| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Cell, Tumor, and Stem Cell Biology |
Departments of 1 Anatomy and Structural Biology, 2 Molecular Pharmacology, 3 Pathology, and 4 Epidemiology and Population Health, Albert Einstein College of Medicine, Bronx, New York
Requests for reprints: Jeffrey E. Segall, Department of Anatomy and Structural Biology, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, NY 10801. Phone: 718-430-4237; Fax: 718-430-8996; E-mail: segall{at}aecom.yu.edu.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Epidermal growth factor (EGF) receptor (EGFR) family members (ErbBs) are currently major targets of anticancer strategies (24) and identifying the contributions of ErbBs to tumor cell metastasis is important for the development of useful anti-ErbB therapies. The EGFR family has four members: ErbB1 (EGFR, HER-1), ErbB2 (HER-2/neu), ErbB3, and ErbB4 (5, 6). Twenty percent to 30% of human breast cancers have been found to overexpress ErbB2, and ErbB2 overexpression is significantly associated with decreased disease-free survival and overall survival (3, 7, 8). Normal activation of ErbB2 occurs through formation of heterodimers with other EGFR family members that can bind ligands, such as ErbB3 (9, 10). ErbB3 binds heregulin but is unable to stimulate cellular responses on its own due to a defective kinase domain. Binding of heregulin to ErbB3 can generate ErbB3/ErbB2 heterodimers, leading to activation of mitogen-activated protein kinase (MAPK), phosphatidylinositol 3-kinase (PI3K), and src (6, 11). Mutation of the ErbB3 sites coupling to these pathways reduces heregulin-induced DNA synthesis and colony formation in soft agar by NIH 3T3 cells (12). Suppression of either ErbB2 or ErbB3 function in SKBR3, MB361, or BT474 cell lines results in cell cycle arrest in G1 (13) in vitro. In vivo, suppression of heregulin expression in MDA-MB-231 cells blocks tumor growth (14), and tumors induced by expression of ErbB2 in the mammary gland often show overexpression of ErbB3 (15).
Heregulin also stimulates chemotaxis and invasion mediated by ErbB3/ErbB2 heterodimers (16, 17). Activation of the PI3K and MAPK pathways can be important for cell motility and chemotaxis (1822). The products of PI3K regulate the cytoskeleton through Rho family G proteins as well as Akt (2325). MAPKs can regulate adhesion dynamics directly and regulate gene expression patterns important for motility and invasion (2629). Thus, ErbB3-dependent motility responses could contribute to breast cancer metastasis independent of effects on tumor growth.
To evaluate the potential contributions of ErbB3-dependent motility responses to tumor metastasis, we evaluated the effects of overexpressing ErbBs on the metastatic properties of MDA-MB-435 (30, 31) and MTLn3 mammary tumor cells (32). We find that enhancing ErbB3/ErbB2 signaling increases intravasation and metastasis without affecting primary tumor growth. Suppression of ErbB3 expression significantly reduced intravasation and metastasis. Examination of a tumor progression microarray indicates that ErbB2 and ErbB3 expression associate positively with the presence of metastases and not with primary tumor size. We propose that ErbB3-dependent signaling can contribute to metastasis through enhancing tumor cell motility and intravasation. Our results support the development of therapies targeting cell motility to aid in the prevention and treatment of metastasis.
| Materials and Methods |
|---|
|
|
|---|
-MEM (Life Technologies, Gaithersburg, MD) supplemented with 5% fetal bovine serum and penicillin/streptomycin solution (Life Technologies). The empty retroviral expression vector pLXSN and pLXSN containing the human cDNAs for ErbB1, ErbB2, ErbB3, and ErbB4 were received from David Stern (Yale University, New Haven, CT; ref. 34) and packaged in the Phoenix cell line provided by Dr. Garry P. Nolan (Stanford University, Stanford, CA; ref. 35), and cells were infected in growth medium in the presence of 4 µg/mL polybrene (Sigma, St. Louis, MO). Pools of at least 100 transductants were selected by growing in .8 mg/mL geneticin (Sigma) medium. The pools were stored as frozen stocks and used for all experiments within 10 passages. Expression of transduced ErbBs measured by fluorescence-activated cell sorting (FACS) showed no change with passage in vitro and after growth to form primary tumors in vivo.
