| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Experimental Therapeutics, Molecular Targets, and Chemical Biology |
Divisions of 1 Gastroenterology and 2 Hematology/Oncology; 3 Cancer Research Institute; Departments of 4 Anatomy and 5 Biochemistry, University of California, San Francisco, California; 6 Cardiovascular Research Center, John A. Burns School of Medicine, University of Hawaii at Manoa, Honolulu, Hawaii; 7 Department of Hepatology and Gastroenterology, Charité, Campus Virchow-Klinikum, Humboldt University, Berlin, Germany; and 8 DNAX Research Institute of Molecular and Cellular Biology, Palo Alto, California
Correspondence: Wolfgang Michael Korn, University of California, San Francisco, Comprehensive Cancer Center, Box 0128, San Francisco, CA 94143-0128. Phone: 415-502-2844; Fax: 415-502-4787; E-mail: mkorn{at}cc.ucsf.edu.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Cell-cell adhesion molecules are regulated through a variety of pathways in addition to the Raf-MEK-Erk pathway. In particular, there is strong evidence that this pathway cooperates with the transforming growth factor-ß (TGF-ß) signaling pathway in repressing epithelial-type cell adhesion molecules (1416). Moreover, in cell culture systems, TGF-ß can promote a phenotypic switch of epithelial tumor cells into a mesenchymal phenotype, a phenomenon known as epithelial-mesenchymal transition (EMT; refs. 1417). This process is not only characterized by striking morphologic changes but also by the loss of expression of epithelial-type cell adhesion molecules, including E-cadherin and ZO-1, accompanied by de novo expression of mesenchymal markers, such as vimentin, N-cadherin, and smooth-muscle actin. It has been hypothesized that these TGF-ß-dependent effects, together with increased cell mobility and invasiveness, promote the development of tumor metastases, which is supported by studies in a variety of animal models of cancer, including skin, breast, and colon cancer models (1821).
TGF-ß-dependent down-regulation of CAR has been reported before (22). We hypothesized that loss of CAR expression occurs in the context of TGF-ß-dependent EMT. Here, we show that this is indeed the case and describe TGF-ß-dependent transcriptional repression of CAR as one mechanism of CAR regulation. The recent development of small-molecule inhibitors of TGF-ß receptor kinases allowed us to test whether inhibition of TGF-ß signaling in cancer cells that have undergone EMT can reverse this process, increase CAR expression, and enhance susceptibility to adenovirus infection.
| Materials and Methods |
|---|
|
|
|---|
TGF-ß and small molecule inhibitors. NMuMG and Panc-1 (5-30% confluence) cells were stimulated with 5 ng/mL hTGF-ß1 (R&D Systems, Minneapolis, MN) or with its solvent [4 mmol/L HCl/0.1% (w/v) bovine serum albumin] for up to 6 days. The TGF-ßRI/II kinase inhibitor LY2109761 (a kind gift from J. Yingling) was used at a concentration of 20 µmol/L, the minimal dose required to completely inhibit Smad2 phosphorylation in EpXT cells. Control samples not treated with LY2109761 were supplemented with its solvent, DMSO. Medium containing TGF-ß and/or LY2109761 was replaced daily or every 2nd day. To investigate a possible effect of TGF-ß on CAR protein stability, NMuMG cells were pretreated with 5 ng/mL hTGF-ß1 for 3 days, then incubated for 6 hours with the proteasome inhibitors lactacystin or MG132 (both 10 µmol/L, both Calbiochem/EMD Biosciences, Inc., La Jolla, CA). To test whether the TGF-ß-induced down-regulation of CAR protein is phosphatidylinositol 3-kinase (PI3K)dependent, NMuMG cells were treated for 3 days with the PI3K inhibitor LY294002 (10 µmol/L; Cell Signaling Technology, Inc., Beverly, MA), in the presence or absence of TGF-ß.
