Cancer Research SABCS Protein Translation and Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
Cancer Research 66, 11975, December 15, 2006. doi: 10.1158/0008-5472.CAN-06-1529
© 2006 American Association for Cancer Research
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Barz, T.
Right arrow Articles by Spengler, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Barz, T.
Right arrow Articles by Spengler, D.

Endocrinology

Peroxisome Proliferator-Activated Receptor {gamma} Is a Zac Target Gene Mediating Zac Antiproliferation

Thomas Barz, Anke Hoffmann, Markus Panhuysen and Dietmar Spengler

Molecular Neuroendocrinology, Max-Planck-Institute of Psychiatry, Munich, Germany

Requests for reprints: Dietmar Spengler, Molecular Neuroendocrinology, Max-Planck-Institute of Psychiatry, Kraepelinstrasse 2-10, 80804 Munich, Germany. Phone: 49-89-30622-559; Fax: 49-89-30622-605; E-mail: spengler{at}mpipsykl.mpg.de.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Zac is a C2H2 zinc finger protein, which regulates apoptosis and cell cycle arrest through DNA binding and transactivation. During tumorigenesis and in response to mitogenic activation, Zac gene expression is down-regulated in a methylation-sensitive manner. As yet, no target genes have been identified that could explain the potent antiproliferative function of Zac. Here, applying genome-wide expression analysis, we identify peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) as a new bona fide Zac target gene, which is induced by direct Zac binding to the proximal PPAR{gamma}1 promoter. We show that in human colon carcinoma cells, ZAC activates expression of PPAR{gamma} target genes in a PPAR{gamma}-dependent manner. Moreover, we show that treatment of pituitary tumor cells with octreotide, a somatostatin analogue, leads to Zac induction and subsequent Zac-dependent up-regulation of PPAR{gamma}, which thereupon mediates part of the antiproliferative activity of Zac. Our work provides a first step toward elucidating a functional relationship between Zac and PPAR{gamma} that could be relevant to the understanding of tumorigenesis and diabetes as well. (Cancer Res 2006; 66(24): 11975-82)


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Zac is a zinc finger protein, which potently induces apoptosis and cell cycle arrest and prevents tumor formation in nude mice (1, 2). Expression of Lot1, the rat orthologue of Zac, is lost during spontaneous transformation of ovary surface epithelial cells in vitro (3), whereas human ZAC, which is widely expressed in normal tissues, is frequently down-regulated in a methylation-sensitive manner in various tumors (3–7). Additionally, Zac/Lot1 expression is repressed by epidermal growth factor and Ras/jun oncogenes (8, 9), suggesting that it might be integrated in a negative feedback loop controlling cell proliferation in response to mitogen activation. Consistent with the antiproliferative role of Zac, its down-regulation by small interfering RNA (siRNA) enhances pituitary tumor cell proliferation (10). Conversely, octreotide, a somatostatin analogue, inhibits tumor cell growth by inducing Zac expression via activated glycogen synthase kinase-3ß (GSK3ß) and possibly through p53 (10, 11). In addition, Zac coactivates p53 (12), for example, to enhance transactivation of the proapoptotic gene Apaf-1 (11). These findings suggest that Zac and p53 cooperate at different levels in antiproliferation.

Zac also potently coactivates or corepresses the hormone-dependent activity of nuclear receptors, including androgen, estrogen, glucocorticoid, and thyroid hormone receptors (13); all of these are key regulators of development, homeostasis, differentiation, and cell growth. Recent data, showing tightly controlled spatio-temporal Zac expression during embryogenesis in mesenchymal and neural stem/progenitor cells, have suggested additional roles related to differentiation and development (14, 15). Consistent with this concept, other studies have disclosed that the Zac gene is maternally imprinted (16, 17) and that defects of its imprinting status underlie the etiology of transient neonatal diabetes mellitus (TNDM), an uncommon form of childhood diabetes (OMIM *601410), which probably results from a delayed maturation of pancreatic ß-cells (18, 19).

Our earlier work revealed that Zac can act as a transcription factor through its monomeric or dimeric binding to either a GC-rich palindromic DNA element or to GC-rich direct and reverse repeat elements, respectively (2, 20, 21). Zac confers transactivation in a strictly HAT-dependent manner via recruitment of p300 and the coordinated regulation of p300's substrate affinities and catalytic activity by zinc fingers 6 and 7 and its COOH terminus (22). In this way, Zac DNA binding is directly coupled to p300-HAT regulation, indicating that modification of the chromatin status may play an important role in target gene recognition and activation. However, it is far from clear how Zac exerts its antiproliferative functions because only a few potential Zac target genes involved in differentiation (PAC1 and KRT14) have been proposed until now (21, 23). Therefore, a genome-wide screen for Zac target genes should reveal the transcriptional activities responsible for biological effects of Zac and the gene networks addressed.

The transcription factor peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) is a member of the nuclear hormone receptor family. Besides its key role in adipogenesis, PPAR{gamma} has increasingly been recognized to participate in lipid metabolism, glucose homeostasis, inflammatory responses, differentiation, antiproliferation, and apoptosis (24), raising intense clinical interest on regulation of its expression and pharmacologic control of its activity. PPAR{gamma} exists as two protein isoforms, expressed from different promoters and alternatively spliced at the 5'-end of the gene, resulting in 30 additional amino acids at the NH2 terminus of PPAR{gamma}2 compared with PPAR{gamma}1 (25, 26). Whereas expression of PPAR{gamma}2 is mainly restricted to adipose tissue, PPAR{gamma}1 has also been detected in other tissues, including heart, skeletal muscle, liver, colon, kidney, spleen, pancreas, pituitary, and brain. Studies on regulation of PPAR{gamma} expression have been focused primarily on the PPAR{gamma}2 promoter in adipocyte precursor cells in terms of adipogenesis, whereas control of PPAR{gamma}1 transcription is still poorly understood.

Here, using genome-wide expression analysis, we identify PPAR{gamma} as a new bona fide Zac target gene that mediates antiproliferation in cancer cells. This functional link between Zac and PPAR{gamma} may also apply to other common diseases, in particular diabetes.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Cell culture and transfection. Cells were cultivated in DMEM with 10% FCS and penicillin/streptidin. Transfections were carried out by electroporation or Metafectene (Biontex, Munich, Germany). Inducible Zac clones of the hippocampal cell line HW3-5 (27) were generated as described previously (1) using the pCMVtetr vector (28). Proliferation rate was measured using a Coulter Counter (Beckman, Krefeld, Germany) following seeding of 2 x 103 cells in 24-well plates and cultivation in the absence or presence of tetracycline (100 ng/mL) for 10 days. 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assays were done as described (1). For transfection assays, luciferase values were normalized on ß-galactosidase activity by cotransfecting a pRK7-ß-Gal vector. All chemicals were purchased from Sigma (Taufkirchen, Germany). PSG5mPPAR{gamma}1 plasmid was generously provided by L. Michalik (University of Lausanne, Lausanne, Switzerland). See ref. 21 for Zac expression constructs.

RNA, Northern blot, microarray analysis, and reverse transcription-PCR. RNA was isolated using Trizol (Invitrogen, Karlsruhe, Germany). For Northern blot, 20 µg total RNA was separated by denaturating gel electrophoresis, blotted overnight, blocked, and hybridized in Rapid-hyb buffer (Amersham, Piscataway, NJ) to P32-random-primed cDNA. Blot was exposed to phosphoimage plate overnight and plate was scanned using a BAS reader (Fuji, Grünwald, Germany). For microarray analysis, 40 µg total RNA per sample was dye coupled using indirect labeling. To exclude dye bias, one half of each sample was coupled to Cy3 and to Cy5, respectively. The samples were hybridized on four 24k mouse cDNA arrays (Max-Planck-Institute of Psychiatry, Munich, Germany; ref. 29) for each dye coupling combination and scanned on a Perkin-Elmer Life Sciences (Rodgau-Jügesheim, Germany) ScanArray 4000 laser scanner. Reverse transcription was carried out with Omniscript reverse transcription kit (Qiagen, Hilden, Germany). One microliter of reverse transcription reaction was used as template for PCRs of 30 cycles using Taq DNA Polymerase (Fermentas, St. Leon-Rot, Germany). Quantitative PCR was done combining 2x QuantiTect SYBR Green PCR Master Mix (Qiagen), 20 pmol primers, 2 µL reverse transcription reaction, and H2O ad 20 µL. Thermal cycling was done using LightCycler 2.0 (Roche, Penzberg, Germany) with an initial activation step of 15 minutes at 95°C and 45 cycles of 15 seconds at 94°C, 30 seconds at 58°C, and 30 seconds at 72°C. PCR primer sequences are given in Supplementary List 1. Colon RNA was purchased from Clontech (Heidelberg, Germany).

Immunoblot, chromatin immunoprecipitation assay, and RNA interference. Rabbit PPAR{gamma} antibody for immunoblot was purchased from Calbiochem (Darmstadt, Germany); mouse {alpha}-Flag, ß-actin, and PTEN antibodies were from Sigma; and rabbit TSC22 and mouse KER20 antibodies were from Biozol (Eching, Germany). Rabbit POX antibody (30) was generously provided by J. Phang (NIH, Frederick, MD). Zac antibodies were generated in rabbit against fusion proteins of glutathione S-transferase and specific Zac epitopes using the following protocol: preimmunization i.d. Freund's complete adjuvant at day 1; three boosts s.c. Freund's incomplete adjuvant at days 20, 30, and 40; and bleeding at day 61. Specificity of antibodies was validated by immunoblot (Fig. 4A). Chromatin immunoprecipitation (ChIP) assay was done as described (31) using {alpha}-Zac-LPR with HW3-5 cells and {alpha}-Zac-C with SK-N-MC and GH3 cells for immunoprecipitation (preimmune sera were taken for control). PCR amplification of promoter sequences was done with AccuPrime GC-Rich DNA Polymerase (Invitrogen) and ChIP primers given in Supplementary List 1. Zac-RNA interference (RNAi) and PPAR{gamma}-RNAi experiments were done using Zac-siRNA (caugggucucuuugaggaauu) and siRNAs described previously in refs. 10 and 32, respectively.


Figure 4
View larger version (18K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 4. Zac/ZAC binds to proximal region of endogenous PPAR{gamma}1 promoter. A, specificity of {alpha}-Zac antibodies used for ChIP analysis in (B) and (C). Top, scheme of mouse Zac protein. The numbers correspond to amino acid residues. Domains missing in human ZAC and epitopes used for {alpha}-Zac antibody generation are indicated. ZF, zinc fingers; L, linker; PR, proline repeat; C, COOH terminus. Bottom, immunoblots (20 µg WCE) show specificity of {alpha}-Zac antibodies against Flag-tagged Zac/ZAC constructs transfected into LLC-PK1 cells (50 ng each). Immunoreactivity of {alpha}-Zac antibodies was compared with {alpha}-Flag antibody (1:1,000 dilution each). No signals were detected using preabsorbed antibodies or preimmune sera (data not shown). Protein marker sizes are given in kDa. B, left, ChIP assay reveals in vivo occupancy of proximal PPAR{gamma}1 promoter by Zac in mouse HW3-5 cells; right, no PCR product was detected after immunoprecipitation for a distal promoter region without Zac binding motifs, which was taken for control. Positions of primers used for PCR amplification are indicated by arrowheads in promoter schemes at the top. Ut, untransfected cells; Zac, cells transfected with Zac (1 µg); ps, IP with preimmune serum; {alpha}-Zac-LPR, IP with {alpha}-Zac-LPR antibody. C, in vivo occupancy of proximal PPAR{gamma}1 promoter by ZAC in human SK-N-MC cells revealed by ChIP assay as in (B).

 

   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Generation and characterization of inducible Zac clones. To identify Zac target genes by gene expression analysis, we first sought to find a cellular model with endogenous but modest Zac expression because high levels as found in pituitary tumor cells prevent the generation of inducible Zac clones (1). Figure 1A shows moderate Zac expression in the hippocampal cell line HW3-5 (27) as determined by Northern blot and reverse transcription-PCR (RT-PCR). The corticotroph pituitary cell line AtT-20 exhibiting high Zac expression (1, 33) and the neuroblastoma cell line Neuro-2A served as positive and negative controls, respectively. Digestion by BglII using an internal restriction site confirmed the specificity of the PCR product.


Figure 1
View larger version (30K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 1. Characterization of inducible Zac clones. A, Northern blot and RT-PCR showing endogenous Zac expression in HW3-5 cells. The corticotroph pituitary cell line AtT-20 and the neuroblastoma cell line Neuro-2A (N-2A) served as positive and negative controls, respectively. BglII digestion confirmed specificity of the HW3-5 PCR product. M, size marker. B, immunoblot [40 µg whole-cell extract (WCE)] showing increased Zac expression in inducible HW3-5 Zac clones 24 hours after tetracycline (Tc) removal. C, induced Zac expression in HW3-5 Zac clones inhibits proliferation. Cells were cultivated in the presence or absence of tetracycline and cell numbers were measured daily with a cell counter. Medium was renewed every 3rd day. Points, mean of three independent experiments for each clone; bars, SD. D, immunoblot (40 µg WCE) showing Zac induction at different time points after tetracycline removal in HW3-5 Zac clones.

 
We generated a panel of inducible HW3-5 Zac clones using a Tet-off system (28). By cultivation in the absence or presence of tetracycline, corresponding to ectopic Zac expression being switched on and off, respectively, we screened 30 clones for maximal Zac induction, which is shown for two representatives in Fig. 1B. We further analyzed the selected clones for their Zac responsiveness: typical results showed a dramatic growth inhibition by Zac from about days 3 to 4 after tetracycline removal onward, reaching a maximum ~20-fold difference in cell number at around day 8 (Fig. 1C). Finally, a time course analysis of regulated Zac expression by immunoblot revealed significantly elevated Zac levels as early as 6 hours after tetracycline removal (Fig. 1D), showing a fast and potent response.

Zac induces expression of PPAR{gamma}. Using cDNA microarrays, we did a comparative, genome-wide expression analysis of two representative inducible Zac clones cultivated for 3, 6, and 9 hours with or without tetracycline. Only genes exhibiting a >1.5-fold difference between tetracycline-positive and tetracycline-negative conditions in both clones were taken into account. Collectively, Zac induction differentially affected 127 common genes (Supplementary Table S1), belonging to different functional groups, including metabolism, transcription, proliferation, signaling/transport, and cell structure (Fig. 2A ). Among the genes showing most prominent Zac-induced expression changes was the PPAR{gamma} gene, exhibiting a >2-fold activation. We further validated PPAR{gamma} up-regulation following Zac induction: quantitative RT-PCR (qRT-PCR) analysis revealed a >1.5-fold increase in PPAR{gamma} mRNA as early as 3 hours after tetracycline removal in both clones, reaching 3.5- and 2.5-fold induction after 9 hours, respectively (Fig. 2B). At the protein level, PPAR{gamma} up-regulation was detectable 6 hours after tetracycline removal (Fig. 2B).


Figure 2
View larger version (19K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 2. Zac induces PPAR{gamma} expression. A, microarray analysis of HW3-5 Zac clones reveals genes affected by Zac induction, including the PPAR{gamma} gene (Pparg). B, increase of PPAR{gamma} expression in two different HW3-5 Zac clones at different time points after tetracycline removal, as detected by qRT-PCR and immunoblot (10 µg WCE). qRT-PCR results. Points, mean of four independent experiments done in duplicate; bars, SD. C, Zac-mediated PPAR{gamma} induction depends on an intact DNA-binding domain. Zac or the DNA-binding defective mutants ZacZF6mt or ZacZF7mt (1 µg each) were transfected in HW3-5 cells and PPAR{gamma} levels were determined by RT-PCR and immunoblot (10 µg WCE). Control experiments confirmed equal expression of Zac constructs. D, Zac-induced PPAR{gamma} expression is specific for the PPAR{gamma}1 transcript. Top, scheme of PPAR{gamma} gene with alternative promoters and resulting transcripts. Arrows, promoter regions. A1, A2, B, and 1–6, exons. Open arrowheads, positions of transcript-specific primers; closed arrowheads, transcript-unspecific primers (used in C). Bottom, RT-PCR reveals Zac DNA binding-dependent induction of PPAR{gamma}1 transcript, whereas no PCR product was detected for PPAR{gamma}2 in HW3-5 cells. 3T3 cells expressing both PPAR{gamma} isoforms were taken as positive control.

 
Because these data did not allow to discern between the transactivator or coactivator functions of Zac, we transfected parent HW3-5 cells with wild-type (WT) Zac or DNA binding-defective mutant forms (ZacZF6mt and ZacZF7mt; ref. 21). In contrast to WT Zac, neither Zac mutant induced PPAR{gamma} but rather reduced its expression as detected by RT-PCR (amplifying a transcript region common to both PPAR{gamma} isoforms) and immunoblot (Fig. 2C). These results strongly suggested that PPAR{gamma} induction by Zac requires specific DNA binding. To distinguish between regulation via the PPAR{gamma}1 and/or the PPAR{gamma}2 promoter, we carried out RT-PCR with primers specific for the respective PPAR{gamma} isoform transcripts (Fig. 2D, top, open arrowheads). Whereas we detected no PPAR{gamma}2-specific transcripts (Fig. 2D, bottom right), levels of PPAR{gamma}1 clearly confirmed Zac DNA binding-dependent induction (Fig. 2D, bottom left). These results indicate that Zac regulates PPAR{gamma} expression specifically via the PPAR{gamma}1 promoter.

Mouse and human PPAR{gamma}1 promoters are direct Zac/ZAC targets. We analyzed the highly conserved mouse and human PPAR{gamma}1 promoter sequences (25, 26) for potential Zac binding sites. Indeed, within the extremely GC-rich proximal promoter region, we identified multiple, partly overlapping Zac DNA binding motifs, resembling the consensus direct repeat type (G4N1–8G4)2 or its complement (Fig. 3A ; ref. 21). Reporter assays showed that Zac/ZAC increased the activities of mouse (26) and human PPAR{gamma}1 promoters (25) by 2- to 3-fold; when only proximal promoter sequences were used, an ~4-fold enhancement was detected (Fig. 3B). Consistent with the results described above, DNA binding-defective Zac/ZAC mutant forms completely failed to activate the PPAR{gamma}1 promoters. In addition, Zac/ZAC did not affect the activities of PPAR{gamma}2 promoter plasmids or parent vectors lacking PPAR{gamma} promoter sequences (data not shown).