Flow cytometric analysis. Cells (
106) were incubated with specific anti-ErbB1, anti-ErbB2, anti-ErbB3, and anti-ErbB4 antibodies (NeoMarkers, Fremont, CA) for 1 hour at 4°C. After three washes in cold PBS containing 0.2% bovine serum albumin (BSA), cells were incubated with R-phycoerythrin-conjugated goat anti-mouse IgG (Jackson ImmunoResearch Laboratories, West Grove, PA) for 1 hour at 4°C. After washing, cells were suspended in PBS containing 0.2% BSA, and fluorescence was measured by flow cytometry. Cells incubated with secondary antibody only were measured at the same time to serve as background control. To semiquantitatively measure the expression level of ErbBs, standard curves were obtained by using the LinearFlow Orange Flow Cytometry Intensity Calibration kit (Molecular Probes, Eugene, OR) with the mean values of cells incubated with secondary antibody alone subtracted.
Spontaneous and experimental metastasis assays. All animal studies described here were done according to the protocols approved by the Institutional Animal Care and Use Committee of Albert Einstein College of Medicine. To measure spontaneous metastasis, the tumor cells were grown to 70% to 85% confluence before being harvested. Cells were detached by incubation in DPBS + 2 mmol/L EDTA, scraping with a rubber policeman, then centrifuged, and resuspended in DPBS at 107 cells/mL. MDA-MB-435 (
106) or MTLn3 (5 x 105) cells were injected into the right fourth mammary fat pad from the head of 5- to 7-week-old female BALB/c severe combined immunodeficient (SCID) mice (National Cancer Institute, Bethesda, MD) in 100 µL PBS with calcium and magnesium through a 25-gauge needle. Tumor growth rate was monitored at weekly intervals by measuring in two dimensions, and tumor volumes were calculated using the formula: length x width2 / 2. At the end point for spontaneous metastasis, mice were anesthetized with Aerrane (isoflurane, Baxter Pharmaceutical Products, Inc., Deerfield, IL). The right chest was exposed by a simple skin flap surgery. Blood was taken from the right atrium via heart puncture with a 25-gauge needle and 1 mL syringe coated with heparin and containing 0.1 mL of heparin. Blood (0.2-1.05 mL) was harvested. The blood was immediately plated into 150-mm-diameter dishes filled with 5% fetal bovine serum in
-MEM. The next day, the plates were rinsed with fresh medium and replaced with fresh medium containing 0.8 mg/mL geneticin to selectively grow tumor cells. After 4 (for MTLn3) to 10 (for MDA-MB-435) days, all colonies in the dish were counted. Tumor blood burden was calculated as total colonies in the dish divided by the volume of blood taken.
To measure experimental lung metastasis, 5 x 105 cells were injected into the lateral tail veins of 5- to 7-week-old female BALB/c SCID mice (National Cancer Institute). Eight weeks (for MDA-MB-435) or 2 weeks (for MTLn3) after injection, the mice were sacrificed, and the lungs were removed, fixed in formalin, and stained H&E sections were counted for metastasis as described below.
Tumor histology and quantitative assessment of metastasis. Samples were fixed in 10% neutral formalin buffer, embedded in paraffin, and sectioned at 5 µm and stained by H&E. For each lung sample, all micrometastases were counted at x10 magnification and the total lung area was measured using a UMAX PowerLook III color scanner (UMAX Technologies, Inc., Dallas, TX) and Adobe Photoshop version 5.5 software. Briefly, after scanning lung sections, the cross-sectional area in pixels were measured using the luminosity window in Adobe PhotoShop. The actual lung tissue area was calculated with the formula: area (mm2) = (number of pixels) x 0.00179. The efficiency of lung metastasis was expressed in number of metastases per square centimeter of lung area for each animal. Mean and SE were then calculated for each cell line.
Determination of blood vessel density in primary tumor. Sections (5 µm) of paraffin-embedded primary tumor samples were stained with rabbit anti-human von Willebrand factor as primary antibody (DAKO, Carpinteria, CA). Sections stained without primary antibody served as controls. DAKO peroxidase substrate kit 3,3'-diaminobenzidine (DAB) was used following the manufacturer's instructions for identifying antibody binding. Vessels were counted microscopically using a defined magnification (x200). Blood vessels in five nonoverlapping fields per tumor lesion were counted and averaged. Vascular counts included complete vessel cross-sections, partial vessel cross-sections, and small groups of positive cells. Twelve tumors from 435-PL and 10 tumors from 435-B2 were analyzed. Statistical analysis was done by unpaired t test.