Immunoblotting. Cells were lysed in 1% (v/v) NP40 (IGEPAL, Sigma-Aldrich, St. Louis, MO), 0.5% sodium deoxycholate (deoxycholic acid; Sigma-Aldrich), 0.1% (w/v) SDS, and Complete/Mini protease inhibitor cocktail (Roche, Indianapolis, IN). Cell lysates were separated on NuPAGE 4-12% polyacrylamide Bis-Tris gels/MES-SDS buffer (Invitrogen, San Diego, CA), transferred onto Immobilon-P polyvinylidene fluoride (PVDF) membranes, (Millipore, Billerica, MA), and blocked in 5% milk/TBS containing 0.1% Tween 20 (TBST). Primary rabbit polyclonal antibodies used were anti-CAR H-300 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA), anti-CAR Ab72 (13), anti-phospho-Smad2 (Ser465/467; Cell Signaling Technology), anti-total Smad2 (Zymed, South San Francisco, CA), anti-fibronectin (H-300; Santa Cruz Biotechnology). Primary mouse monoclonal antibodies used were anti-E-cadherin (BD Transduction Laboratories, Lexington, KY), anti-total Smad2/3 (BD Transduction Laboratories), and anti-ß-actin (Sigma-Aldrich). Both primary and secondary antibodies were diluted in 0.5% milk/TBST. Secondary antibodies were horseradish peroxidase conjugated, allowing detection via enhanced chemiluminescence (Amersham Pharmacia, Piscataway, NJ).
Flow cytometry for cell surface CAR. Cells were washed with PBS and detached in 0.05% trypsin (University of California, San Francisco, Cell Culture Facility, San Francisco, CA). Incubations in primary anti-CAR mouse monoclonal antibody RmcB (2) and secondary AlexaFluor 488 goat anti-mouse F(ab')2 antibody fragments (Molecular Probes, Eugene, OR) were carried out for 45 and 30 minutes, respectively, at 4°C. Integrity of the cells was controlled via propidium iodide staining. Flow cytometry was done on a FACSCalibur cytometer (Becton, Dickinson and Company, Franklin Lakes, NJ) and analyzed with CellQuest Pro software (Becton, Dickinson and Company).
Immunofluorescence. Immunofluorescence staining was done as described before (13). Cells were grown on 60 mm plastic cell culture dishes and fixed with 1.6% paraformaldehyde. CAR protein was detected using anti-CAR Ab72 antibody. Nuclear counterstaining was done using Hoechst 33258 solution.
Adenovirus infections. Stimulation with TGF-ß and LY2109761 resulted in differences in local cell densities and, thus, potentially interferes with access of CAR to the adenovirus. To avoid this bias, Panc-1 and EpXT cells were infected in suspension: Cells were washed in PBS, detached in 0.05% trypsin (University of California, San Francisco, Cell Culture Facility, San Francisco, CA or Invitrogen), diluted in DMEM + 10% FBS, counted, and adjusted to equal cell concentrations. One volume of cell suspension was then mixed with 1 volume of Ad-GFP, a nonreplicating E1A-deleted adenovirus encoding enhanced green fluorescent protein (eGFP; ref. 13), diluted in DMEM + 2% FBS. For both Panc-1 and EpXT infections, medium was replaced by regular growth medium following attachment of the cells [i.e., 6 hours (Panc-1) or 10 hours (EpXT) after addition of the virus]. Cells were washed 24 hours (Panc-1) or 50 hours (EpXT) after infection, then trypsinized and analyzed for eGFP expression on a FACSCalibur cytometer (Becton, Dickinson and Company) and CellQuest Pro software (Becton, Dickinson and Company). Infections of (adherent) CHO, E4, and NMuMG cells with the replication-incompetent firefly luciferaseencoding adenovirus (Ad-Luc) were done in DMEM + 2% FBS. Four hours after addition of the virus to the cells, virus was replaced by regular growth medium. Cells were lysed 48 hours after infection. Luminescence was evaluated via the Luciferase Assay System from Promega (Madison, WI).
