levels of oxidative stress leading to up-regulation of Foxo3a and apoptosis. Relieving the levels of oxidative stress by addition of NAC can delay Foxo3a up-regulation and the onset of apoptosis.

Increased ROS levels induce transcriptional activity of the Foxo3a promoter. Although we have shown regulation of Foxo3a protein levels by chronic PKB activation, we wished to determine whether this could occur at the transcriptional level. Ba/F3 cells were treated with 4-OHT in the presence or absence of transcription inhibitor actinomycin D. Actinomycin D completely blocked the up-regulation of Foxo3a protein by 4-OHT (Fig. 6A ). Therefore, we examined if the effect of PKB activation on Foxo3a protein levels was also reflected on the level of Foxo3a mRNA. Real-time quantitative PCR showed an increase in Foxo3a mRNA after 4 hours of PKB activation (Fig. 6B). Furthermore, H2O2 treatment also resulted in an increase of Foxo3a mRNA (Fig. 6C).


Figure 6
View larger version (13K):
[in this window]
[in a new window]
 
Figure 6. PKB activation and H2O2 up-regulate Foxo3a mRNA levels and promoter activity. A, Ba/F3-myrPKB:ER* cells were cultured for the indicated times in the presence of 4-OHT with or without the indicated concentrations of actinomycin D (Act-D) added to the medium and lysed and equal amounts of protein were analyzed for levels of Foxo3a and actin. B, Ba/F3 myrPKB:ER* cells were cultured with or without 4OHT (right) for 4 hours and as a control WT Ba/F3 cells were incubated with 4OHT for 4 hours (left), RNA was isolated, cDNA was synthesized, and real-time PCR was done using specific primers for Foxo3a. Results were normalized for the housekeeping gene L19. The values are expressed in relation to untreated cells, which received the arbitrary value of one. Columns, relative change of Foxo3a mRNA; bars, SD. Data are representative of at least three independent experiments. Data were analyzed using one-way ANOVA corrected with Bonferroni's post-test for multiple comparisons. C, Ba/F3 myrPKB:ER* cells were cultured with or without H2O2 for 4 hours, RNA was isolated, cDNA was synthesized, and real-time PCR was done using specific primers for Foxo3a. Results were normalized for the housekeeping gene L19. The values are expressed in relation to untreated cells, which received the arbitrary value of one. Columns, relative change of Foxo3a mRNA; bars, SD. Data are representative of at least three independent experiments. Data were analyzed using one-way ANOVA corrected with Bonferroni's post-test for multiple comparisons. D, Ba/F3-myrPKB:ER* cells were transiently transfected with pGL3-Foxo3a promoter construct and subsequently treated with 4-OHT (top) or H2O2 (bottom). Cells were harvested at the indicated times and assayed for luciferase activity. Results are corrected for cotransfected Renilla activity, and the relative luciferase activity is standardized to that observed with the empty vector. The values are expressed in relation to untreated cells, which received the arbitrary value of one. Columns, relative change of Foxo3a promoter activity; bars, SD. Results were presented as an average of three independent experiments. Data were analyzed using ANOVA statistics with Dunnett's post-test for multiple comparisons (all columns versus control).

 
In addition to analyzing Foxo3a mRNA, we also examined Foxo3a promoter regulation by PKB activation. To this end, Ba/F3 cells were transiently transfected with a luciferase reporter construct under the control of the Foxo3a promoter. Subsequently, luciferase activity was measured after 4-OHT mediated PKB activation. As shown in Fig. 6D (top), chronic PKB activation induced Foxo3a promoter activity after 24 hours. To investigate whether Foxo3a promoter activity was also oxidative stress dependent, luciferase activity was measured after addition of H2O2 to the culture medium. Figure 6D (bottom) shows that, on addition of H2O2, luciferase reporter activity increases. Taken together, these data suggest that chronic PKB activation leads to a state of oxidative stress, which subsequently induces Foxo3a transcription, leading to increased levels of Foxo3a protein. This increased Foxo3a expression leads to transcriptional up-regulation of proapoptotic target genes, eventually resulting in programmed cell death.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A tumor develops when the balance between generation and growth of new cells and death and removal of excess cells is perturbed. Aberrant PKB activation has now been implicated in the pathogenesis of a variety of human cancers. Mouse models have suggested that unregulated PKB signaling can contribute to malignancy either alone or in cooperation with additional genetic alterations (33). However, to properly interpret studies investigating the role of this kinase in oncogenesis, it is important to take into account that diverse genetic events and cellular changes occur in the development of a tumor. We have used a cellular model, in which PKB activity can be rapidly and inducibly activated providing a simplified model for understanding the molecular mechanisms underlying transforming capacity of this protein. Interestingly, our data suggest that chronic PKB activation can lead to cellular oxidative stress, eventually resulting in apoptosis through increased Foxo3a expression. Importantly, this shows that PKB activity alone is insufficient for cell survival and additional signals induced by cytokine stimulation are required. Indeed, it has been shown that expression of either activated Ras or PKB alone is insufficient to cause glioblastoma in mice, although their coexpression leads to aggressive disease (34).