Microchemotaxis chamber assay. A 48-well microchemotaxis chamber (Neuroprobe, Cabin John, MD) was used as described previously (36), except that L15 containing 0.35% BSA was used instead of
-MEM. For measurement of migration in response to heregulin, filters were coated with 20 µg/mL fibronectin (Sigma), whereas for measurement of responses to EGF or BTC, filters were coated with 27 µg/mL rat tail collagen (BD Biosciences, Palo Alto, CA). After inserting the filters in the chamber, 20,000 cells were plated into the wells of the upper chamber. The chambers were incubated for 4 hours at 37°C before analyzing the number of cells crossing the filter.
In vivo invasion assay. Cell collection into needles placed into anesthetized animals was carried out as described previously (37, 38). In brief, 33-gauge needles are filled with Matrigel diluted 1:10 with L15-BSA, 0.01 mmol/L EDTA (pH 7.4) with or without heregulin ß1 (HRGß1). The mouse is anesthetized and laid on its back, and a small patch of skin was removed to expose the tumor. Three 25-gauge needles with inserted blocking wires are inserted into the tumor using a specially designed holder and a micromanipulator. The guide wires are then removed and the 33-gauge needles were inserted through the 25-gauge needles into the tumor. The animal is kept under anesthesia for 4 hours, after which the needles are removed, the contents were expelled onto a coverslip and stained with 4',6-diamidino-2-phenylindole, and cells were counted.
Immunoblotting. MDA-MB-435 cells were grown to 70% confluency in a 10-cm cell culturing dish and then incubated with serum-free medium overnight. The medium was changed to fresh serum-free medium with or without 50 ng/mL HRGß1 and cells were incubated for 0 to 15 minutes in a 5% CO2 incubator. Cells were then washed twice with cold PBS containing 1 mmol/L vanadate and lysed in 1 mL lysis buffer [50 mmol/L Tris-HCl (pH 7.5), 1% Triton X-100, 5 mmol/L EGTA, 150 mmol/L NaCl, 10 mmol/L sodium phosphate, 10 mmol/L NaF, 1 mmol/L sodium vanadate, 1 mmol/L benzamidine, 10 µg/mL leupeptin, and 10 µg/mL aprotinin]. The plates were scraped with a rubber policeman and incubated on ice for 30 minutes. The lysate was precleared by centrifugation at 15,000 rpm for 15 minutes. Lysate protein concentration was estimated using BCA protein assay reagent (Pierce, Rockford, IL). Protein (20 µg) of each sample was loaded and separated by SDS-PAGE and transferred electrophoretically to nitrocellulose membranes, which were immunoblotted by appropriate antibodies followed by incubation with horseradish peroxidase (HRP)conjugated secondary antibodies. The following antibodies were used: anti-ß-actin (Sigma); anti-phosphotyrosine (PY20, BD Biosciences, San Diego, CA); anti-ErbB3 monoclonal and anti-phospho-ErbB3 (Tyr1289, Cell Signaling, Beverly, MA); anti-ErbB4 (Upstate, Lake Placid, NY); anti-src (Santa Cruz Biotechnology, Santa Cruz, CA); polyclonal antiextracellular signal-regulated kinase (ERK) 1/2, anti-phospho-ERK (Thr202/Tyr204), anti-Akt, and anti-phospho-Akt (Ser473) antibodies (Cell Signaling); anti-paxillin (Santa Cruz Biotechnology), and anti-phospho-paxillin (BioSource International, Camarillo CA). The blots were developed by the enhanced chemiluminescence (ECL) technique (ECL kit, Amersham Pharmacia Biotech) according to the manufacturer's instructions.
Immunoprecipitation. Cells were lysed in lysis buffer [50 mmol/L Tris-HCl (pH 7.5), 5 mmol/L EGTA, 1 mmol/L EDTA, 1% Triton X-100, 1 mmol/L phenylmethylsulfonyl fluoride, 2 mmol/L sodium orthovanadate, 50 mmol/L NaF, protease inhibitors]. The protein concentration was measured by BCA protein assay kit. Equal amounts of cell lysates either with or without HRGß1 (12.5 nmol/L) treatment were incubated with anti-ErbB2 for 2 hours at 4°C followed by an incubation with protein G agarose beads (Upstate) for 1 hour. Samples were washed five times in cell lysis buffer, resuspended in 30 µL of 2x SDS sample buffer, and boiled for 5 minutes. The proteins were then resolved using a SDS-PAGE gel, transferred to a nitrocellulose membrane, and detected by Western blotting as described above.