Real-time PCR and assessment of mRNA stability. RNA was extracted using the RNeasy Midi/Mini kits (Qiagen, Valencia, CA). For the NMuMG cell TGF-ß study (Fig. 5A), RNA was treated with DNase I (Roche), then subjected to a cleanup with the RNeasy kit. Reverse transcription of 500 ng RNA was carried out by using random primers and M-MLVRT reverse transcriptase (both Invitrogen). Real-time PCR was done with AmpliTaq Gold (Roche/Applied Biosystems, Foster City, CA) on a 7900 HT Sequence Detection System (ABI PRISM, Applied Biosystems). For the Panc-1 cell TGF-ß study (Fig. 5B) and the NMuMG cell RNA stability assay (Fig. 5C), RNA quality evaluation on a Bioanalyzer (Agilent Technologies, Palo Alto, CA), reverse transcription, and TaqMan PCR were done at the University of California, San Francisco, Comprehensive Cancer Center Genome Core (San Francisco, CA). Primer/probes for CAR were described before (13). For normalization, mouse ß-glucuronidase (ß-gus; ref. 23) with CGAACCAGTCACCGCTGAGAGTAATCG as probe and CTCATCTGGAATTTCGCCGA and GGCGAGTGAAGATCCCCTTC as primers or human ß-gus with TGAACAGTCACCGACGAGAGTGCTGG as probe and CTCATTTGGAATTTTGCCGATT and CCGAGTGAAGATCCCCTTTTTA as primers as well as mouse 18S rRNA with TGCTGGCACCAGACTTGCCCTC as probe and CGGCTACCACATCCAAGGAA and GCTGGAATTACCGCGGCT as primers were used. For mouse plasminogen activator inhibitor-1 (PAI-1), TCAACTACACTGAGTTCACCACCCCCG was used as probe, and ACCGTCTCTGTGCCCATGAT and CAGCGATGAACATGCTGAGG were used as primers. For mouse c-myc, CAGACAGCCACGACGATGCCCC was used as probe, and CTGTTTGAAGGCTGGATTTCCT and TTCCTGTTGGTGAAGTTCACGT were used as primers. Real-time PCR for human E-cadherin was done by using the CDH1 (D: Hs00170423_m1) Assay-On-Demand (Applied Biosystems). For assessment of mRNA stability, NMuMG cells, seeded in 60 mm dishes at a density of 4 x 105 cells per dish, were initially stimulated for 72 hours with TGF-ß, then treated with 1 µg/mL actinomycin D (Invitrogen), alone or in combination with TGF-ß for 1.5, 3, and 6 hours. At each time point, cells were washed twice with cold PBS, then lysed in 350 µL lysis buffer RLT (RNeasy kit; Qiagen).
|
| Results |
|---|
|
|
|---|
|
|
|
All experiments regarding Panc-1 cells described in this article were done as follows: First, a mesenchymal phenotype was induced by treatment with TGF-ß for 3 days. Second, LY2109761 was added, in the continued presence of TGF-ß, for another 3 days. LY2109761 treatment reestablished the epithelial phenotype (Fig. 1B). In addition to inhibition of Smad2 phosphorylation, we found that CAR and E-cadherin protein levels increased while fibronectin expression decreased, which is indicative for reversal of EMT (Fig. 2B). In addition, the phenotypic switch of NMuMG cells was prevented by combined exposure of these cells to TGF-ß and the TGF-ß receptor inhibitor (data not shown), which is in agreement with observations made previously using the related compounds LY364947 and LY580276 (27).
Because presence of CAR at the cell surface is essential for its function as a receptor for adenovirus and as a cell-cell adhesion molecule, we asked if the reduced level of total CAR protein expression in Panc-1 cells following TGF-ß treatment is associated with a loss of CAR protein at the cell surface. To test this, we stained nonpermeabilized Panc-1 cells for CAR using a monoclonal anti-CAR antibody (RmcB; ref. 2) and did fluorescence-activated cell sorting analysis. As shown in Fig. 3A, treatment with TGF-ß reduced CAR cell surface protein levels dramatically. CAR levels at the cell surface were fully restored in Panc-1 cells that were initially treated for 3 days with TGF-ß alone, followed by another 3 days of cotreatment with LY2109761 (Fig. 3A). This was confirmed by immunofluorescence microscopy (Fig. 3B). Panc-1 cells were grown on 60 mm plastic tissue culture dishes and stimulated as above (i.e., first with TGF-ß alone and then with LY2109761 in the continued presence of TGF-ß). In untreated cells, CAR was strongly expressed at sites of cell-cell interaction, whereas it was dramatically reduced in cells that had been treated with TGF-ß alone. Addition of the TGF-ß receptor inhibitor restored CAR expression at cell junctions. Interestingly, the cell surface signal was slightly weaker in cells treated with LY2109761 compared with untreated cells and showed a less continuous, somewhat disrupted appearance. At this point, it remains unclear whether these differences in staining patterns are a result of incomplete restoration of CAR expression or, for example, a consequence of off-target effects of the inhibitor.