Figure 3
View larger version (30K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 3. Zac/ZAC transactivates mouse and human PPAR{gamma}1 promoters. A, alignment reveals conservation (*) of GC-rich proximal PPAR{gamma}1 promoter sequences between mouse (m) and human (h). Transcriptional start sites are marked by bold letters and relative bp positions are indicated. For both species, multiple potential Zac/ZAC–binding sites resembling the idealized direct repeat type (G4N1–8G4)2 are present as exemplified in the list. B, transfection assays showing transcriptional activation of mouse and human PPAR{gamma}1 promoters by Zac/ZAC. Luciferase activity in LLC-PK1 cells, cotransfected with different PPAR{gamma}1 promoter constructs (2 µg; left columns) and Zac/ZAC (50 ng), revealed 2- to 4-fold induction (right columns) compared with mock-transfected cells. DNA binding-defective Zac/ZAC mutants ZacZF6mt and ZacZF7mt failed to activate the PPAR{gamma}1 promoter. Columns, mean of four independent experiments; bars, SD. bp positions of promoters relate to transcriptional start sites. C, PPAR{gamma}1 induction in human neuroblastoma cell line SK-N-MC by ZAC transfection (1 µg) as determined by RT-PCR and immunoblot (20 µg WCE).

 
To examine if Zac-mediated PPAR{gamma}1 induction is conserved, we transfected ZAC into the human neuroblastoma cell line SK-N-MC, which exhibits endogenous expression of both PPAR{gamma}1 (34) and ZAC (data not shown). Importantly, ZAC significantly increased PPAR{gamma} mRNA and protein levels (Fig. 3C), suggesting cross-species conservation. Next, to investigate Zac/ZAC occupancy at the endogenous PPAR{gamma}1 promoter in vivo, we carried out ChIP assays with antibodies generated against different Zac epitopes (Fig. 4A ). The ChIP assays were done with untransfected and Zac/ZAC–transfected HW3-5 and SK-N-MC cells, respectively. PCR revealed the in vivo occupancy of the proximal PPAR{gamma}1 promoter by endogenous Zac/ZAC in both cell lines (Fig. 4B and C, left, lanes 2) and a further enhancement following Zac/ZAC transfection (Fig. 4B and C, left, lanes 4). In contrast, no Zac/ZAC binding was detected for distal promoter regions lacking Zac consensus motifs (Fig. 4B and C, right). We conclude that PPAR{gamma} is a direct Zac/ZAC target gene in mouse and human cells and that transactivation is mediated via the Zac/ZAC binding sites in the proximal PPAR{gamma}1 promoter.

PPAR{gamma} mediates Zac antiproliferation. Because both Zac and PPAR{gamma} exert antiproliferation (1, 24), we asked if PPAR{gamma} mediates Zac activity. First, we tested if an increase in PPAR{gamma} levels as that induced by Zac causes antiproliferation. Performing colony formation assays, we adjusted cotransfection of PPAR{gamma} and a selectable marker gene to achieve moderately enhanced PPAR{gamma} expression (Fig. 5A and B, left, bottom ). Indeed, the increased levels of PPAR{gamma} inhibited cell growth by 20% to 30% (Fig. 5A and B, left). Interestingly, colony formation assays with Zac/ZAC in the presence of PPAR{gamma} agonists rosiglitazone (Fig. 5A and B, right) or 15-{Delta}-PGJ2 (data not shown) revealed a synergistic effect, whereas PPAR{gamma} antagonist GW9662 counteracted Zac/ZAC–induced growth inhibition (Fig. 5A and B, right compare column 2 and 6). Together, these data suggest that Zac/ZAC antiproliferation is mediated in part through the induction of PPAR{gamma} expression.


Figure 5
View larger version (25K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 5. Zac/ZAC antiproliferation is modulated by PPAR{gamma} effectors in neural cells and ZAC induces PPAR{gamma} target genes in colon carcinoma cells. A, colony formation assay with mouse HW3-5 cells. PPAR{gamma} [left; expression levels (bottom)], mock, or Zac vectors (right) were cotransfected with a puromycin resistance plasmid at a 3:1 ratio. Selection (puromycin, 2 µg/mL) was done in the presence or absence of PPAR{gamma} effectors rosiglitazone (Rosi; agonist, 5 µmol/L) and GW9662 (antagonist, 100 nmol/L), respectively. Medium was renewed every 3rd day. Colonies were stained with MTT at day 10 and counted. Growth of mock-transfected cells in the absence of PPAR{gamma} effectors was set to 100%. Columns, mean of three independent experiments; bars, SD. B, colony formation assay with human SK-N-MC cells done as in (A). C, expression of PPAR{gamma} and ZAC in human colon carcinoma cell lines. For immunoblots, 50 µg of WCE of each cell line were taken. D, ZAC induces PPAR{gamma} target genes in colon carcinoma cells in a PPAR{gamma}-dependent manner. qRT-PCR results as fold gene expression (mean values ± SD of four independent experiments done in duplicate) in ZAC-transfected versus mock-transfected colon carcinoma cells with different p53 and PPAR{gamma} status. P values according to Student's t test were ≤0.05 in all cases. mut, mutant.

 
To examine if our results also apply to non-neural cell types, we extended our study to human colon carcinoma cells, in which activation of PPAR{gamma} induces differentiation and growth arrest. As shown in Fig. 5C (top), we detected modest to high levels of PPAR{gamma} in all eight cell lines tested. Only half of them expressed ZAC mRNA (Fig. 5C, bottom left), and for two of the mRNA-positive cell lines, we were not able to detect any ZAC protein (Fig. 5C, bottom right), indicating ZAC inactivation at different levels.

Interestingly, the two cell lines expressing ZAC protein are among those exhibiting highest PPAR{gamma} levels. Therefore, we asked if ZAC induces PPAR{gamma} expression also in colon carcinoma cells and, if so, whether this regulation leads to activation of PPAR{gamma} downstream pathways. Indeed, ZAC induced the expression of PPAR{gamma} in all cell lines tested, including Caco-2, Hct-15, Hct116, HT-29, Isreco-1, and SW480 (Fig. 5D; data not shown). Moreover, classic PPAR{gamma} target genes controlling lipid metabolism, such as ADRP or L-FABP, became up-regulated in Hct116 and SW480 cells, both of which express WT PPAR{gamma}. Notably, Hct-15 cells expressing mutant PPAR{gamma} showed a weaker ZAC-induced up-regulation of these genes (Fig. 5D). Similarly, cotransfection of PPAR{gamma}-siRNA with ZAC into Hct116 cells largely suppressed induction of PPAR{gamma} target genes, indicating a PPAR{gamma}-dependent ZAC effect.

Several genes mediating differentiation and growth arrest in colon carcinoma have been identified as PPAR{gamma} targets (30, 35–37). Among these, KER20, POX, and PTEN, were induced by ZAC in Hct116 cells at the transcript and the protein level, whereas expression of TSC22 was unchanged (Fig. 5D; Supplementary Figure S1). Importantly, ZAC-induced up-regulation of POX and PTEN was preserved in p53-defective SW480, Isreco-1, and HT-29 cells (Fig. 5D; ref. 38; data not shown), indicating that the induction by ZAC is not mediated via coactivation of p53. Moreover, in agreement with above results, neither Hct-15 cells expressing mutant PPAR{gamma} (39) nor Hct116 cells treated with PPAR{gamma}-siRNA exhibited any ZAC-induced up-regulation of these PPAR{gamma} targets (Fig. 5D). In summary, these data conclusively show the activation of PPAR{gamma} downstream pathways by ZAC via induction of a functional PPAR{gamma} protein.

To investigate if this concept also applies to endogenous Zac expression, we treated the rat pituitary tumor cell line GH3 (40, 41) with the somatostatin analogue octreotide, which potently induces Zac expression through activated GSK3ß-dependent pathways (10). We detected progressively increasing Zac mRNA levels following 6, 12, and 24 hours of treatment, which was accompanied by simultaneous elevation of Zac protein levels (Fig. 6A ). Importantly, PPAR{gamma} mRNA and protein were increased after 12 and 24 hours (i.e., induction was time shifted to that of Zac; Fig. 6A). To confirm that PPAR{gamma} induction was Zac dependent, we treated GH3 cells with octreotide 24 hours after their transfection with Zac-siRNA. As shown in Fig. 6B, Zac-siRNA largely prevented octreotide-dependent Zac induction at mRNA and protein levels. Moreover, in contrast to cells transfected with scrambled siRNA, octreotide-induced PPAR{gamma} expression was strongly impaired, indicating that Zac function was necessary for the induction of PPAR{gamma}.


Figure 6
View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 6. PPAR{gamma} mediates Zac antiproliferation in response to octreotide treatment. A, PPAR{gamma} expression is enhanced in response to octreotide. RT-PCR and immunoblot showing Zac and PPAR{gamma} induction in GH3 cells at different time points of octreotide (Oct) treatment (1 µmol/L). B, octreotide-induced PPAR{gamma} expression is Zac dependent. RT-PCR and immunoblot of Zac-siRNA-transfected (100 nmol/L) GH3 cells treated with octreotide (24 hours, 1 µmol/L) 24 hours after transfection. Cells transfected with scrambled siRNA (scra) were taken for control. C, antiproliferative Zac effects are partly dependent on PPAR{gamma}. GH3 cells were treated for 48 hours with octreotide (1 µmol/L) in the presence or absence of PPAR{gamma} effectors rosiglitazone (5 µmol/L) and GW9662 (100 nmol/L), respectively. Cell viability was determined by MTT assay. Columns, mean of four independent experiments; bars, SD. *, P < 0.05; **, P < 0.01, Student's t test. D, transfection of GH3 cells with PPAR{gamma}-siRNA (100 nmol/L) partly reverses the Zac-mediated antiproliferative effect of octreotide. PPAR{gamma} levels are shown by RT-PCR and immunoblot.

 
To further examine if PPAR{gamma} mediates Zac-dependent growth inhibition in response to octreotide (10), we treated GH3 cells with octreotide in the presence or absence of PPAR{gamma} agonist rosiglitazone and antagonist GW9662, respectively. ChIP assays revealed an increased in vivo occupancy of the proximal PPAR{gamma}1 promoter by Zac in response to octreotide, which was unaffected by the PPAR{gamma} effectors (Supplementary Figure S2). Importantly, however, whereas rosiglitazone treatment synergistically enhanced the antiproliferative octreotide effect (Fig. 6C, columns 1–4), it was partly antagonized by GW9662 (Fig. 6C, column 5). Thus, the synergistic response to octreotide and rosiglitazone reflects increased levels of activated PPAR{gamma} following Zac induction.

Finally, to show that PPAR{gamma} mediates Zac antiproliferation, we treated GH3 cells with octreotide after transfection with PPAR{gamma}-siRNA. Similarly to the effect of PPAR{gamma} antagonist GW9662 (Fig. 6C) and in contrast to scrambled siRNA, PPAR{gamma}-siRNA partly reversed octreotide-induced growth inhibition (Fig. 6D). Collectively, we conclude that Zac induces PPAR{gamma} in response to octreotide, which thereupon mediates part of the antiproliferative activity of Zac.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The seven-zinc finger protein Zac is a transcriptional regulator controlling apoptosis and cell cycle arrest (1). However, until now, no Zac-regulated genes have been identified providing insight into Zac-dependent pathways in antiproliferation. Here, using genome-wide expression analysis, we identify PPAR{gamma} as the first bona fide Zac target gene with antiproliferative properties. We show that Zac binds to the proximal PPAR{gamma}1 promoter in vivo and induces PPAR{gamma} expression in several cell types (neural cells, colon carcinoma cells, and pituitary tumor cells) of different species (mouse, human, and rat). In human colon carcinoma cells, ZAC activates PPAR{gamma} downstream pathways: We detect a PPAR{gamma}-dependent, ZAC-induced up-regulation of PPAR target genes that are linked to differentiation (KER20 and TSC22; refs. 35, 36) or growth inhibition, such as the tumor suppressor gene PTEN (37) and the proapoptotic gene POX (30). Moreover, we show that PPAR{gamma} mediates Zac antiproliferation in pituitary tumor cells in response to octreotide. Thus, our study provides the first direct functional link between Zac and PPAR{gamma} and additionally assigns them a role in somatostatin receptor-dependent pathways.