ErbB3 RNA interference experiments. RNA interference transient transfections were done first to find the most efficient knockout sequences. Transfection-ready small interfering RNA (siRNA) duplexes against human ErbB3 were ordered from Dharmacon, Inc. (Lafayette, CO). The ErbB3 siRNA kit contains four distinct individual RNA duplexes and a mixture of siRNA duplexes (SMARTpool, Dharmacon). Cells at 60% confluency were transfected in penicillin/streptomycin-free medium with the four individual siRNA duplexes and the pooled SMARTselected siRNA by using Oligofectamine (Invitrogen, Grand Island, NY) following the manufacturer's recommended protocol. Two oligonucleotides (D-003127-05 and D-003127-07) found to suppress ErbB3 expression and inhibit responses to HRGß1 in vitro were cloned into pSUPER.retro.puro (OligoEngine, Seattle, WA) as small hairpin RNAs (shRNA). A control sequence (39) that did not suppress ErbB3 expression was also cloned as a shRNA into pSUPER.retro.puro as control. Retroviruses containing the pSUPER.retro constructs were packaged using Phoenix cells. Viral supernatants were harvested, and 435-B2 and 435-PL recipient cells were infected in the presence of 4 µg/mL polybrene. After infection for 24 hours, resistant cells were selected with puromycin (3 µg/mL). FACS analysis of the stable transductants indicated that the D-003127-05 shRNA produced the strongest suppression of ErbB3 expression, and this line was used for in vivo studies. The sense strand sequences used for the shRNAs for the most strongly stably suppressed were GATCCCCAAGAGGATGTCAACGGTTATTCAAGAGATAACCGTTGACATCCTCTTTTTTTA (B3 shRNA) and GATCCCCAATTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAATTTTTTTA (control shRNA).
Immunohistochemical staining for ErbB2 and ErbB3. Cooperative Breast Cancer Tissue Resource (CBCTR) Breast Tissue Progression microarrays were acquired from the CBCTR of the National Cancer Institute.5 These tissue microarrays are designed by National Cancer Institute statisticians for high statistical power to detect differences in prevalence among the three stages of primary invasive ductal breast cancer: node negative, node positive, and metastatic disease. Each tissue microarray block consists of 288 0.6-mm cores representing 252 breast cancer and normal breast specimens plus replicate cores of 4 different cell lines and 4 different nonbreast tissue controls. Two sequential slices from two replicate blocks containing different cores from the same primary tumors were used to stain for ErbB2 and ErbB3.
Paraffin sections were melted at 60°C for 30 minutes, deparaffinized in xylene, rehydrated through graded alcohols to water, and washed in TBS. Slides were pretreated with 3% H2O2 for 10 minutes and washed in TBS. Antigen retrieval was done in a steamer for 20 minutes using 10 mmol/L sodium citrate buffer (pH 6.0). Slides were then cooled for 30 minutes at room temperature. Slides were incubated in blocking solution (5% normal goat serum, 2% BSA) for 1 hour at room temperature before incubating with antibodies for 1 hour at room temperature, anti-erbB3 (Santa Cruz Biotechnology) at 1:100 or anti-ErbB2 (A0485, DAKO) at 1:250, diluted in blocking solution. Slides were then washed four times, 3 minutes each with TBS before applying biotin-labeled secondary antibody (goat anti-rabbit, DAKO) at 1:500 for 1 hour at room temperature. Slides were washed again and incubated for 30 minutes with the avidin-biotin-HRP complex as directed by DAKO. Slides were washed in TBS, and DAB was applied (DAKO) for 5 minutes (ErbB3) or 4 minutes (ErbB2) before lightly counterstaining with Harris hematoxylin (Poly Scientific, Bay Shore, NY). These concentrations and incubation times were determined to give a wide range of detections: weak positives were visible, but strong positives were not overstained. Control tests using blocking peptides (ErbB3 C-17 P, Santa Cruz Biotechnology) inhibited all ErbB3 staining.