Loss of CAR expression in response to TGF-ß is independent of proteasome activity and PI3K signaling. To begin to develop an understanding of the molecular mechanisms underlying the observed loss in CAR protein expression, we first analyzed possible TGF-ß-mediated effects on protein stability, because one well-documented mechanism by which TGF-ß treatment reduces levels of a variety of proteins is the activation of proteasomal degradation of such target molecules. For example, enhanced proteasome-dependent degradation of estrogen receptor
in response to TGF-ß has been shown in breast cancer cells (28). Similarly, TGF-ß treatment has been shown to induce proteasomal degradation of the proto-oncogene SnoN, which is a required step for transcriptional repression of c-myc by TGF-ß (29). We therefore ascertained whether the specific proteasome inhibitors MG132 and lactacystin prevented TGF-ß-dependent reduction in CAR protein levels in NMuMG cells. Cells prestimulated for 3 days in the presence or absence of TGF-ß were treated with MG132 or lactacystin. As shown in Fig. 4, both compounds had no effect on CAR protein levels and did not prevent TGF-ß-dependent down-regulation of CAR protein. These findings indicate that loss of CAR protein following TGF-ß treatment is independent of proteasomal activity. Because it has been shown previously that the PI3K signal transduction pathway may be required for TGF-ß-mediated EMT (24), we tested whether treatment of NMuMG cells with the PI3K inhibitor LY294002 prevented CAR repression by TGF-ß. Cells were stimulated with TGF-ß alone or in combination with LY294002 for 3 days. As shown in Fig. 4, CAR levels decreased in TGF-ß-treated cells, despite inhibition of PI3K signaling, indicating that TGF-ß-induced down-regulation of CAR is PI3K independent.
|
TGF-ß has also been found to regulate gene expression by interfering with mRNA stability, for instance in the case of the S100A8 gene (33). We tested this possibility by measuring CAR mRNA levels in NMuMG cells. Cells were first stimulated with or without TGF-ß for 72 hours in the absence of actinomycin D, then, for the time course shown in Fig. 5C, in the presence of this drug. Actinomycin D is a global inhibitor of gene transcription. A change in the slope of decay of a given RNA species in response to a stimulus in the presence of actinomycin D is, therefore, indicative of altered RNA stability. As depicted in Fig. 5C, no difference in the slope of the curve was found for CAR mRNA of NMuMG cells treated with or without TGF-ß, indicating that TGF-ß does not affect CAR mRNA stability. Activation of TGF-ß signaling by the ectopically added TGF-ß was confirmed by measuring PAI-1 mRNA levels, as they are reported to be enhanced following TGF-ß stimulation (30). The mRNA of c-myc was reported to be very unstable (34), thus being a suitable positive control for the efficacy of the actinomycin D applied (Fig. 5C).
Pharmacologic restoration of adenovirus infection rates following TGF-ßinduced EMT. We next asked whether the reduction of cell surface CAR in cells treated with TGF-ß translates into reduced susceptibility to adenovirus infection and if this could be overcome pharmacologically, which is of particular interest from a clinical perspective. This is underscored by the high percentage of clinical tumor samples from gastrointestinal and other malignancies with reduced or lost CAR expression (7, 8).9 To measure the efficiency of adenovirus infection in cells treated with or without TGF-ß, we used two different nonreplicating adenovirusesAd-GFP, expressing GFP under the control of a constitutively active cytomegalovirus (CMV) promoter, and Ad-Luc, encoding firefly luciferase as well under a constitutive promoter. As shown in Fig. 6A, treatment of both E4 mouse skin tumor cells as well as NMuMG normal mouse mammary cells with TGF-ß resulted in a clear reduction of infectability as measured by luciferase activity. A similar reduction in infectability was found in Panc-1 cells upon treatment with TGF-ß and infection with Ad-GFP (Fig. 6B). It is noteworthy that the measurement of GFP expression was done in TGF-ß-treated cells 24 hours after infection and removal of TGF-ß. Therefore, it is unlikely that the reduced GFP levels are a result of different GFP expression levels due to TGF-ß-mediated repression of the CMV promoter. When Panc-1 cells were treated with LY2109761 in the continued presence of TGF-ß, infectability increased significantly. However, the levels of GFP-positive cells observed in cells treated with TGF-ß plus LY2109761 did not achieve those observed in untreated cells. This discrepancy might be a reflection of the differences in the CAR expression patterns between inhibitor-treated cells and control cells observed by immunofluorescence (Fig. 3B). Alternatively, prolonged treatment might be necessary to fully restore cell surface CAR levels.
|
|
| Discussion |
|---|
|
|
|---|
At the outset of our experiments, we hypothesized that CAR expression could be regulated in analogy to other epithelial cell-cell adhesion molecules, including E-cadherin and ZO-1 (12, 15). In agreement with this, we had been able to show before that CAR is regulated by the Raf-MEK-Erk pathway (13), which is known to promote loss of epithelial cell-adhesion molecules. Previous evidence provided by our group and others suggests that this pathway collaborates with the TGF-ß pathway in promoting the switch from epithelial to mesenchymal phenotype in cancer cells (1416, 19). The observation that TGF-ß reduces CAR levels and susceptibility to adenovirus infection has previously been reported (22). Here, we show that this regulation takes place in the context of EMT.
The diverse cellular effects of TGF-ß are well known to be mediated through transcriptional, posttranscriptional, and posttranslational mechanisms. For example, transcriptional repression of E-cadherin by snail and SIP-1 in response to TGF-ß has been shown (31, 32). Regulation of S100A8 through altered mRNA stability (33) and decreased estrogen receptor, as well as SnoN protein stability following TGF-ß treatment (28, 29), are examples for the different mechanisms used by TGF-ß to regulate protein expression. We found in this investigation transcriptional repression of CAR by TGF-ß, and we were able to exclude altered CAR mRNA stability or enhanced proteasomal protein degradation as possible mechanisms. Although the exact transcriptional mechanism of CAR regulation by TGF-ß remains unclear, preliminary analyses done in our laboratory suggest a mechanism that resembles regulation of E-cadherin.11
Loss of CAR expression in cells undergoing EMT raises the question of the biological consequences of reduced CAR levels. CAR is a component of tight junction cell-cell adhesion complexes (1). It has been shown that by blocking the CAR-CAR interaction using monoclonal antibodies, the transmembranic resistance is significantly reduced (1). Loss of CAR expression could therefore undermine tissue integrity by altering the extracellular fluid homeostasis and contribute to the increased cellular motility that is considered one of the biological consequences of EMT that, in the context of cancer, could lead to increased invasiveness and metastatic potential of malignant cells. In this regard, it is worth mentioning that small molecule inhibitors reversing the EMT process, like the TGF-ß receptor kinase inhibitor LY2109761 used in this study, potentially also reduce (or delay the onset of) metastasis formation. Because TGF-ß is also released in nonmalignant conditions, such as wound healing and pathologic processes associated with chronic tissue damage, such as liver cirrhosis, it can be speculated that TGF-ß-induced loss of CAR could promote the abnormal state by altering the functionality of tight junctions. It is important to emphasize that the existence of a clinical correlate of EMT in human cancer is subject of an ongoing debate because histomorphologic evidence for this process is present in human epithelial cancers only rarely (35). However, it is clear that epithelial malignancies frequently show features resembling incomplete EMT. For example, loss of E-cadherin expression is a common finding in epithelial malignancies and has been associated with poor prognosis in several tumor types (36, 37).
Adenovirus uptake involves several distinct steps, including attachment of the virus particle to the cell surface and internalization. CAR mediates attachment of the virus, whereas
v integrins have been described as mediators of virus internalization (38). Interestingly, TGF-ß is known to up-regulate
v integrins (39). However, it is unlikely that this effect plays a role in our system because we found reduced uptake of adenovirus following treatment with TGF-ß.
Our findings have direct relevance for the design of antitumor therapies using recombinant adenoviruses. We have observed frequent loss of CAR expression in gastrointestinal and breast cancers, in particular in less differentiated tumors. Others have published similar findings in prostate and bladder cancer (7, 8). We found that liver tumors with reduced CAR expression also showed low levels of E-cadherin.9 Furthermore, it is well known that TGF-ß levels are increased in many tumor types, including liver and pancreatic cancer. It is therefore conceivable that the clinical correlate of EMT is associated with loss of CAR, thus rendering such tumors less susceptible to adenovirus infection.
We were able to show here that pharmacologic inhibition of TGF-ß signaling can up-regulate CAR expression in cells that have undergone TGF-ß-induced EMT and in cells with established mesenchymal phenotype. Because several human cancer cell lines did not respond in this way and showed only subtle and variable morphologic changes, our laboratories are interested in identifying molecular markers predictive of cellular and biochemical responses to treatment with TGF-ß inhibitors. Interestingly, because analogues of the TGF-ß receptor kinase inhibitor LY2109761 will soon be entering phase I clinical trials in oncology, it seems to be worthwhile to further explore the possibility of designing clinical protocols combining TGF-ß inhibitors and adenoviral agents. Preclinical studies addressing this possibility are currently under way in our laboratories.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Dr. J. Yingling (Eli Lilly and Company, Indianapolis, IN) for providing the TGF-ß receptor kinase inhibitor used in this study; Drs. J. Gray, F. McCormick, L. Timmerman, J. Yeh, M. McMahon, and S. Gysin (University of California, San Francisco, Comprehensive Cancer Center) for providing us with data from mRNA expression array analyses that were used for selection of tumor cell lines; and C. Mysinger (University of California, San Francisco, Comprehensive Cancer Center) for generously providing Ad-GFP.
| Footnotes |
|---|
10 J. Yingling, personal communication. ![]()
11 M.D. Lacher and W.M. Korn, unpublished data. ![]()
Received 7/18/05. Revised 11/ 2/05. Accepted 11/10/05.
| References |
|---|
|
|
|---|
(v) and Coxsackie adenovirus receptor expression in clinical bladder cancer. Urology 2002;60:5316.[CrossRef][Medline]
, and TGFß. Gene Ther 2003;10:198205.[CrossRef][Medline]
by TGF-ß1 in breast cancer cell lines. J Cell Biochem 2003;88:18190.[CrossRef][Medline]
- and ß-catenin in breast cancer biopsies. Br J Cancer 2002;87:12816.[CrossRef][Medline]
V integrins in hepatocellular carcinoma: an in vivo and in vitro study. Hepatology 2002;36:41826.[CrossRef]This article has been cited by other articles:
![]() |
C.-L. Wu, G.-S. Shieh, C.-C. Chang, Y.-T. Yo, C.-H. Su, M.-Y. Chang, Y.-H. Huang, P. Wu, and A.-L. Shiau Tumor-Selective Replication of an Oncolytic Adenovirus Carrying Oct-3/4 Response Elements in Murine Metastatic Bladder Cancer Models Clin. Cancer Res., February 15, 2008; 14(4): 1228 - 1238. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Libertini, I. Iacuzzo, A. Ferraro, M. Vitale, M. Bifulco, A. Fusco, and G. Portella Lovastatin Enhances the Replication of the Oncolytic Adenovirus dl1520 and Its Antineoplastic Activity against Anaplastic Thyroid Carcinoma Cells Endocrinology, November 1, 2007; 148(11): 5186 - 5194. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Goldsmith, A. Aguila, K. Steadman, A. Martinez, S. M. Steinberg, M. C. Alley, W. R. Waud, S. E. Bates, and T. Fojo The histone deacetylase inhibitor FK228 given prior to adenovirus infection can boost infection in melanoma xenograft model systems Mol. Cancer Ther., February 1, 2007; 6(2): 496 - 505. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |