Cancer Research Cancer Research Funding Available  Protein Translation and Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lacher, M. D.
Right arrow Articles by Korn, W. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lacher, M. D.
Right arrow Articles by Korn, W. M.
[Cancer Research 66, 1648-1657, February 1, 2006]
© 2006 American Association for Cancer Research


Experimental Therapeutics, Molecular Targets, and Chemical Biology

Transforming Growth Factor-ß Receptor Inhibition Enhances Adenoviral Infectability of Carcinoma Cells via Up-Regulation of Coxsackie and Adenovirus Receptor in Conjunction with Reversal of Epithelial-Mesenchymal Transition

Markus D. Lacher1, Maarit I. Tiirikainen6, Elise F. Saunier3, Christine Christian1, Mario Anders7, Martin Oft8, Allan Balmain3,4, Rosemary J. Akhurst3,5 and Wolfgang Michael Korn1,2

Divisions of 1 Gastroenterology and 2 Hematology/Oncology; 3 Cancer Research Institute; Departments of 4 Anatomy and 5 Biochemistry, University of California, San Francisco, California; 6 Cardiovascular Research Center, John A. Burns School of Medicine, University of Hawaii at Manoa, Honolulu, Hawaii; 7 Department of Hepatology and Gastroenterology, Charité, Campus Virchow-Klinikum, Humboldt University, Berlin, Germany; and 8 DNAX Research Institute of Molecular and Cellular Biology, Palo Alto, California

Correspondence: Wolfgang Michael Korn, University of California, San Francisco, Comprehensive Cancer Center, Box 0128, San Francisco, CA 94143-0128. Phone: 415-502-2844; Fax: 415-502-4787; E-mail: mkorn{at}cc.ucsf.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Expression of the Coxsackie and Adenovirus Receptor (CAR) is frequently reduced in carcinomas, resulting in decreased susceptibility of such tumors to infection with therapeutic adenoviruses. Because CAR participates physiologically in the formation of tight-junction protein complexes, we examined whether molecular mechanisms known to down-regulate cell-cell adhesions cause loss of CAR expression. Transforming growth factor-ß (TGF-ß)–mediated epithelial-mesenchymal transition (EMT) is a phenomenon associated with tumor progression that is characterized by loss of epithelial-type cell-cell adhesion molecules (including E-cadherin and the tight junction protein ZO-1), gain of mesenchymal biochemical markers, such as fibronectin, and acquisition of a spindle cell phenotype. CAR expression is reduced in tumor cells that have undergone EMT in response to TGF-ß. This down-regulation results from repression of CAR gene transcription, whereas altered RNA stability and increased proteasomal protein degradation play no role. Loss of CAR expression in response to TGF-ß is accompanied by reduced susceptibility to adenovirus infection. Indeed, treatment of carcinoma cells with LY2109761, a specific pharmacologic inhibitor of TGF-ß receptor types I and II kinases, resulted in increased CAR RNA and protein levels as well as improved infectability with adenovirus. This was observed in cells induced to undergo EMT by addition of exogenous TGF-ß and in those that were transformed by endogenous autocrine/paracrine TGF-ß. These findings show down-regulation of CAR in the context of EMT and suggest that combination of therapeutic adenoviruses and TGF-ß receptor inhibitors could be an efficient anticancer strategy. (Cancer Res 2006; 66(3): 1648-57)


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Adenovirus-based antitumor agents with unmodified fiber-knob protein rely on binding to the Coxsackie and Adenovirus Receptor (CAR) for their entry into target cells. CAR is a transmembrane protein that takes part in formation of tight-junction cell-cell adhesion complexes (1). In vitro and in vivo studies have shown that loss of CAR expression results in reduced uptake of the virus (25). Conversely, transgenic mouse models expressing CAR in all tissues allowed for adenovirus infection of previously inaccessible tissue types (6). We9 and others have shown that CAR expression is frequently reduced in gastrointestinal, breast, prostate, and bladder cancer, likely resulting in reduced susceptibility to virus-induced cell killing by therapeutic adenoviruses (79). Whereas detailed information about the molecular mechanisms resulting in reduced CAR levels is still lacking, recent published studies are beginning to shed light on this question. Up-regulation of CAR and increased adenoviral infectability of tumor cells has been reported following treatment with histone deacetylase inhibitors (10, 11). We hypothesized that factors known to decrease expression of cell-cell adhesion molecules (e.g., E-cadherin and ZO-1) could be responsible for repressing the tight-junction protein CAR (12). Indeed, we previously reported that activation of signaling through the Raf-MEK-Erk signal transduction cascade reduces CAR and that, vice versa, pharmacologic inhibition of such signals restores CAR expression in epithelial cancer cell lines, including lines derived from colon and pancreatic cancer (13). Because therapeutics targeting inhibition of histone-deacetylase, Raf, and mitogen-activated protein/extracellular signal-regulated kinase kinase (MEK) have been developed and are currently undergoing clinical testing, these findings support the development of combined therapeutic approaches using adenoviral-based and small-molecule-targeted therapies.

Cell-cell adhesion molecules are regulated through a variety of pathways in addition to the Raf-MEK-Erk pathway. In particular, there is strong evidence that this pathway cooperates with the transforming growth factor-ß (TGF-ß) signaling pathway in repressing epithelial-type cell adhesion molecules (1416). Moreover, in cell culture systems, TGF-ß can promote a phenotypic switch of epithelial tumor cells into a mesenchymal phenotype, a phenomenon known as epithelial-mesenchymal transition (EMT; refs. 1417). This process is not only characterized by striking morphologic changes but also by the loss of expression of epithelial-type cell adhesion molecules, including E-cadherin and ZO-1, accompanied by de novo expression of mesenchymal markers, such as vimentin, N-cadherin, and smooth-muscle actin. It has been hypothesized that these TGF-ß-dependent effects, together with increased cell mobility and invasiveness, promote the development of tumor metastases, which is supported by studies in a variety of animal models of cancer, including skin, breast, and colon cancer models (1821).

TGF-ß-dependent down-regulation of CAR has been reported before (22). We hypothesized that loss of CAR expression occurs in the context of TGF-ß-dependent EMT. Here, we show that this is indeed the case and describe TGF-ß-dependent transcriptional repression of CAR as one mechanism of CAR regulation. The recent development of small-molecule inhibitors of TGF-ß receptor kinases allowed us to test whether inhibition of TGF-ß signaling in cancer cells that have undergone EMT can reverse this process, increase CAR expression, and enhance susceptibility to adenovirus infection.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell lines. Normal murine mammary gland [NMuMG; American Type Culture Collection (ATCC), Rockville, MD], Panc-1 (ATCC), Chinese hamster ovary (CHO) cells expressing ectopic human CAR (CHO+) or containing vector without insert (CHO–; gifts from Dr. J. Bergelson, Children's Hospital of Philadelphia, Philadelphia, PA), E4 mouse skin cancer cells, as well as EpXT mammary tumor cells (14, 15) were grown in DMEM supplemented with 10% fetal bovine serum (FBS). Phase-contrast images were taken on a DC330 charge coupled device camera (Dage-MTI, Inc., Michigan City, IN)/Zeiss Axiovert S100TV (Zeiss, Thornwood, NY) microscope system.

TGF-ß and small molecule inhibitors. NMuMG and Panc-1 (5-30% confluence) cells were stimulated with 5 ng/mL hTGF-ß1 (R&D Systems, Minneapolis, MN) or with its solvent [4 mmol/L HCl/0.1% (w/v) bovine serum albumin] for up to 6 days. The TGF-ßRI/II kinase inhibitor LY2109761 (a kind gift from J. Yingling) was used at a concentration of 20 µmol/L, the minimal dose required to completely inhibit Smad2 phosphorylation in EpXT cells. Control samples not treated with LY2109761 were supplemented with its solvent, DMSO. Medium containing TGF-ß and/or LY2109761 was replaced daily or every 2nd day. To investigate a possible effect of TGF-ß on CAR protein stability, NMuMG cells were pretreated with 5 ng/mL hTGF-ß1 for 3 days, then incubated for 6 hours with the proteasome inhibitors lactacystin or MG132 (both 10 µmol/L, both Calbiochem/EMD Biosciences, Inc., La Jolla, CA). To test whether the TGF-ß-induced down-regulation of CAR protein is phosphatidylinositol 3-kinase (PI3K)–dependent, NMuMG cells were treated for 3 days with the PI3K inhibitor LY294002 (10 µmol/L; Cell Signaling Technology, Inc., Beverly, MA), in the presence or absence of TGF-ß.

Immunoblotting. Cells were lysed in 1% (v/v) NP40 (IGEPAL, Sigma-Aldrich, St. Louis, MO), 0.5% sodium deoxycholate (deoxycholic acid; Sigma-Aldrich), 0.1% (w/v) SDS, and Complete/Mini protease inhibitor cocktail (Roche, Indianapolis, IN). Cell lysates were separated on NuPAGE 4-12% polyacrylamide Bis-Tris gels/MES-SDS buffer (Invitrogen, San Diego, CA), transferred onto Immobilon-P polyvinylidene fluoride (PVDF) membranes, (Millipore, Billerica, MA), and blocked in 5% milk/TBS containing 0.1% Tween 20 (TBST). Primary rabbit polyclonal antibodies used were anti-CAR H-300 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA), anti-CAR Ab72 (13), anti-phospho-Smad2 (Ser465/467; Cell Signaling Technology), anti-total Smad2 (Zymed, South San Francisco, CA), anti-fibronectin (H-300; Santa Cruz Biotechnology). Primary mouse monoclonal antibodies used were anti-E-cadherin (BD Transduction Laboratories, Lexington, KY), anti-total Smad2/3 (BD Transduction Laboratories), and anti-ß-actin (Sigma-Aldrich). Both primary and secondary antibodies were diluted in 0.5% milk/TBST. Secondary antibodies were horseradish peroxidase conjugated, allowing detection via enhanced chemiluminescence (Amersham Pharmacia, Piscataway, NJ).

Flow cytometry for cell surface CAR. Cells were washed with PBS and detached in 0.05% trypsin (University of California, San Francisco, Cell Culture Facility, San Francisco, CA). Incubations in primary anti-CAR mouse monoclonal antibody RmcB (2) and secondary AlexaFluor 488 goat anti-mouse F(ab')2 antibody fragments (Molecular Probes, Eugene, OR) were carried out for 45 and 30 minutes, respectively, at 4°C. Integrity of the cells was controlled via propidium iodide staining. Flow cytometry was done on a FACSCalibur cytometer (Becton, Dickinson and Company, Franklin Lakes, NJ) and analyzed with CellQuest Pro software (Becton, Dickinson and Company).

Immunofluorescence. Immunofluorescence staining was done as described before (13). Cells were grown on 60 mm plastic cell culture dishes and fixed with 1.6% paraformaldehyde. CAR protein was detected using anti-CAR Ab72 antibody. Nuclear counterstaining was done using Hoechst 33258 solution.

Adenovirus infections. Stimulation with TGF-ß and LY2109761 resulted in differences in local cell densities and, thus, potentially interferes with access of CAR to the adenovirus. To avoid this bias, Panc-1 and EpXT cells were infected in suspension: Cells were washed in PBS, detached in 0.05% trypsin (University of California, San Francisco, Cell Culture Facility, San Francisco, CA or Invitrogen), diluted in DMEM + 10% FBS, counted, and adjusted to equal cell concentrations. One volume of cell suspension was then mixed with 1 volume of Ad-GFP, a nonreplicating E1A-deleted adenovirus encoding enhanced green fluorescent protein (eGFP; ref. 13), diluted in DMEM + 2% FBS. For both Panc-1 and EpXT infections, medium was replaced by regular growth medium following attachment of the cells [i.e., 6 hours (Panc-1) or 10 hours (EpXT) after addition of the virus]. Cells were washed 24 hours (Panc-1) or 50 hours (EpXT) after infection, then trypsinized and analyzed for eGFP expression on a FACSCalibur cytometer (Becton, Dickinson and Company) and CellQuest Pro software (Becton, Dickinson and Company). Infections of (adherent) CHO, E4, and NMuMG cells with the replication-incompetent firefly luciferase–encoding adenovirus (Ad-Luc) were done in DMEM + 2% FBS. Four hours after addition of the virus to the cells, virus was replaced by regular growth medium. Cells were lysed 48 hours after infection. Luminescence was evaluated via the Luciferase Assay System from Promega (Madison, WI).