Consistent with our results, showing that Zac antiproliferation is mediated by PPAR{gamma}, both proteins play a role in tumor suppression of breast cancer (4, 42–44) and pituitary adenomas (40, 41, 45, 46). Acromegalic patients suffering from growth hormone (GH)–producing pituitary tumors are routinely treated with somatostatin analogues, such as octreotide. Although improvement in the signs and symptoms of acromegaly due to normalization of GH secretion is achieved in most cases (64–74%), only ~30% of patients show tumor shrinkage (47). Interestingly, it has been shown that PPAR{gamma} ligands suppress not only GH secretion but also proliferation of pituitary tumor cells in vivo (41, 45, 46). We show here that octreotide induces PPAR{gamma} via Zac and, moreover, observe a synergistic growth inhibition by simultaneous treatment of pituitary tumor cells with octreotide and PPAR{gamma} ligands (rosiglitazone, 15-{Delta}-PGJ2). Thus, we suggest that a combined application of octreotide (to provide high PPAR{gamma} levels via Zac) and PPAR{gamma} agonists (to achieve full PPAR{gamma} activation) might be more efficient in acromegaly therapy than either treatment alone.

Besides the interconnected role in antiproliferation of Zac and PPAR{gamma}, both proteins additionally operate in controlling metabolic functions (see Introduction), which might be similarly linked. In fact, we show here that ZAC-mediated PPAR{gamma} induction activates client metabolic target genes. Zac overexpression due to imprinting defects causes TNDM, which is characterized by a temporary insulin insufficiency at around birth and a strongly increased risk for type 2 diabetes in later life. A recent study using a transgenic mouse model of TNDM indicates that this form of diabetes involves impaired pancreatic development (i.e., a decreased ß-cell number and an impaired glucose-stimulated insulin secretion in neonates and adults; ref. 19). Interestingly, PPAR{gamma} function is also critical for ß-cell proliferation and physiology: activation of PPAR{gamma} is sufficient to inhibit ß-cell proliferation and PPAR{gamma} overexpression significantly compromises glucose-stimulated insulin secretion (48–50). Conversely, elimination of PPAR{gamma} in ß-cells leads to pancreatic hyperplasia in mice, even if normal glucose homeostasis in these animals indicates compensatory mechanisms in ß-cell function (48). In view of the similar functions of Zac and PPAR{gamma} in pancreatic ß-cells, we speculate that Zac-induced PPAR{gamma} expression might also play a role in diabetic conditions, which might open new possibilities for clinical treatment.

In summary, there are several fields where the functions of Zac and PPAR{gamma} overlap, although future work is necessary to clarify the extent of their interactions in these contexts under normal and disease conditions. By identifying PPAR{gamma} as a new Zac target gene and showing that PPAR{gamma} mediates Zac antiproliferation, we present here the first direct functional link between these two factors, which might be particularly important for the understanding of their implications in cancer and diabetes.


   Acknowledgments
 
Grant support: Deutsche Forschungsgemeinschaft grant (T. Barz and D. Spengler) and European Integrated Project CRESCENDO (D. Spengler).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank A. Toniolo (University of Insubria, Varese, Italy) for the HW3-5 cell line; J.K. Reddy (Feinberg School of Medicine, Chicago, IL) and J. Auwerx (CNRS/INSERM/ULP, Illkirch, France) for the PPAR{gamma}1 promoter plasmids of mouse and human, respectively; G. Aust (Universität Leipzig, Leipzig, Germany), S. Brand (Klinikum der Universität München-GroBhadern, Munich, Germany), D. Diehl (Ludwig-Maximilian Universität, Munich, Germany), and U. Wenzel (Technische Universität München, Freising, Germany) for colon carcinoma cell lines; and J. Deussing and B. Puetz (Max-Planck-Institute of Psychiatry) for microarray development and data normalization, respectively.


   Footnotes
 
Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/).

Received 4/29/06. Revised 9/19/06. Accepted 10/17/06.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Spengler D, Villalba M, Hoffmann A, et al. Regulation of apoptosis and cell cycle arrest by Zac1, a novel zinc finger protein expressed in the pituitary gland and the brain. EMBO J 1997;16:2814–25.[CrossRef][Medline]
  2. Varrault A, Ciani E, Apiou F, et al. hZAC encodes a zinc finger protein with antiproliferative properties and maps to a chromosomal region frequently lost in cancer. Proc Natl Acad Sci USA 1998;95:8835–40.[Abstract/Free Full Text]
  3. Abdollahi A, Godwin AK, Miller PD, et al. Identification of a gene containing zinc-finger motifs based on lost expression in malignantly transformed rat ovarian surface epithelial cells. Cancer Res 1997;57:2029–34.[Abstract/Free Full Text]
  4. Bilanges B, Varrault A, Basyuk E, et al. Loss of expression of the candidate tumor suppressor gene ZAC in breast cancer cell lines and primary tumors. Oncogene 1999;18:3979–88.[CrossRef][Medline]
  5. Kamikihara T, Arima T, Kato K, et al. Epigenetic silencing of the imprinted gene ZAC by DNA methylation is an early event in the progression of human ovarian cancer. Int J Cancer 2005;115:690–700.[CrossRef][Medline]
  6. Midorikawa Y, Yamamoto S, Ishikawa S, et al. Molecular karyotyping of human hepatocellular carcinoma using single-nucleotide polymorphism arrays. Oncogene 2006;25:5581–90.[CrossRef][Medline]
  7. Murillo H, Schmidt LJ, Karter M, et al. Prostate cancer cells use genetic and epigenetic mechanisms for progression to androgen independence. Genes Chromosomes Cancer 2006;45:702–16.[CrossRef][Medline]
  8. Abdollahi A, Bao R, Hamilton TC. LOT1 is a growth suppressor gene down-regulated by the epidermal growth factor receptor ligands and encodes a nuclear zinc-finger protein. Oncogene 1999;18:6477–87.[CrossRef][Medline]
  9. Ordway JM, Williams K, Curran T. Transcription repression in oncogenic transformation: common targets of epigenetic repression in cells transformed by Fos, Ras, or Dnmt1. Oncogene 2004;23:3737–48.[CrossRef][Medline]
  10. Theodoropoulou M, Zhang J, Laupheimer S, et al. Octreotide, a somatostatin analogue, mediates its antiproliferative action in pituitary tumor cells by altering phosphatidylinositol 3-kinase signaling and inducing Zac1 expression. Cancer Res 2006;66:1576–82.[Abstract/Free Full Text]
  11. Rozenfeld-Granot G, Krishnamurthy J, Kannan K, et al. A positive feedback mechanism in the transcriptional activation of Apaf-1 by p53 and the coactivator Zac-1. Oncogene 2002;21:1469–76.[CrossRef][Medline]
  12. Huang SM, Schonthal AH, Stallcup MR. Enhancement of p53-dependent gene activation by the transcriptional coactivator Zac1. Oncogene 2001;20:2134–43.[CrossRef][Medline]
  13. Huang SM, Stallcup MR. Mouse Zac1, a transcriptional coactivator and repressor for nuclear receptors. Mol Cell Biol 2000;20:1855–67.[Abstract/Free Full Text]
  14. Valente T, Auladell C. Expression pattern of Zac1 mouse gene, a new zinc-finger protein that regulates apoptosis and cellular cycle arrest, in both adult brain and along development. Mech Dev 2001;108:207–11.[CrossRef][Medline]
  15. Valente T, Junyent F, Auladell C. Zac1 is expressed in progenitor/stem cells of the neuroectoderm and mesoderm during embryogenesis: differential phenotype of the Zac1-expressing cells during development. Dev Dyn 2005;233:667–79.[CrossRef][Medline]
  16. Arima T, Drewell RA, Arney KL, et al. A conserved imprinting control region at the HYMAI/ZAC domain is implicated in transient neonatal diabetes mellitus. Hum Mol Genet 2001;10:1475–83.[Abstract/Free Full Text]
  17. Piras G, El KA, Kozlov S, et al. Zac1 (Lot1), a potential tumor suppressor gene, and the gene for {epsilon}-sarcoglycan are maternally imprinted genes: identification by a subtractive screen of novel uniparental fibroblast lines. Mol Cell Biol 2000;20:3308–15.[Abstract/Free Full Text]
  18. Varrault A, Bilanges B, Mackay DJ, et al. Characterization of the methylation-sensitive promoter of the imprinted ZAC gene supports its role in transient neonatal diabetes mellitus. J Biol Chem 2001;276:18653–6.[Abstract/Free Full Text]
  19. Ma D, Shield JP, Dean W, et al. Impaired glucose homeostasis in transgenic mice expressing the human transient neonatal diabetes mellitus locus, TNDM. J Clin Invest 2004;114:339–48.[CrossRef][Medline]
  20. Bilanges B, Varrault A, Mazumdar A, et al. Alternative splicing of the imprinted candidate tumor suppressor gene ZAC regulates its antiproliferative and DNA binding activities. Oncogene 2001;20:1246–53.[CrossRef][Medline]
  21. Hoffmann A, Ciani E, Boeckardt J, Holsboer F, Journot L, Spengler D. Transcriptional activities of the zinc finger protein Zac are differentially controlled by DNA binding. Mol Cell Biol 2003;23:988–1003.[Abstract/Free Full Text]
  22. Hoffmann A, Barz T, Spengler D. Multitasking C2H2 Zinc fingers link Zac DNA binding to coordinated regulation of p300-histone acetyltransferase activity. Mol Cell Biol 2006;26:5544–57.[Abstract/Free Full Text]
  23. Hoffmann A, Ciani E, Houssami S, Brabet P, Journot L, Spengler D. Induction of type I PACAP receptor expression by the new zinc finger protein Zac1 and p53. Ann N Y Acad Sci 1998;865:49–58.[CrossRef][Medline]
  24. Rosen ED, Spiegelman BM. PPAR{gamma}: a nuclear regulator of metabolism, differentiation, and cell growth. J Biol Chem 2001;276:37731–4.[Free Full Text]
  25. Fajas L, Auboeuf D, Raspe E, et al. The organization, promoter analysis, and expression of the human PPAR{gamma} gene. J Biol Chem 1997;272:18779–89.[Abstract/Free Full Text]
  26. Zhu Y, Qi C, Korenberg JR, et al. Structural organization of mouse peroxisome proliferator-activated receptor {gamma} (mPPAR{gamma}) gene: alternative promoter use and different splicing yield two mPPAR{gamma} isoforms. Proc Natl Acad Sci USA 1995;92:7921–5.[Abstract/Free Full Text]
  27. Kuwahara C, Takeuchi AM, Nishimura T, et al. Prions prevent neuronal cell-line death. Nature 1999;400:225–6.[CrossRef][Medline]
  28. Hoffmann A, Villalba M, Journot L, Spengler D. A novel tetracycline-dependent expression vector with low basal expression and potent regulatory properties in various mammalian cell lines. Nucleic Acids Res 1997;25:1078–9.[Abstract/Free Full Text]
  29. Landgrebe J, Welzl G, Metz T, et al. Molecular characterisation of antidepressant effects in the mouse brain using gene expression profiling. J Psychiatr Res 2002;36:119–29.[CrossRef][Medline]
  30. Pandhare J, Cooper SK, Phang JM. Proline oxidase, a proapoptotic gene, is induced by troglitazone: evidence for both peroxisome proliferator-activated receptor {gamma}-dependent and -independent mechanisms. J Biol Chem 2006;281:2044–52.[Abstract/Free Full Text]
  31. Hsu MC, Chang HC, Hung WC. HER-2/neu represses the metastasis suppressor RECK via ERK and Sp transcription factors to promote cell invasion. J Biol Chem 2006;281:4718–25.[Abstract/Free Full Text]
  32. Wada K, Nakajima A, Katayama K, et al. Peroxisome proliferator-activated receptor {gamma}-mediated regulation of neural stem cell proliferation and differentiation. J Biol Chem 2006;281:12673–81.[Abstract/Free Full Text]
  33. Pagotto U, Arzberger T, Ciani E, et al. Inhibition of Zac1, a new gene differentially expressed in the anterior pituitary, increases cell proliferation. Endocrinology 1999;140:987–96.[Abstract/Free Full Text]
  34. Bakopanos E, Silva JE. Thiazolidinediones inhibit the expression of ß3-adrenergic receptors at a transcriptional level. Diabetes 2000;49:2108–15.[Abstract/Free Full Text]
  35. Gupta RA, Brockman JA, Sarraf P, Willson TM, DuBois RN. Target genes of peroxisome proliferator-activated receptor {gamma} in colorectal cancer cells. J Biol Chem 2001;276:29681–7.[Abstract/Free Full Text]
  36. Gupta RA, Sarraf P, Brockman JA, et al. Peroxisome proliferator-activated receptor {gamma} and transforming growth factor-ß pathways inhibit intestinal epithelial cell growth by regulating levels of TSC-22. J Biol Chem 2003;278:7431–8.[Abstract/Free Full Text]
  37. Patel L, Pass I, Coxon P, Downes CP, Smith SA, Macphee CH. Tumor suppressor and anti-inflammatory actions of PPAR{gamma} agonists are mediated via upregulation of PTEN. Curr Biol 2001;11:764–8.[CrossRef][Medline]
  38. Rodrigues NR, Rowan A, Smith ME, et al. p53 mutations in colorectal cancer. Proc Natl Acad Sci USA 1990;87:7555–9.[Abstract/Free Full Text]
  39. Gupta RA, Sarraf P, Mueller E, et al. Peroxisome proliferator-activated receptor {gamma}-mediated differentiation: a mutation in colon cancer cells reveals divergent and cell type-specific mechanisms. J Biol Chem 2003;278:22669–77.[Abstract/Free Full Text]
  40. Pagotto U, Arzberger T, Theodoropoulou M, et al. The expression of the antiproliferative gene ZAC is lost or highly reduced in nonfunctioning pituitary adenomas. Cancer Res 2000;60:6794–9.[Abstract/Free Full Text]
  41. Bogazzi F, Ultimieri F, Raggi F, et al. PPAR{gamma} inhibits GH synthesis and secretion and increases apoptosis of pituitary GH-secreting adenomas. Eur J Endocrinol 2004;150:863–75.[Abstract]
  42. Mueller E, Sarraf P, Tontonoz P, et al. Terminal differentiation of human breast cancer through PPAR{gamma}. Mol Cell 1998;1:465–70.[CrossRef][Medline]
  43. Elstner E, Muller C, Koshizuka K, et al. Ligands for peroxisome proliferator-activated receptor{gamma} and retinoic acid receptor inhibit growth and induce apoptosis of human breast cancer cells in vitro and in BNX mice. Proc Natl Acad Sci USA 1998;95:8806–11.[Abstract/Free Full Text]
  44. Suzuki T, Hayashi S, Miki Y, et al. Peroxisome proliferator-activated receptor {gamma} in human breast carcinoma: a modulator of estrogenic actions. Endocr Relat Cancer 2006;13:233–50.[Abstract/Free Full Text]
  45. Heaney AP, Fernando M, Melmed S. PPAR-{gamma} receptor ligands: novel therapy for pituitary adenomas. J Clin Invest 2003;111:1381–8.[CrossRef][Medline]
  46. Heaney AP, Fernando M, Yong WH, Melmed S. Functional PPAR-{gamma} receptor is a novel therapeutic target for ACTH-secreting pituitary adenomas. Nat Med 2002;8:1281–7.[CrossRef][Medline]
  47. Freda PU. Somatostatin analogs in acromegaly. J Clin Endocrinol Metab 2002;87:3013–8.[Free Full Text]
  48. Rosen ED, Kulkarni RN, Sarraf P, et al. Targeted elimination of peroxisome proliferator-activated receptor {gamma} in ß cells leads to abnormalities in islet mass without compromising glucose homeostasis. Mol Cell Biol 2003;23:7222–9.[Abstract/Free Full Text]
  49. Ito E, Ozawa S, Takahashi K, et al. PPAR-{gamma} overexpression selectively suppresses insulin secretory capacity in isolated pancreatic islets through induction of UCP-2 protein. Biochem Biophys Res Commun 2004;324:810–4.[CrossRef][Medline]
  50. Ravnskjaer K, Boergesen M, Rubi B, et al. Peroxisome proliferator-activated receptor {alpha} (PPAR{alpha}) potentiates, whereas PPAR{gamma} attenuates, glucose-stimulated insulin secretion in pancreatic ß-cells. Endocrinology 2005;146:3266–76.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
M. A. Lanaspa, A. Andres-Hernando, C. J. Rivard, Y. Dai, N. Li, and T. Berl
ZAC1 Is Up-regulated by Hypertonicity and Decreases Sorbitol Dehydrogenase Expression, Allowing Accumulation of Sorbitol in Kidney Cells
J. Biol. Chem., July 24, 2009; 284(30): 19974 - 19981.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
M. Frontini, M. Vijayakumar, A. Garvin, and N. Clarke
A ChIP-chip approach reveals a novel role for transcription factor IRF1 in the DNA damage response
Nucleic Acids Res., March 1, 2009; 37(4): 1073 - 1085.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
A. Hoffmann and D. Spengler
A New Coactivator Function for Zac1's C2H2 Zinc Finger DNA-Binding Domain in Selectively Controlling PCAF Activity
Mol. Cell. Biol., October 1, 2008; 28(19): 6078 - 6093.
[Abstract] [Full Text] [PDF]

Home page
 Mol Cancer ResHome page
P.-Y. Liu, J. Y.-H. Chan, H.-C. Lin, S.-L. Wang, S.-T. Liu, C.-L. Ho, L.-C. Chang, and S.-M. Huang
Modulation of the Cyclin-Dependent Kinase Inhibitor p21WAF1/Cip1 Gene by Zac1 through the Antagonistic Regulators p53 and Histone Deacetylase 1 in HeLa Cells
Mol. Cancer Res., July 1, 2008; 6(7): 1204 - 1214.
[Abstract] [Full Text] [PDF]

Home page
 Endocr. Rev.Home page
L. Aguilar-Bryan and J. Bryan
Neonatal Diabetes Mellitus
Endocr. Rev., May 1, 2008; 29(3): 265 - 291.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Barz, T.
Right arrow Articles by Spengler, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Barz, T.
Right arrow Articles by Spengler, D.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online