The fact that dysregulation of PKB activation can lead to oxidative stress in cells can be explained by the mechanism by which PKB inhibits apoptotic events. PKB-mediated survival depends at least in part on the maintenance of glucose metabolism. PKB activation has been shown to maintain mitochondrial membrane potential and hexokinase activity in situations that would otherwise lead to apoptosis, such as serum withdrawal. PKB activation leads to an increase in nutrient uptake and enhanced cellular metabolism through a mTOR-dependent mechanism (35). mTOR can be activated by PKB either by direct phosphorylation (36) or by phosphorylation and inhibition of TSC2 (37). In our system, PKB-mediated survival is also dependent on mTOR activity and thus the key role mTOR plays in coordinating the cellular response to extracellular nutrient levels is of great importance to survival induced by chronic PKB activation. However, metabolic activity also results in the production of ROS and, in absence of sufficient cellular mechanisms to compensate for this, a state of oxidative stress. Unfortunately, we were unable to detect increased levels of ROS due to lack of sensitivity of available methods. However, experiments using both H2O2 and NAC support that chronic PKB activation can lead to oxidative stress and that the observed effects on Foxo3a regulation are oxidative stress dependent. In our system, the chronic activation of PKB leads to a prolonged situation of cellular oxidation resulting in depletion of cellular protection mechanisms, including MnSOD and GSH.

Excessive ROS and oxidative stress can result in cellular damage but also in altered signal transduction. Recently, there have been several reports describing the regulation of Foxo transcription factors by cellular oxidative stress. Essers et al. (38) showed that oxidative stress induces the activation of Foxo4. Oxidative stress leads to the activation of small GTPase Ral and this results in a JNK-dependent phosphorylation of Foxo4, leading to nuclear translocation and transcriptional activation. Another post-translational modification observed for Foxos in response to cellular stress is changes in acetylation. In 2005, three independent groups reported that Foxos are acetylated in response to cellular stress. Although these studies show that regulation of acetylation of Foxos leads to changes in transcriptional activation, the functional consequences remain unclear (3941). Here, we are the first to show that Foxo3a can also be regulated by oxidative stress at the level of expression. This shows that cellular oxidative stress can modulate Foxo transcriptional activity through multiple molecular mechanisms.

How could cellular oxidation lead to up-regulation of Foxo3a protein levels? We have shown clearly that Foxo3a expression is regulated at the level of transcription (Fig. 6A and D). Studies have shown that changes in redox status can regulate phosphorylation and activation of a variety of intracellular signaling molecules (42). This can subsequently lead to changes in the activity of redox-sensitive transcription factors, including components of the nuclear factor-{kappa}B and activator protein-1 (AP-1) complexes (43). Indeed, with homology to Foxo3a, regulation of AP-1 activity through oxidative stress can be achieved through changes in transcription of genes encoding AP-1 subunits, control of mRNA stability, post-translational processing, and turnover of protein. It is likely that oxidation-mediated modulation of such transcription factors is responsible for the increased Foxo3a expression we observe after chronic PKB activation.

Here, we investigate the effect of chronic PKB{alpha} on survival and proliferation of Ba/F3 cells. Recently, Jin et al. (44) investigated the effect of chronic PKBß activation in human kidney epithelial cells (HEK293). This chronic activation resulted in alterations in cellular growth, size, and the appearance of aneuploid cells. After prolonged activation, cells underwent extensive multinucleation caused by both endomitosis and cell fusion. In our system, we do not observe these phenomena; this is most likely due to the distinct nature of the two cell lines used in these studies. It is also possible that, due to their factor-dependent nature, hematopoietic cell lines are less likely to accumulate major alterations because they are more prone to apoptosis than HEK293 cells. Transgenic mice expressing constitutively active PKB targeted to the lymphocyte population show lymphoproliferation (45, 46). In our study, we also observed increased proliferation when PKB was activated in the presence of cytokine (Fig. 2A, left), but because survival was already optimal under these conditions, there was no further advantage of PKB activation (Fig. 2B). This indicates that, in our system, the antiapoptotic activity of PKB does not lead to apoptosis in combination with other stimulating factors, but that chronic activation enhances proliferation and could increase resistance to apoptotic stimuli as was shown by Jones et al. (47). PKB activation only enhances existing survival and proliferation signals but its chronic activation seems to make these cells more sensitive to targeting or depletion of protective mechanisms, such as GSH or MnSOD.

Insulin and insulin-like growth factor-I have beneficial effects on cardiomyocyte function and survival, including protection against ischemic injury. This is thought to be mediated in part due to PKB activation (48), and acute PKB activation is cardioprotective. However, recent studies have shown that chronic PKB activation actually results in decreased functional recovery and increased injury after ischemia/reperfusion injury (IRI; ref. 49). In these studies, PKB-induced injury could be abrogated by constitutive PI3K activation. Interestingly, we found that, in contrast to PKB, chronic PI3K activation was indeed sufficient for cytokine-independent Ba/F3 survival (data not shown). Our data suggest a possible molecular mechanism underlying the detrimental effects of chronic PKB activation in IRI, suggesting that prolonged PKB activation in cardiomyocytes might also lead to increased oxidative stress and cellular damage.

We show that increased expression of Foxo3a ultimately results in up-regulation of p27kip1 and Bim protein levels together with down-regulation of Bcl-xl. This can be explained because Bcl-xl expression is inhibited by Bcl-6, which is a transcriptional target of Foxo4 (50). Another known Foxo3a target MnSOD is down-regulated during Foxo3a activation in this cytokine-deprived situation. This indicates that, in contrast to other cell systems, Foxo3a transcriptional up-regulation is insufficient to protect cells against oxidative stress. Bone marrow–derived Ba/F3 cells apparently do not have an adequate mechanism to deal with the enhanced oxidative environment caused by chronic PKB activation.

A cell must successfully overcome a series of hurdles before it can be considered to be cancerous. Our data suggest that, although chronic activation of PKB may indeed be a crucial factor in bypassing normal failsafe mechanisms, allowing factor independent growth and survival, additional mechanisms are required to enable "PKB-transformed" cells to cope with the detrimental effects of uncontrolled glycolysis. Dysregulation of PKB activity is therefore in itself insufficient for hematopoietic cell survival, and cells are "culled" through up-regulation of the proapoptotic Foxo3a transcription factor. These findings have important consequences for our understanding of the processes leading to cellular transformation.


    Acknowledgments
 
Grant support: ZonMW grants (A.G.M. van Gorp and K.U. Birkenkamp).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Ines Soeiro for technical assistance and Dr. A. Klippel for kindly providing us with the SR{alpha}-myrPKB:ER* construct.