Real-time PCR and assessment of mRNA stability. RNA was extracted using the RNeasy Midi/Mini kits (Qiagen, Valencia, CA). For the NMuMG cell TGF-ß study (Fig. 5A), RNA was treated with DNase I (Roche), then subjected to a cleanup with the RNeasy kit. Reverse transcription of 500 ng RNA was carried out by using random primers and M-MLVRT reverse transcriptase (both Invitrogen). Real-time PCR was done with AmpliTaq Gold (Roche/Applied Biosystems, Foster City, CA) on a 7900 HT Sequence Detection System (ABI PRISM, Applied Biosystems). For the Panc-1 cell TGF-ß study (Fig. 5B) and the NMuMG cell RNA stability assay (Fig. 5C), RNA quality evaluation on a Bioanalyzer (Agilent Technologies, Palo Alto, CA), reverse transcription, and TaqMan PCR were done at the University of California, San Francisco, Comprehensive Cancer Center Genome Core (San Francisco, CA). Primer/probes for CAR were described before (13). For normalization, mouse ß-glucuronidase (ß-gus; ref. 23) with CGAACCAGTCACCGCTGAGAGTAATCG as probe and CTCATCTGGAATTTCGCCGA and GGCGAGTGAAGATCCCCTTC as primers or human ß-gus with TGAACAGTCACCGACGAGAGTGCTGG as probe and CTCATTTGGAATTTTGCCGATT and CCGAGTGAAGATCCCCTTTTTA as primers as well as mouse 18S rRNA with TGCTGGCACCAGACTTGCCCTC as probe and CGGCTACCACATCCAAGGAA and GCTGGAATTACCGCGGCT as primers were used. For mouse plasminogen activator inhibitor-1 (PAI-1), TCAACTACACTGAGTTCACCACCCCCG was used as probe, and ACCGTCTCTGTGCCCATGAT and CAGCGATGAACATGCTGAGG were used as primers. For mouse c-myc, CAGACAGCCACGACGATGCCCC was used as probe, and CTGTTTGAAGGCTGGATTTCCT and TTCCTGTTGGTGAAGTTCACGT were used as primers. Real-time PCR for human E-cadherin was done by using the CDH1 (D: Hs00170423_m1) Assay-On-Demand (Applied Biosystems). For assessment of mRNA stability, NMuMG cells, seeded in 60 mm dishes at a density of 4 x 105 cells per dish, were initially stimulated for 72 hours with TGF-ß, then treated with 1 µg/mL actinomycin D (Invitrogen), alone or in combination with TGF-ß for 1.5, 3, and 6 hours. At each time point, cells were washed twice with cold PBS, then lysed in 350 µL lysis buffer RLT (RNeasy kit; Qiagen).


Figure 5
View larger version (22K):
[in this window]
[in a new window]
 
Figure 5. Assessment of CAR mRNA expression and stability in response to TGF-ß. Real-time PCR analysis for CAR mRNA expression in NMuMG (A) and Panc-1 cells (B). A, cells were treated with TGF-ß for 2, 4, and 6 days. Expression levels were normalized against ß-gus mRNA levels. B, cells were initially stimulated with or without TGF-ß for 3 days, then for additional 3 days in the presence or absence of LY2109761. Expression levels were normalized against ß-gus mRNA levels and indicated as percentage of untreated CAR and E-cadherin levels. C, RNA stability analysis. RNA of NMuMG cells that were pretreated for 72 hours with (Figure 5) or without (CTRL, {blacktriangleup}) TGF-ß was harvested at the indicated time points after addition of actinomycin D. Real-time PCR was then done for c-myc, CAR, and PAI-1. The latter gene was analyzed as a positive control for TGF-ß signaling, and c-myc, due to its short half-life, for efficacy of the actinomycin D used. Because actinomycin D inhibits RNA synthesis globally, CAR, c-myc, and PAI-1 expression levels were normalized against 18S rRNA levels, which are not expected to be significantly reduced over the time course done.

 

    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Loss of CAR expression occurs during EMT. To study the regulation of CAR in cells undergoing EMT, we chose murine NMuMG cells, which readily undergo EMT following TGF-ß treatment (24, 25). Indeed, treatment of NMuMG cells with TGF-ß resulted in transition from an epithelial to a mesenchymal phenotype, which was characterized by the occurrence of spindle-like cells (Fig. 1A). We also used Panc-1 cells as a model of human pancreatic cancer because this disease is currently a target for investigational adenoviral therapies. Moreover, Panc-1 cells were previously found to undergo TGF-ß-dependent EMT (17). Similar to NMuMG cells, Panc-1 cells show a mesenchymal switch that becomes morphologically apparent after 2 days of exposure to TGF-ß and is fully established 1 day later (data not shown; ref. 17). This phenotype was maintained after continued exposure to TGF-ß (Fig. 1B).


Figure 1
View larger version (57K):
[in this window]
[in a new window]
 
Figure 1. Phenotypic changes in cells treated with TGF-ß and a specific inhibitor of TGF-ß receptor I and II kinase activity, LY2109761. A, phase-contrast photographs of NMuMG cells treated with TGF-ß for 2 days (x100 magnification) and 4 days (x320 magnification). B, Panc-1 cells were treated with or without TGF-ß for 3 days, followed by additional 3 days of costimulation with the TGF-ß receptor kinase inhibitor. Magnification, x320.

 
Activation of the TGF-ß signaling pathway was assessed by phosphorylation of Smad2 (Fig. 2). Smad2 phosphorylation was accompanied by biochemical changes that are indicative of EMT and included up-regulation of fibronectin and down-regulation of E-cadherin protein expression. In agreement with our hypothesis, CAR protein expression was also reduced in total protein extracts as determined by Western blot analysis for both NMuMG cells (Fig. 2A) as well as for Panc-1 cells (Fig. 2B). This was confirmed by immunofluorescence microscopy (see below; Fig. 3B).


Figure 2
View larger version (44K):
[in this window]
[in a new window]
 
Figure 2. Western blot analysis of the mesenchymal marker fibronectin, the epithelial markers E-cadherin and CAR, as well as of phosphorylated and total Smad-2. A, corresponding to the microscopic images shown in Fig. 1A, total protein was harvested from untreated (control) or TGF-ß-treated NMuMG cells. CAR was detected with the H-300 antibody. ß-actin loading controls are shown for each independent membrane. B, Panc-1 cells were treated with or without TGF-ß in the presence or absence of the TGF-ß receptor kinase inhibitor LY2109761. CAR detection was carried out with the Ab72 antibody.

 

Figure 3
View larger version (52K):
[in this window]
[in a new window]
 
Figure 3. Assessment of CAR expression at the surface of pancreatic cancer cells treated with TGF-ß and/or LY2109761. A, flow cytometry. Panc-1 cells were treated for 3 days with or without TGF-ß. LY2109761 was then added for an additional 3 days. Flow cytometry was done on nonpermeabilized cells following staining with the monoclonal anti-CAR antibody RmcB (red line). Unstained but identically treated cells were used as control (black line). B, immunofluorescence. Panc-1 cells were treated as described above. Cells were fixed with paraformaldehyde and stained with the anti-CAR antibody Ab72. Hoechst 33258 was used as a nuclear counterstain.

 
TGF-ß inhibition reverses EMT and up-regulates CAR. We next asked whether pharmacologic inhibition of the TGF-ß receptor kinases prevents and potentially reverses EMT and CAR repression. To address this question, we took advantage of LY2109761, a novel small-molecule inhibitor specific for TGF-ß receptor types I and II kinases. The IC50 values of this compound for inhibiting autophosphorylation of TGF-ß receptor type I/ALK5 and TGF-ß receptor type II are 0.07 and 0.322 µmol/L, respectively (26).10

All experiments regarding Panc-1 cells described in this article were done as follows: First, a mesenchymal phenotype was induced by treatment with TGF-ß for 3 days. Second, LY2109761 was added, in the continued presence of TGF-ß, for another 3 days. LY2109761 treatment reestablished the epithelial phenotype (Fig. 1B). In addition to inhibition of Smad2 phosphorylation, we found that CAR and E-cadherin protein levels increased while fibronectin expression decreased, which is indicative for reversal of EMT (Fig. 2B). In addition, the phenotypic switch of NMuMG cells was prevented by combined exposure of these cells to TGF-ß and the TGF-ß receptor inhibitor (data not shown), which is in agreement with observations made previously using the related compounds LY364947 and LY580276 (27).

Because presence of CAR at the cell surface is essential for its function as a receptor for adenovirus and as a cell-cell adhesion molecule, we asked if the reduced level of total CAR protein expression in Panc-1 cells following TGF-ß treatment is associated with a loss of CAR protein at the cell surface. To test this, we stained nonpermeabilized Panc-1 cells for CAR using a monoclonal anti-CAR antibody (RmcB; ref. 2) and did fluorescence-activated cell sorting analysis. As shown in Fig. 3A, treatment with TGF-ß reduced CAR cell surface protein levels dramatically. CAR levels at the cell surface were fully restored in Panc-1 cells that were initially treated for 3 days with TGF-ß alone, followed by another 3 days of cotreatment with LY2109761 (Fig. 3A). This was confirmed by immunofluorescence microscopy (Fig. 3B). Panc-1 cells were grown on 60 mm plastic tissue culture dishes and stimulated as above (i.e., first with TGF-ß alone and then with LY2109761 in the continued presence of TGF-ß). In untreated cells, CAR was strongly expressed at sites of cell-cell interaction, whereas it was dramatically reduced in cells that had been treated with TGF-ß alone. Addition of the TGF-ß receptor inhibitor restored CAR expression at cell junctions. Interestingly, the cell surface signal was slightly weaker in cells treated with LY2109761 compared with untreated cells and showed a less continuous, somewhat disrupted appearance. At this point, it remains unclear whether these differences in staining patterns are a result of incomplete restoration of CAR expression or, for example, a consequence of off-target effects of the inhibitor.

Loss of CAR expression in response to TGF-ß is independent of proteasome activity and PI3K signaling. To begin to develop an understanding of the molecular mechanisms underlying the observed loss in CAR protein expression, we first analyzed possible TGF-ß-mediated effects on protein stability, because one well-documented mechanism by which TGF-ß treatment reduces levels of a variety of proteins is the activation of proteasomal degradation of such target molecules. For example, enhanced proteasome-dependent degradation of estrogen receptor {alpha} in response to TGF-ß has been shown in breast cancer cells (28). Similarly, TGF-ß treatment has been shown to induce proteasomal degradation of the proto-oncogene SnoN, which is a required step for transcriptional repression of c-myc by TGF-ß (29). We therefore ascertained whether the specific proteasome inhibitors MG132 and lactacystin prevented TGF-ß-dependent reduction in CAR protein levels in NMuMG cells. Cells prestimulated for 3 days in the presence or absence of TGF-ß were treated with MG132 or lactacystin. As shown in Fig. 4, both compounds had no effect on CAR protein levels and did not prevent TGF-ß-dependent down-regulation of CAR protein. These findings indicate that loss of CAR protein following TGF-ß treatment is independent of proteasomal activity. Because it has been shown previously that the PI3K signal transduction pathway may be required for TGF-ß-mediated EMT (24), we tested whether treatment of NMuMG cells with the PI3K inhibitor LY294002 prevented CAR repression by TGF-ß. Cells were stimulated with TGF-ß alone or in combination with LY294002 for 3 days. As shown in Fig. 4, CAR levels decreased in TGF-ß-treated cells, despite inhibition of PI3K signaling, indicating that TGF-ß-induced down-regulation of CAR is PI3K independent.


Figure 4
View larger version (22K):
[in this window]
[in a new window]
 
Figure 4. Effect of proteasome inhibitors on CAR expression in TGF-ß-treated cells. NMuMG cells were treated with or without TGF-ß for 3 days in the presence or absence of the specific proteasome inhibitors MG132 or lactacystin. To investigate whether PI3K signaling contributes to TGF-ß-induced down-regulation of CAR protein, NMuMG cells were treated for 3 days with the PI3K inhibitor LY294002 alone, as well as in combination with TGF-ß (last two lanes). CAR was detected with the H-300 antibody. ß-actin levels are shown as loading control.

 
Transcriptional regulation of CAR in response to TGF-ß treatment. TGF-ß elicits many of its cellular effects through transcriptional repression or activation of target genes through the Smad signaling cascade. For example, PAI-1 is strongly activated in response to TGF-ß treatment (30), whereas the E-cadherin gene can be transcriptionally repressed by TGF-ß as cells undergo EMT. The latter effect has been shown to be mediated through the transcriptional repressors snail and SIP1 (31, 32). We therefore assessed the effect of TGF-ß treatment on CAR mRNA expression. NMuMG and Panc-1 cells were treated with TGF-ß and RNA was harvested for real-time reverse transcription-PCR analysis. We found that in both cell systems, TGF-ß treatment resulted in a clear reduction in CAR mRNA levels (Fig. 5A and B). Because CAR expression is possibly also regulated through cell density, it is noteworthy that CAR mRNA expression was already diminished after 24 hours of treatment (NMuMG cells; data not shown) at a time where the difference in cell confluence (as a consequence of growth-inhibitory effects of TGF-ß) is minimal.

TGF-ß has also been found to regulate gene expression by interfering with mRNA stability, for instance in the case of the S100A8 gene (33). We tested this possibility by measuring CAR mRNA levels in NMuMG cells. Cells were first stimulated with or without TGF-ß for 72 hours in the absence of actinomycin D, then, for the time course shown in Fig. 5C, in the presence of this drug. Actinomycin D is a global inhibitor of gene transcription. A change in the slope of decay of a given RNA species in response to a stimulus in the presence of actinomycin D is, therefore, indicative of altered RNA stability. As depicted in Fig. 5C, no difference in the slope of the curve was found for CAR mRNA of NMuMG cells treated with or without TGF-ß, indicating that TGF-ß does not affect CAR mRNA stability. Activation of TGF-ß signaling by the ectopically added TGF-ß was confirmed by measuring PAI-1 mRNA levels, as they are reported to be enhanced following TGF-ß stimulation (30). The mRNA of c-myc was reported to be very unstable (34), thus being a suitable positive control for the efficacy of the actinomycin D applied (Fig. 5C).

Pharmacologic restoration of adenovirus infection rates following TGF-ß–induced EMT. We next asked whether the reduction of cell surface CAR in cells treated with TGF-ß translates into reduced susceptibility to adenovirus infection and if this could be overcome pharmacologically, which is of particular interest from a clinical perspective. This is underscored by the high percentage of clinical tumor samples from gastrointestinal and other malignancies with reduced or lost CAR expression (7, 8).9 To measure the efficiency of adenovirus infection in cells treated with or without TGF-ß, we used two different nonreplicating adenoviruses—Ad-GFP, expressing GFP under the control of a constitutively active cytomegalovirus (CMV) promoter, and Ad-Luc, encoding firefly luciferase as well under a constitutive promoter. As shown in Fig. 6A, treatment of both E4 mouse skin tumor cells as well as NMuMG normal mouse mammary cells with TGF-ß resulted in a clear reduction of infectability as measured by luciferase activity. A similar reduction in infectability was found in Panc-1 cells upon treatment with TGF-ß and infection with Ad-GFP (Fig. 6B). It is noteworthy that the measurement of GFP expression was done in TGF-ß-treated cells 24 hours after infection and removal of TGF-ß. Therefore, it is unlikely that the reduced GFP levels are a result of different GFP expression levels due to TGF-ß-mediated repression of the CMV promoter. When Panc-1 cells were treated with LY2109761 in the continued presence of TGF-ß, infectability increased significantly. However, the levels of GFP-positive cells observed in cells treated with TGF-ß plus LY2109761 did not achieve those observed in untreated cells. This discrepancy might be a reflection of the differences in the CAR expression patterns between inhibitor-treated cells and control cells observed by immunofluorescence (Fig. 3B). Alternatively, prolonged treatment might be necessary to fully restore cell surface CAR levels.


Figure 6
View larger version (14K):
[in this window]
[in a new window]
 
Figure 6. Susceptibility of E4, NMuMG, and Panc-1 cells to adenovirus infection in response to TGF-ß and the TGF-ß receptor kinase inhibitor LY2109761. CHO cells constitutively expressing CAR (CHO+), or containing control plasmid (CHO–), were used as controls. A, E4 and NMuMG cells were treated with TGF-ß for 3 days, then infected with Ad-Luc at the indicated multiplicities of infection (MOI). Cells were lysed 48 hours after infection. Indicated luciferase activities were normalized against cell number and control (100%). B, Panc-1 cells were treated with or without LY2109761 in the presence or absence of TGF-ß as described. Twenty-four hours after infection with Ad-GFP at a MOI of 2, analysis was done by flow cytometry.

 
Pharmacologic partial reversion of EMT in cells with established mesenchymal phenotype leads to increased infection rate. We next tested whether pharmacologic inhibition of TGF-ß signaling in carcinoma cells with an established mesenchymal phenotype results in up-regulation of CAR and increased infectability. We used murine EpXT cells, which are Ras-transformed mammary epithelial cells, and show a mesenchymal phenotype that is maintained through autocrine activation of TGF-ß signaling (14, 15). Within 24 hours of treatment with the TGF-ß receptor kinase inhibitor LY2109761, EpXT cells seeded at low confluency established patches of cellular monolayers with close cell-cell contacts, in contrast to the scattered and loose growth pattern of untreated cells (Fig. 7A). After prolonged periods of treatment, cells formed three-dimensional cell clusters consisting of multiple layers of cells (Fig. 7A). Interestingly, such three-dimensional cell clusters formed to a lesser extent when starting the LY2109761 treatment on cells seeded at higher confluency or when applying conditioned medium. It is possible that this effect is mediated through autocrine or paracrine production of TGF-ß by these cells because also 5 ng/mL of exogenous TGF-ß prevented the formation of such three-dimensional cell clusters (data not shown). Treatment of cells at higher confluency with LY2109761 induced phenotypical changes compared with untreated cells that were characterized by the formation of monolayer patches with loose cell contacts as determined by phase-contrast microscopy (data not shown).


Figure 7
View larger version (41K):
[in this window]
[in a new window]
 
Figure 7. Phenotype and infectivity analysis of EpXT cells. The effect of LY2109761 on murine, Ras-transformed mammary epithelial cells was examined by light microscopy (A) and Western blot analysis (B). CAR-expressing CHO cells (CHO+) were used as positive control. CAR was detected with the H-300 antibody. C, effect of LY2109761 on susceptibility of EpXT cells to adenovirus infection. Cells were infected with Ad-GFP after a treatment for 3.5 days with LY2109761 or DMSO. GFP expression was assessed 50 hours after infection by flow cytometry. Both the LY2109761 treatment and the infection were done with duplicate samples. Columns, percentage of GFP-expressing cells; bars, SD (for MOI-0.25 and MOI-1 only).

 
Analysis of total protein levels by Western blotting (protein lysates of samples shown in Fig. 7A) confirmed the activation of the TGF-ß signaling pathway in untreated cells as indicated by constitutive phosphorylation of Smad2. Activation of Smad2 was completely inhibited by LY2109761. At the same time, increased levels of total CAR and E-cadherin protein were observed (Fig. 7B). Furthermore, Western blot analysis showed persistent expression of mesenchymal markers, such as fibronectin (data not shown), indicating that treatment of these cells with LY2109761 results in incomplete reversal of EMT. Because we had found previously that CAR expression is negatively regulated by the Raf-MEK-Erk pathway, we tested whether combined treatment of these cells with the specific MEK inhibitor CI-1040 and LY2109761 increased the level of up-regulation of CAR. However, no such additive or synergistic effect was found (data not shown). Similarly, whereas treatment with the histone deacetylase inhibitor trichostatin A increased CAR levels in EpXT cells in agreement with previous reports from other laboratories (10, 11), combination of this drug with LY2109761 did not increase CAR expression further (data not shown). Preliminary analyses of additional cell lines [CT26 (mouse colon cancer; ref. 19), Hs578T (human breast cancer), Hs766T, and Panc-2.13 (human pancreatic cancer)] with RNA expression profiles characteristic for mesenchymal phenotype revealed for CT26 and Hs766T morphologic changes similar to the ones observed in EpXT cells. However, no significant changes in CAR protein expression at the cell surface was observed in these cells (data not shown). Nevertheless, the increase in overall CAR levels following treatment with the TGF-ß receptor inhibitor was sufficient to significantly increase susceptibility of EpXT cells to adenovirus infection, as shown in Fig. 7C. This effect was most pronounced in cells seeded at low confluency and grown in the absence of conditioned medium. Because these experimental conditions favor the formation of three-dimensional cell clusters, as described above, increased adenoviral infection rates could be explained through the up-regulation of CAR expression as shown by Western blot analysis (Fig. 7B).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
This study shows that CAR expression is negatively regulated during TGF-ß-induced EMT and that pharmacologic inhibition of TGF-ß signal transduction restores, at least partially, CAR expression and epithelial phenotype, thus increasing the susceptibility of cancer cells to infection with adenovirus. Our results have implications for our understanding of the biological consequences of TGF-ß signaling and the clinical application of adenoviral anticancer therapies.

At the outset of our experiments, we hypothesized that CAR expression could be regulated in analogy to other epithelial cell-cell adhesion molecules, including E-cadherin and ZO-1 (12, 15). In agreement with this, we had been able to show before that CAR is regulated by the Raf-MEK-Erk pathway (13), which is known to promote loss of epithelial cell-adhesion molecules. Previous evidence provided by our group and others suggests that this pathway collaborates with the TGF-ß pathway in promoting the switch from epithelial to mesenchymal phenotype in cancer cells (1416, 19). The observation that TGF-ß reduces CAR levels and susceptibility to adenovirus infection has previously been reported (22). Here, we show that this regulation takes place in the context of EMT.

The diverse cellular effects of TGF-ß are well known to be mediated through transcriptional, posttranscriptional, and posttranslational mechanisms. For example, transcriptional repression of E-cadherin by snail and SIP-1 in response to TGF-ß has been shown (31, 32). Regulation of S100A8 through altered mRNA stability (33) and decreased estrogen receptor, as well as SnoN protein stability following TGF-ß treatment (28, 29), are examples for the different mechanisms used by TGF-ß to regulate protein expression. We found in this investigation transcriptional repression of CAR by TGF-ß, and we were able to exclude altered CAR mRNA stability or enhanced proteasomal protein degradation as possible mechanisms. Although the exact transcriptional mechanism of CAR regulation by TGF-ß remains unclear, preliminary analyses done in our laboratory suggest a mechanism that resembles regulation of E-cadherin.11

Loss of CAR expression in cells undergoing EMT raises the question of the biological consequences of reduced CAR levels. CAR is a component of tight junction cell-cell adhesion complexes (1). It has been shown that by blocking the CAR-CAR interaction using monoclonal antibodies, the transmembranic resistance is significantly reduced (1). Loss of CAR expression could therefore undermine tissue integrity by altering the extracellular fluid homeostasis and contribute to the increased cellular motility that is considered one of the biological consequences of EMT that, in the context of cancer, could lead to increased invasiveness and metastatic potential of malignant cells. In this regard, it is worth mentioning that small molecule inhibitors reversing the EMT process, like the TGF-ß receptor kinase inhibitor LY2109761 used in this study, potentially also reduce (or delay the onset of) metastasis formation. Because TGF-ß is also released in nonmalignant conditions, such as wound healing and pathologic processes associated with chronic tissue damage, such as liver cirrhosis, it can be speculated that TGF-ß-induced loss of CAR could promote the abnormal state by altering the functionality of tight junctions. It is important to emphasize that the existence of a clinical correlate of EMT in human cancer is subject of an ongoing debate because histomorphologic evidence for this process is present in human epithelial cancers only rarely (35). However, it is clear that epithelial malignancies frequently show features resembling incomplete EMT. For example, loss of E-cadherin expression is a common finding in epithelial malignancies and has been associated with poor prognosis in several tumor types (36, 37).

Adenovirus uptake involves several distinct steps, including attachment of the virus particle to the cell surface and internalization. CAR mediates attachment of the virus, whereas {alpha}v integrins have been described as mediators of virus internalization (38). Interestingly, TGF-ß is known to up-regulate {alpha}v integrins (39). However, it is unlikely that this effect plays a role in our system because we found reduced uptake of adenovirus following treatment with TGF-ß.

Our findings have direct relevance for the design of antitumor therapies using recombinant adenoviruses. We have observed frequent loss of CAR expression in gastrointestinal and breast cancers, in particular in less differentiated tumors. Others have published similar findings in prostate and bladder cancer (7, 8). We found that liver tumors with reduced CAR expression also showed low levels of E-cadherin.9 Furthermore, it is well known that TGF-ß levels are increased in many tumor types, including liver and pancreatic cancer. It is therefore conceivable that the clinical correlate of EMT is associated with loss of CAR, thus rendering such tumors less susceptible to adenovirus infection.

We were able to show here that pharmacologic inhibition of TGF-ß signaling can up-regulate CAR expression in cells that have undergone TGF-ß-induced EMT and in cells with established mesenchymal phenotype. Because several human cancer cell lines did not respond in this way and showed only subtle and variable morphologic changes, our laboratories are interested in identifying molecular markers predictive of cellular and biochemical responses to treatment with TGF-ß inhibitors. Interestingly, because analogues of the TGF-ß receptor kinase inhibitor LY2109761 will soon be entering phase I clinical trials in oncology, it seems to be worthwhile to further explore the possibility of designing clinical protocols combining TGF-ß inhibitors and adenoviral agents. Preclinical studies addressing this possibility are currently under way in our laboratories.


    Acknowledgments
 
Grant support: American Cancer Society Individual Research Award (W.M. Korn), Hellman Family Award (W.M. Korn), R01 CA095701, UC Discovery Grant Biostar 02-10242, P0-1 AR050440, R0-1 GM60514, Deutsche Forschungsgemeinshaft Fellowship (M. Anders), and Swiss National Science Foundation Fellowship (M.D. Lacher).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Dr. J. Yingling (Eli Lilly and Company, Indianapolis, IN) for providing the TGF-ß receptor kinase inhibitor used in this study; Drs. J. Gray, F. McCormick, L. Timmerman, J. Yeh, M. McMahon, and S. Gysin (University of California, San Francisco, Comprehensive Cancer Center) for providing us with data from mRNA expression array analyses that were used for selection of tumor cell lines; and C. Mysinger (University of California, San Francisco, Comprehensive Cancer Center) for generously providing Ad-GFP.


    Footnotes
 
9 W.M. Korn, et al. Expression of the Coxsackievirus and adenovirus receptor in gastrointestinal cancer correlates with tumor differentiation, in press. Back

10 J. Yingling, personal communication. Back

11 M.D. Lacher and W.M. Korn, unpublished data. Back

Received 7/18/05. Revised 11/ 2/05. Accepted 11/10/05.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Cohen CJ, Shieh JT, Pickles RJ, Okegawa T, Hsieh JT, Bergelson JM. The coxsackievirus and adenovirus receptor is a transmembrane component of the tight junction. Proc Natl Acad Sci U S A 2001;98:15191–6.[Abstract/Free Full Text]
  2. Bergelson JM, Cunningham JA, Droguett G, et al. Isolation of a common receptor for Coxsackie B viruses and adenoviruses 2 and 5. Science 1997;275:1320–3.[Abstract/Free Full Text]
  3. Douglas JT, Kim M, Sumerel LA, Carey DE, Curiel DT. Efficient oncolysis by a replicating adenovirus (ad) in vivo is critically dependent on tumor expression of primary ad receptors. Cancer Res 2001;61:813–7.[Abstract/Free Full Text]
  4. Li Y, Pong RC, Bergelson JM, et al. Loss of adenoviral receptor expression in human bladder cancer cells: a potential impact on the efficacy of gene therapy. Cancer Res 1999;59:325–30.[Abstract/Free Full Text]
  5. Okegawa T, Li Y, Pong RC, Bergelson JM, Zhou J, Hsieh JT. The dual impact of Coxsackie and adenovirus receptor expression on human prostate cancer gene therapy. Cancer Res 2000;60:5031–6.[Abstract/Free Full Text]
  6. Tallone T, Malin S, Samuelsson A, et al. A mouse model for adenovirus gene delivery. Proc Natl Acad Sci U S A 2001;98:7910–5.[Abstract/Free Full Text]
  7. Sachs MD, Rauen KA, Ramamurthy M, et al. Integrin {alpha}(v) and Coxsackie adenovirus receptor expression in clinical bladder cancer. Urology 2002;60:531–6.[CrossRef][Medline]
  8. Rauen KA, Sudilovsky D, Le JL, et al. Expression of the Coxsackie adenovirus receptor in normal prostate and in primary and metastatic prostate carcinoma: potential relevance to gene therapy. Cancer Res 2002;62:3812–8.[Abstract/Free Full Text]
  9. Anders M, Hansen R, Ding RX, Rauen KA, Bissell MJ, Korn WM. Disruption of 3D tissue integrity facilitates adenovirus infection by deregulating the coxsackievirus and adenovirus receptor. Proc Natl Acad Sci U S A 2003;100:1943–8.[Abstract/Free Full Text]
  10. Kitazono M, Goldsmith ME, Aikou T, Bates S, Fojo T. Enhanced adenovirus transgene expression in malignant cells treated with the histone deacetylase inhibitor FR901228. Cancer Res 2001;61:6328–30.[Abstract/Free Full Text]
  11. Goldsmith ME, Kitazono M, Fok P, Aikou T, Bates S, Fojo T. The histone deacetylase inhibitor FK228 preferentially enhances adenovirus transgene expression in malignant cells. Clin Cancer Res 2003;9:5394–401.[Abstract/Free Full Text]
  12. Chen Y, Lu Q, Schneeberger EE, Goodenough DA. Restoration of tight junction structure and barrier function by down- regulation of the mitogen-activated protein kinase pathway in ras- transformed Madin-Darby canine kidney cells. Mol Biol Cell 2000;11:849–62.[Abstract/Free Full Text]
  13. Anders M, Christian C, McMahon M, McCormick F, Korn WM. Inhibition of the Raf/MEK/ERK pathway up-regulates expression of the coxsackievirus and adenovirus receptor in cancer cells. Cancer Res 2003;63:2088–95.[Abstract/Free Full Text]
  14. Oft M, Peli J, Rudaz C, Schwarz H, Beug H, Reichmann E. TGF-ß1 and Ha-Ras collaborate in modulating the phenotypic plasticity and invasiveness of epithelial tumor cells. Genes Dev 1996;10:2462–77.[Abstract/Free Full Text]
  15. Janda E, Lehmann K, Killisch I, et al. Ras and TGF{ß} cooperatively regulate epithelial cell plasticity and metastasis: dissection of Ras signaling pathways. J Cell Biol 2002;156:299–314.[Abstract/Free Full Text]
  16. Fujimoto K, Sheng H, Shao J, Beauchamp RD. Transforming growth factor-ß1 promotes invasiveness after cellular transformation with activated Ras in intestinal epithelial cells. Exp Cell Res 2001;266:239–49.[CrossRef][Medline]
  17. Ellenrieder V, Hendler SF, Boeck W, et al. Transforming growth factor ß1 treatment leads to an epithelial-mesenchymal transdifferentiation of pancreatic cancer cells requiring extracellular signal-regulated kinase 2 activation. Cancer Res 2001;61:4222–8.[Abstract/Free Full Text]
  18. Weeks BH, He W, Olson KL, Wang XJ. Inducible expression of transforming growth factor ß1 in papillomas causes rapid metastasis. Cancer Res 2001;61:7435–43.[Abstract/Free Full Text]
  19. Oft M, Heider KH, Beug H. TGFß signaling is necessary for carcinoma cell invasiveness and metastasis. Curr Biol 1998;8:1243–52.[CrossRef][Medline]
  20. Siegel PM, Massague J. Cytostatic and apoptotic actions of TGF-ß in homeostasis and cancer. Nat Rev Cancer 2003;3:807–21.[CrossRef][Medline]
  21. Tang B, Vu M, Booker T, et al. TGF-ß switches from tumor suppressor to prometastatic factor in a model of breast cancer progression. J Clin Invest 2003;112:1116–24.[CrossRef][Medline]
  22. Bruning A, Runnebaum IB. CAR is a cell-cell adhesion protein in human cancer cells and is expressionally modulated by dexamethasone, TNF{alpha}, and TGFß. Gene Ther 2003;10:198–205.[CrossRef][Medline]
  23. Ginzinger DG. Gene quantification using real-time quantitative PCR: an emerging technology hits the mainstream. Exp Hematol 2002;30:503–12.[CrossRef][Medline]
  24. Bakin AV, Tomlinson AK, Bhowmick NA, Moses HL, Arteaga CL. Phosphatidylinositol 3-kinase function is required for transforming growth factor ß-mediated epithelial to mesenchymal transition and cell migration. J Biol Chem 2000;275:36803–10.[Abstract/Free Full Text]
  25. Miettinen PJ, Ebner R, Lopez AR, Derynck R. TGF-ß induced transdifferentiation of mammary epithelial cells to mesenchymal cells: involvement of type I receptors. J Cell Biol 1994;127:2021–36.[Abstract/Free Full Text]
  26. Yingling JM, Blanchard KL, Sawyer JS. Development of TGF-ß signalling inhibitors for cancer therapy. Nat Rev Drug Discov 2004;3:1011–22.[CrossRef][Medline]
  27. Peng SB, Yan L, Xia X, et al. Kinetic characterization of novel pyrazole TGF-ß receptor I kinase inhibitors and their blockade of the epithelial-mesenchymal transition. Biochemistry 2005;44:2293–304.[CrossRef][Medline]
  28. Petrel TA, Brueggemeier RW. Increased proteasome-dependent degradation of estrogen receptor-{alpha} by TGF-ß1 in breast cancer cell lines. J Cell Biochem 2003;88:181–90.[CrossRef][Medline]
  29. Edmiston JS, Yeudall WA, Chung TD, Lebman DA. Inability of transforming growth factor-ß to cause SnoN degradation leads to resistance to transforming growth factor-ß-induced growth arrest in esophageal cancer cells. Cancer Res 2005;65:4782–8.[Abstract/Free Full Text]
  30. Murakami M, Ikeda T, Saito T, et al. Transcriptional regulation of plasminogen activator inhibitor-1 by transforming growth factor-ß, activin A and microphthalmia-associated transcription factor. Cell Signal 2006;18:256–65. Epub 2005 Jun 14.[CrossRef][Medline]
  31. Cano A, Perez-Moreno MA, Rodrigo I, et al. The transcription factor snail controls epithelial-mesenchymal transitions by repressing E-cadherin expression. Nat Cell Biol 2000;2:76–83.[CrossRef][Medline]
  32. Comijn J, Berx G, Vermassen P, et al. The two-handed E box binding zinc finger protein SIP1 downregulates E-cadherin and induces invasion. Mol Cell 2001;7:1267–78.[CrossRef][Medline]
  33. Rahimi F, Hsu K, Endoh Y, Geczy CL. FGF-2, IL-1ß and TGF-ß regulate fibroblast expression of S100A8. FEBS J 2005;272:2811–27.[CrossRef][Medline]
  34. Lemm I, Ross J. Regulation of c-myc mRNA decay by translational pausing in a coding region instability determinant. Mol Cell Biol 2002;22:3959–69.[Abstract/Free Full Text]
  35. Tarin D. The fallacy of epithelial mesenchymal transition in neoplasia. Cancer Res 2005;65:5996–6000.[Abstract/Free Full Text]
  36. Pedersen KB, Nesland JM, Fodstad O, Maelandsmo GM. Expression of S100A4, E-cadherin, {alpha}- and ß-catenin in breast cancer biopsies. Br J Cancer 2002;87:1281–6.[CrossRef][Medline]
  37. Kanazawa T, Watanabe T, Kazama S, Tada T, Koketsu S, Nagawa H. Poorly differentiated adenocarcinoma and mucinous carcinoma of the colon and rectum show higher rates of loss of heterozygosity and loss of E-cadherin expression due to methylation of promoter region. Int J Cancer 2002;102:225–9.[CrossRef][Medline]
  38. Zhang Y, Bergelson JM. Adenovirus receptors. J Virol 2005;79:12125–31.[Free Full Text]
  39. Nejjari M, Hafdi Z, Gouysse G, et al. Expression, regulation, and function of {alpha}V integrins in hepatocellular carcinoma: an in vivo and in vitro study. Hepatology 2002;36:418–26.[CrossRef]



This article has been cited by other articles:


Home page
Clin. Cancer Res.Home page
C.-L. Wu, G.-S. Shieh, C.-C. Chang, Y.-T. Yo, C.-H. Su, M.-Y. Chang, Y.-H. Huang, P. Wu, and A.-L. Shiau
Tumor-Selective Replication of an Oncolytic Adenovirus Carrying Oct-3/4 Response Elements in Murine Metastatic Bladder Cancer Models
Clin. Cancer Res., February 15, 2008; 14(4): 1228 - 1238.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S. Libertini, I. Iacuzzo, A. Ferraro, M. Vitale, M. Bifulco, A. Fusco, and G. Portella
Lovastatin Enhances the Replication of the Oncolytic Adenovirus dl1520 and Its Antineoplastic Activity against Anaplastic Thyroid Carcinoma Cells
Endocrinology, November 1, 2007; 148(11): 5186 - 5194.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
M. E. Goldsmith, A. Aguila, K. Steadman, A. Martinez, S. M. Steinberg, M. C. Alley, W. R. Waud, S. E. Bates, and T. Fojo
The histone deacetylase inhibitor FK228 given prior to adenovirus infection can boost infection in melanoma xenograft model systems
Mol. Cancer Ther., February 1, 2007; 6(2): 496 - 505.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lacher, M. D.
Right arrow Articles by Korn, W. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lacher, M. D.
Right arrow Articles by Korn, W. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online