The slides were scored independently by two pathologists, and the average scores were used for statistical analysis. Of the 192 tumors potentially available on the slides, 164 had at least one high-quality core that was successfully stained for both ErbB2 and ErbB3. The scores for these tumors were then correlated with clinical variables.
Statistics. The Wilcoxon rank sum test was used to determine two-tailed probabilities as given in the figure legends and text and to compare ErbB2 and ErbB3 expression levels between patients with metastases and patients without metastases. Multivariate analyses with metastases (yes/no) as the outcome were conducted by fitting logistic regression models. Model selection was based on backward elimination with P < 0.10 as the criterion for retaining covariates. The magnitude of the association between ErbB2 and ErbB3 with age and tumor size was estimated by the Spearman rank correlation coefficient. Adjustment for confounders was accomplished by fitting linear regression models to the rank transformed data. Statistical significance was defined as P < 0.05.
| Results |
|---|
|
|
|---|
|
|
To test whether the increased intravasation might be due to increased angiogenesis, we evaluated microvessel density as detected by immunostaining for von Willebrand factor. There was no significant difference (21 ± 4 for 435-PL versus 28 ± 5 for 435-B2; P < 0.22); thus, changes in angiogenesis are unlikely to explain the increased intravasation observed for 435-B2 tumors. Examination of overall tumor structure by H&E staining also did not show dramatic differences between tumors from any of the cell lines.
Because proliferation and angiogenesis were not enhanced in 435-B2 cells, it is possible that the increased intravasation reflects increased motility or chemotaxis. To determine whether chemotactic response to a particular heterodimer pair formed by ErbB2 was correlated with enhanced intravasation and metastasis, we evaluated responses to EGF, HRGß1, and BTC (17). EGF responses are mediated by ErbB1, HRGß1 responses are mediated by ErbB3 and ErbB4, and BTC responses are mediated by ErbB1 and ErbB4 (5). Both 435-B1 and 435-B2 lines showed increased chemotactic responses to EGF (Fig. 2A), arguing against responses to EGF via ErbB1 homodimers or ErbB1/ErbB2 heterodimers being responsible for the increased metastatic capabilities of the 435-B2 line (because 435-ErbB1 tumors do not show increased metastasis). Chemotactic responses to BTC were increased in the 435-B1 and 435-B4 lines (Fig. 2B) but not in 435-B2, arguing against ErbB4-ErbB2 heterodimer or ErbB4 homodimer signaling being important for the increased metastasis of the 435-B2 line.
|
The above results argue for an ErbB3/ErbB2 heterodimer being important for enhanced intravasation and metastasis in the 435-B2 cells. To determine if there were greater levels of an active ErbB3/ErbB2 heterodimer in 435-B2 cells after HRGß1 stimulation, we immunoprecipitated ErbB2 and blotted the immunoprecipitates using an antibody specific for ErbB3 phosphorylation at Tyr1289 (Fig. 3A). In 435-B2 cells, we found a strong association of ErbB2 with phospho-ErbB3 after HRGß1 stimulation, consistent with increased heterodimer formation in 435-B2 cells. To directly test whether ErbB3 is required for HRGß1 responses and metastasis in 435-B2 cells, we reduced ErbB3 levels using siRNA. Sequences from the Dharmacon SMARTpool collection specific for ErbB3 were tested and cloned as shRNAs into pSUPER.retro as well as a control sequence that did not alter ErbB3 expression. Retroviruses were generated and used to transduce the 435-B2 line, and the shRNA most effective at stably suppressing ErbB3 expression was studied further. ErbB1 and ErbB2 expression was altered by <10%, whereas ErbB3 expression was reduced by >80% (Fig. 3B). ErbB3 suppression reduced ErbB3 tyrosine phosphorylation and Akt activation induced by HRGß1 (Fig. 3C) and reduced HRGß1 chemotaxis by 90% (Fig. 3D). This confirms that the enhanced signaling and chemotaxis in response to HRGß1 in 435-B2 cells is mediated by an ErbB3/ErbB2 heterodimer. In vivo, suppression of ErbB3 delayed tumor growth, but at equivalent tumor sizes, both intravasation (Fig. 3E) and metastasis (Fig. 3F) were strongly reduced for 435-B2 tumors expressing ErbB3 shRNA compared with tumors expressing control shRNA. Thus, ErbB3 is critical for the high rates of intravasation and metastasis exhibited by 435-B2 cells.