Received 3/24/06. Revised 8/30/06. Accepted 9/12/06.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Martinez-Moczygemba M, Huston DP. Biology of common ß receptor-signaling cytokines: IL-3, IL-5, and GM-CSF. J Allergy Clin Immunol 2003;112:653–65.[CrossRef][Medline]
  2. Coffer PJ, Jin J, Woodgett JR. Protein kinase B (c-Akt): a multifunctional mediator of phosphatidylinositol 3-kinase activation. Biochem J 1998;335:1–13.[Medline]
  3. Datta SR, Brunet A, Greenberg ME. Cellular survival: a play in three Akts. Genes Dev 1999;13:2905–27.[Free Full Text]
  4. Cho H, Thorvaldsen JL, Chu Q, Feng F, Birnbaum MJ. Akt1/PKB{alpha} is required for normal growth but dispensable for maintenance of glucose homeostasis in mice. J Biol Chem 2001;276:38349–52.[Abstract/Free Full Text]
  5. Cho H, Mu J, Kim JK, et al. Insulin resistance and a diabetes mellitus-like syndrome in mice lacking the protein kinase Akt2 (PKBß). Science 2001;292:1728–31.[Abstract/Free Full Text]
  6. Tschopp O, Yang ZZ, Brodbeck D, et al. Essential role of protein kinase B{gamma} (PKB {gamma}/Akt3) in postnatal brain development but not in glucose homeostasis. Development 2005;132:2943–54.[Abstract/Free Full Text]
  7. Peng XD, Xu PZ, Chen ML, et al. Dwarfism, impaired skin development, skeletal muscle atrophy, delayed bone development, and impeded adipogenesis in mice lacking Akt1 and Akt2. Genes Dev 2003;17:1352–65.[Abstract/Free Full Text]
  8. del Peso L, Gonzalez-Garcia M, Page C, Herrera R, Nunez G. Interleukin-3-induced phosphorylation of BAD through the protein kinase Akt. Science 1997;278:687–9.[Abstract/Free Full Text]
  9. Cross DA, Alessi DR, Cohen P, Andjelkovich M, Hemmings BA. Inhibition of glycogen synthase kinase-3 by insulin mediated by protein kinase B. Nature 1995;378:785–9.[CrossRef][Medline]
  10. Cardone MH, Roy N, Stennicke HR, et al. Regulation of cell death protease caspase-9 by phosphorylation. Science 1998;282:1318–21.[Abstract/Free Full Text]
  11. Kops GJ, de Ruiter ND, de Vries AM, Powell DR, Bos JL, Burgering BM. Direct control of the Forkhead transcription factor AFX by protein kinase B. Nature 1999;398:630–4.[CrossRef][Medline]
  12. Birkenkamp KU, Coffer PJ. FOXO transcription factors as regulators of immune homeostasis: molecules to die for? J Immunol 2003;171:1623–9.[Free Full Text]
  13. Dijkers PF, Medema RH, Pals C, et al. Forkhead transcription factor FKHR-L1 modulates cytokine-dependent transcriptional regulation of p27(KIP1). Mol Cell Biol 2000;20:9138–48.[Abstract/Free Full Text]
  14. Schmidt M, Fernandez de MS, van der Horst A, et al. Cell cycle inhibition by FoxO forkhead transcription factors involves downregulation of cyclin D. Mol Cell Biol 2002;22:7842–52.[Abstract/Free Full Text]
  15. Brunet A, Datta SR, Greenberg ME. Transcription-dependent and -independent control of neuronal survival by the PI3K-Akt signaling pathway. Curr Opin Neurobiol 2001;11:297–305.[CrossRef][Medline]
  16. Dijkers PF, Medema RH, Lammers JW, Koenderman L, Coffer PJ. Expression of the pro-apoptotic Bcl-2 family member Bim is regulated by the forkhead transcription factor FKHR-L1. Curr Biol 2000;10:1201–4.[CrossRef][Medline]
  17. Nakae J, Kitamura T, Silver DL, Accili D. The forkhead transcription factor Foxo1 (Fkhr) confers insulin sensitivity onto glucose-6-phosphatase expression. J Clin Invest 2001;108:1359–67.[CrossRef][Medline]
  18. Kops GJ, Dansen TB, Polderman PE, et al. Forkhead transcription factor FOXO3a protects quiescent cells from oxidative stress. Nature 2002;419:316–21.[CrossRef][Medline]
  19. Chang HW, Aoki M, Fruman D, et al. Transformation of chicken cells by the gene encoding the catalytic subunit of PI 3-kinase. Science 1997;276:1848–50.[Abstract/Free Full Text]
  20. Jimenez C, Jones DR, Rodriguez-Viciana P, et al. Identification and characterization of a new oncogene derived from the regulatory subunit of phosphoinositide 3-kinase. EMBO J 1998;17:743–53.[CrossRef][Medline]
  21. Liu W, James CD, Frederick L, Alderete BE, Jenkins RB. PTEN/MMAC1 mutations and EGFR amplification in glioblastomas. Cancer Res 1997;57:5254–7.[Abstract/Free Full Text]
  22. Maehama T, Dixon JE. PTEN: a tumour suppressor that functions as a phospholipid phosphatase. Trends Cell Biol 1999;9:125–8.[CrossRef][Medline]
  23. Cheng JQ, Godwin AK, Bellacosa A, et al. AKT2, a putative oncogene encoding a member of a subfamily of protein-serine/threonine kinases, is amplified in human ovarian carcinomas. Proc Natl Acad Sci U S A 1992;89:9267–71.[Abstract/Free Full Text]
  24. Elstrom RL, Bauer DE, Buzzai M, et al. Akt stimulates aerobic glycolysis in cancer cells. Cancer Res 2004;64:3892–9.[Abstract/Free Full Text]
  25. Plas DR, Talapatra S, Edinger AL, Rathmell JC, Thompson CB. Akt and Bcl-xL promote growth factor-independent survival through distinct effects on mitochondrial physiology. J Biol Chem 2001;276:12041–8.[Abstract/Free Full Text]
  26. Gottlob K, Majewski N, Kennedy S, Kandel E, Robey RB, Hay N. Inhibition of early apoptotic events by Akt/PKB is dependent on the first committed step of glycolysis and mitochondrial hexokinase. Genes Dev 2001;15:1406–18.[Abstract/Free Full Text]
  27. Deprez J, Vertommen D, Alessi DR, Hue L, Rider MH. Phosphorylation and activation of heart 6-phosphofructo-2-kinase by protein kinase B and other protein kinases of the insulin signaling cascades. J Biol Chem 1997;272:17269–75.[Abstract/Free Full Text]
  28. Warburg O. On the origin of cancer cells. Science 1956;123:309–14, 1956.[Free Full Text]
  29. Rathmell JC, Vander Heiden MG, Harris MH, Frauwirth KA, Thompson CB. In the absence of extrinsic signals, nutrient utilization by lymphocytes is insufficient to maintain either cell size or viability. Mol Cell 2006;6:683–92.
  30. Vander Heiden MG, Plas DR, Rathmell JC, Fox CJ, Harris MH, Thompson CB. Growth factors can influence cell growth and survival through effects on glucose metabolism. Mol Cell Biol 2001;21:5899–912.[Abstract/Free Full Text]
  31. Imlay JA, Linn S. DNA damage and oxygen radical toxicity. Science 1988;240:1302–9.[Abstract/Free Full Text]
  32. Dijkers PF, Birkenkamp KU, Lam EW, et al. FKHR-L1 can act as a critical effector of cell death induced by cytokine withdrawal: protein kinase B-enhanced cell survival through maintenance of mitochondrial integrity. J Cell Biol 2002;156:531–42.[Abstract/Free Full Text]
  33. Luo J, Manning BD, Cantley LC. Targeting the PI3K-Akt pathway in human cancer: rationale and promise. Cancer Cell 2003;4:257–62.[CrossRef][Medline]
  34. Holland EC, Celestino J, Dai C, Schaefer L, Sawaya RE, Fuller GN. Combined activation of Ras and Akt in neural progenitors induces glioblastoma formation in mice. Nat Genet 2000;25:55–7.[CrossRef][Medline]
  35. Edinger AL, Thompson CB. Akt maintains cell size and survival by increasing mTOR-dependent nutrient uptake. Mol Biol Cell 2002;13:2276–88.[Abstract/Free Full Text]
  36. Nave BT, Ouwens M, Withers DJ, Alessi DR, Shepherd PR. Mammalian target of rapamycin is a direct target for protein kinase B: identification of a convergence point for opposing effects of insulin and amino-acid deficiency on protein translation. Biochem J 1999;344 Pt 2:427–31.[CrossRef][Medline]
  37. Inoki K, Li Y, Zhu T, Wu J, Guan KL. TSC2 is phosphorylated and inhibited by Akt and suppresses mTOR signalling. Nat Cell Biol 2002;4:648–57.[CrossRef][Medline]
  38. Essers MA, de Vries-Smits LM, Barker N, Polderman PE, Burgering BM, Korswagen HC. Functional interaction between ß-catenin and FOXO in oxidative stress signaling. Science 2005;308:1181–4.[Abstract/Free Full Text]
  39. van der Horst A, Tertoolen LG, de Vries-Smits LM, Frye RA, Medema RH, Burgering BM. FOXO4 is acetylated upon peroxide stress and deacetylated by the longevity protein hSir2(SIRT1). J Biol Chem 2004;279:28873–9.[Abstract/Free Full Text]
  40. Brunet A, Sweeney LB, Sturgill JF, et al. Stress-dependent regulation of FOXO transcription factors by the SIRT1 deacetylase. Science 2004;303:2011–5.[Abstract/Free Full Text]
  41. Motta MC, Divecha N, Lemieux M, et al. Mammalian SIRT1 represses forkhead transcription factors. Cell 2004;116:551–63.[CrossRef][Medline]
  42. Finkel T, Holbrook NJ. Oxidants, oxidative stress, and the biology of ageing. Nature 2000;408:239–47.[CrossRef][Medline]
  43. Meyer M, Schreck R, Baeuerle PA. H2O2 and antioxidants have opposite effects on activation of NF-{kappa}B and AP-1 in intact cells: AP-1 as secondary antioxidant-responsive factor. EMBO J 1993;12:2005–15.[Medline]
  44. Jin J, Woodgett JR. Chronic activation of protein kinase Bß/Akt2 leads to multinucleation and cell fusion in human epithelial kidney cells: events associated with tumorigenesis. Oncogene 2005;24:5459–70.[CrossRef][Medline]
  45. Parsons MJ, Jones RG, Tsao MS, Odermatt B, Ohashi PS, Woodgett JR. Expression of active protein kinase B in T cells perturbs both T and B cell homeostasis and promotes inflammation. J Immunol 2001;167:42–8.[Abstract/Free Full Text]
  46. Rathmell JC, Elstrom RL, Cinalli RM, Thompson CB. Activated Akt promotes increased resting T cell size, CD28-independent T cell growth, and development of autoimmunity and lymphoma. Eur J Immunol 2003;33:2223–32.[CrossRef][Medline]
  47. Jones RG, Parsons M, Bonnard M, et al. Protein kinase B regulates T lymphocyte survival, nuclear factor {kappa}B activation, and Bcl-X(L) levels in vivo. J Exp Med 2000;191:1721–34.[Abstract/Free Full Text]
  48. Matsui T, Tao J, del MF, et al. Akt activation preserves cardiac function and prevents injury after transient cardiac ischemia in vivo. Circulation 2001;104:330–5.[Abstract/Free Full Text]
  49. Nagoshi T, Matsui T, Aoyama T, et al. PI3K rescues the detrimental effects of chronic Akt activation in the heart during ischemia/reperfusion injury. J Clin Invest 2005;115:2128–38.[CrossRef][Medline]
  50. Tang TT, Dowbenko D, Jackson A, et al. The forkhead transcription factor AFX activates apoptosis by induction of the BCL-6 transcriptional repressor. J Biol Chem 2002;277:14255–65.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
S. Maddika, S. Panigrahi, E. Wiechec, S. Wesselborg, U. Fischer, K. Schulze-Osthoff, and M. Los
Unscheduled Akt-Triggered Activation of Cyclin-Dependent Kinase 2 as a Key Effector Mechanism of Apoptin's Anticancer Toxicity
Mol. Cell. Biol., March 1, 2009; 29(5): 1235 - 1248.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
S. A. Buder-Hoffmann, A. Shukla, T. F. Barrett, M. B. MacPherson, K. M. Lounsbury, and B. T. Mossman
A Protein Kinase C{delta}-Dependent Protein Kinase D Pathway Modulates ERK1/2 and JNK1/2 Phosphorylation and Bim-Associated Apoptosis by Asbestos
Am. J. Pathol., February 1, 2009; 174(2): 449 - 459.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
R. C.-Y. Hui, A. R. Gomes, D. Constantinidou, J. R. Costa, C. T. Karadedou, S. Fernandez de Mattos, M. P. Wymann, J. J. Brosens, A. Schulze, and E. W.-F. Lam
The Forkhead Transcription Factor FOXO3a Increases Phosphoinositide-3 Kinase/Akt Activity in Drug-Resistant Leukemic Cells through Induction of PIK3CA Expression
Mol. Cell. Biol., October 1, 2008; 28(19): 5886 - 5898.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
L. Valenti, R. Rametta, P. Dongiovanni, M. Maggioni, A. Ludovica Fracanzani, M. Zappa, E. Lattuada, G. Roviaro, and S. Fargion
Increased Expression and Activity of the Transcription Factor FOXO1 in Nonalcoholic Steatohepatitis
Diabetes, May 1, 2008; 57(5): 1355 - 1362.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
S. Maddika, S. R. Ande, E. Wiechec, L. L. Hansen, S. Wesselborg, and M. Los
Akt-mediated phosphorylation of CDK2 regulates its dual role in cell cycle progression and apoptosis
J. Cell Sci., April 1, 2008; 121(7): 979 - 988.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
F. B. Berry, J. M. Skarie, F. Mirzayans, Y. Fortin, T. J. Hudson, V. Raymond, B. A. Link, and M. A. Walter
FOXC1 is required for cell viability and resistance to oxidative stress in the eye through the transcriptional regulation of FOXO1A
Hum. Mol. Genet., February 14, 2008; 17(4): 490 - 505.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by van Gorp, A. G.M.
Right arrow Articles by Coffer, P. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by van Gorp, A. G.M.
Right arrow Articles by Coffer, P. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online