|
|
Increased expression of ErbB2 and ErbB3 correlates with increased human breast cancer metastasis. The results in the previous sections suggest that higher levels of ErbB2 and ErbB3 in combination could enhance tumor cell metastasis independent of primary tumor growth in human breast cancer. To test this hypothesis, we made use of a breast cancer progression microarray provided by the CBCTR, a resource supported by the National Cancer Institute. The microarray contains cores from 192 invasive human primary breast cancers. Clinical data for the tumors includes patient age, race, primary tumor size, estrogen receptor (ER), progesterone receptor (PR), positive lymph nodes, and distant metastasis. We stained the tissue microarrays in duplicate for ErbB2 and ErbB3.
ErbB2 staining tended to be membrane associated, whereas ErbB3 staining was more cytoplasmic, with some membrane association present (Fig. 5A). The stain intensity and localization was graded independently by two pathologists on a 0 (no staining) to 5 (maximum staining) scale. Overall staining intensity scores by the two pathologists were well correlated, whereas membrane staining scores were not; therefore, overall staining was used for statistical analysis.
|
coefficient = 0.31; P < 0.0001). The bivariate and multivariate associations of ErbB2 and ErbB3 staining scores with the following clinical variables were evaluated: tumor size, nodal status, number of nodes, ER status, PR status, grade, and metastases. The staining intensities for ErbB2 and ErbB3 were significantly elevated in patients with metastases compared with patients without metastases (P = 0.02 for both ErbB and ErbB3). Interestingly, a significantly greater association with metastasis was seen for the sum: ErbB2 + ErbB3 (P = 0.005), indicating that both ErbB2 and ErbB3 provide information regarding the metastatic capability of the primary tumor, consistent with the predictions from our animal model studies. ErbB2 and ErbB3 were also positively associated with metastases in multivariate analyses (P = 0.0083 and 0.017, respectively) after adjusting for tumor size and ER status, the only confounders that were retained in the final logistic regression models. We also evaluated the sum (ErbB2 + ErbB3) in the multivariate model, and the predictive value of the sum was again more highly significant than either one individually (P = 0.0027), consistent with both ErbB2 and ErbB3 independently providing information regarding the metastatic capability of the primary tumor. On segregating the data into groups corresponding to high, intermediate, and low ErbB2 (Supplementary Table S1), we found that the presence of metastases was most significantly correlated with ErbB3 expression in tumors with intermediate levels of ErbB2. A possible interpretation of this result is that, at low levels of ErbB2, ErbB3 is unable to signal (consistent with its limited kinase activity), whereas high levels of ErbB2 may produce autoactivation of ErbB2 that does not require interaction with ErbB3.
The associations of ErbB2 and ErbB3 with ER status, PR status, grade, node status, and number of nodes were not significant. ErbB3 staining correlated positively with age (
= 0.20; P = 0.009) and negatively with tumor size (
= 0.16; P < 0.041), but these associations did not retain significance in multivariate regression analyses. ErbB2 was not significantly associated with other clinical variables.
| Discussion |
|---|
|
|
|---|
In this model, the endogenous ErbB2 and ErbB3 levels in the MDA-MB-435 and MTLn3 cells are sufficient for full stimulation of tumorigenesis in vivo but are suboptimal for maximal chemotaxis and invasion [low levels of ErbB2 in MDA-MB-435 cells (16, 22, 43) and low levels of ErbB3 in MTLn3 cells]. Overexpressing the limiting partner (ErbB2 in MDA-MB-435 cells or ErbB3 in MTLn3 cells) enables stronger signaling resulting in enhanced chemotaxis and invasion without affecting primary tumor growth. The enhanced chemotaxis and invasion could reflect both immediate ErbB activation (17) and ErbB-induced alterations in gene expression patterns (44, 45). Suppression of ErbB3 in 435-B2 cells reduces the signaling efficiency below that which is optimal for tumorigenesis, resulting in slowed tumor growth. However, even on growth of the tumors to a large size, intravasation and metastasis remain reduced as predicted if an ErbB3-dependent intravasation step is required for efficient metastasis of the 435-B2 cells.
The tumor tissue microarray analysis of human breast cancer expression of ErbB3 and ErbB2 is consistent with this model in two ways. First, the combination of ErbB2 and ErbB3 was more significantly associated with the presence of metastasis than the level of ErbB2 or ErbB3 staining alone, consistent with the importance of a complex of ErbB2 and ErbB3 for invasion and metastasis. Second, there was no correlation between tumor size and the combination of ErbB2 and ErbB3, suggesting that these tumors have progressed past the early steps in tumorigenesis. In addition, ErbB3 expression levels may be useful in prognosis of metastasis for tumors that have intermediate levels of ErbB2.
This model has implications for therapies that are targeted to inhibition of ErbB2 or ErbB3 (and by extension other receptors that have functions in both growth control and chemotaxis). It suggests that, for the subset of tumors in which ErbB3/ErbB2 signaling is near the threshold required for tumorigenesis, partial suppression of either ErbB2 or ErbB3 could directly affect tumor growth as is seen for a limited number of tumors. However, for the subset of tumors that have moderate to high levels of both ErbB2 and ErbB3, partial suppression might only affect chemotaxis and invasion without affecting tumor growth, similar in action to metastasis suppressors (46). Such tumors would be scored as nonresponding in terms of growth but might still be inhibited in terms of invasion. Our results support the targeting of ErbB3-dependent signaling for inhibition of invasion in tumors overexpressing ErbB2 and ErbB3. Suppression of invasion would contribute to limiting the further spread of tumor fragments and metastases that remain after removal of the primary tumor and could be useful in combination with treatments that directly target growth (47). In addition, patients with tumors having high levels of ErbB3 in the presence of intermediate to high levels of ErbB2 are at higher risk of metastasis and thus might need to be more aggressively treated.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank the members of the Cox, Segall, and Condeelis laboratories and Glenn Kroog for comments and suggestions and David Stern, Bristol Myers Squibb, and Gary P. Nolan for generously providing the reagents.
| Footnotes |
|---|
5 http://www-cbctr.ims.nci.nih.gov/tma.html. ![]()
Received 2/17/05. Revised 10/11/05. Accepted 11/18/05.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
B. Schoeberl, E. A. Pace, J. B. Fitzgerald, B. D. Harms, L. Xu, L. Nie, B. Linggi, A. Kalra, V. Paragas, R. Bukhalid, et al. Therapeutically Targeting ErbB3: A Key Node in Ligand-Induced Activation of the ErbB Receptor-PI3K Axis Sci. Signal., June 30, 2009; 2(77): ra31 - ra31. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Kedrin, J. Wyckoff, P. J. Boimel, S. J. Coniglio, N. E. Hynes, C. L. Arteaga, and J. E. Segall ERBB1 and ERBB2 Have Distinct Functions in Tumor Cell Invasion and Intravasation Clin. Cancer Res., June 1, 2009; 15(11): 3733 - 3739. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Hernandez, T. Smirnova, D. Kedrin, J. Wyckoff, L. Zhu, E. R. Stanley, D. Cox, W. J. Muller, J. W. Pollard, N. Van Rooijen, et al. The EGF/CSF-1 Paracrine Invasion Loop Can Be Triggered by Heregulin {beta}1 and CXCL12 Cancer Res., April 1, 2009; 69(7): 3221 - 3227. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Pu, C. D. McCaig, L. Cao, Z. Zhao, J. E. Segall, and M. Zhao EGF receptor signalling is essential for electric-field-directed migration of breast cancer cells J. Cell Sci., October 1, 2007; 120(19): 3395 - 3403. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ollier, C. Robert-Granie, L. Bernard, Y. Chilliard, and C. Leroux Mammary Transcriptome Analysis of Food-Deprived Lactating Goats Highlights Genes Involved in Milk Secretion and Programmed Cell Death J. Nutr., March 1, 2007; 137(3): 560 - 567. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Folgiero, R. E. Bachelder, G. Bon, A. Sacchi, R. Falcioni, and A. M. Mercurio The {alpha}6{beta}4 Integrin Can Regulate ErbB-3 Expression: Implications for {alpha}6{beta}4 Signaling and Function Cancer Res., February 15, 2007; 67(4): 1645 - 1652. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Yen, Z. Cao, X. Wu, E. R.Q. Ingalla, C. Baron, L. J.T. Young, J. P. Gregg, R. D. Cardiff, A. D. Borowsky, C. Sweeney, et al. Loss of Nrdp1 Enhances ErbB2/ErbB3-Dependent Breast Tumor Cell Growth Cancer Res., December 1, 2006; 66(23): 11279 - 11286. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |