| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Experimental Therapeutics, Molecular Targets, and Chemical Biology |
Departments of 1 Chemistry, 2 Pediatrics, and 3 Obstetrics and Gynecology, University of Michigan, Ann Arbor, Michigan
Requests for reprints: Anthony W. Opipari, Jr., Division of Gynecologic Oncology, Department of Obstetrics and Gynecology, University of Michigan, 1500 East Medical Center Drive, L4000 Women's Hospital, Ann Arbor, MI 48109. Phone: 734-764-9106; Fax: 734-615-8902; E-mail: aopipari{at}umich.edu.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Genetic alterations that affect c-myc, such as point mutations, amplification, or translocation, convey oncogenic properties (5). As many as 70,000 cancer deaths per year in the United States can be attributed to deregulation of this protein (6). Burkitt's lymphoma, a cancer of B cells, is specifically caused by increased c-myc expression. In Burkitt's lymphoma, c-myc is constitutively overexpressed as a result of translocation of c-myc to the immunoglobulin gene locus, placing it under the transcriptional control of immunoglobulin enhancers (7). Experimental strategies to reduce c-myc expression or disrupt its function in Burkitt's lymphoma cells have successfully treated Burkitt's lymphoma in mice (8, 9).
Bz-423 is a novel benzodiazepine that induces either apoptotic or antiproliferative responses in normal and transformed lymphoid cells (10, 11). The apoptotic activity against lymphoid cells accounts for its therapeutic effects against lupus and arthritis in mice (10, 12). The target of Bz-423 and its apoptotic mechanism have been elucidated. Bz-423 binds to the oligomycin sensitivity-conferring protein (OSCP) component of the mitochondrial F1Fo-ATPase and inhibits ATP synthesis, which blocks electron transport and leads to superoxide (O2) production via a respiratory state 3 to state 4 transition (13). O2 produced in this manner functions as a second messenger that activates a tightly regulated apoptotic signaling pathway (10). The amount of O2 produced following inhibition of the F1Fo-ATPase by Bz-423 is concentration dependent. Concentrations of Bz-423 below those required to kill cells produce proportionally less O2 and cause Burkitt's lymphoma cells to stop proliferating due to cell cycle arrest at the G1 checkpoint (11).
Prior studies showed that pretreating cells with antioxidants restores normal proliferation, which links Bz-423-induced O2 with growth arrest (11). Based on this finding, the experiments described here were done to probe the molecular basis for the antiproliferative effects of Bz-423 in Burkitt's lymphoma cells. Our results show that Bz-423 rapidly depletes Burkitt's lymphoma cells of c-myc protein in a O2 dependent manner. c-Myc protein stability seems to be reduced by a post-translational mechanism because no change in the level of c-myc transcript is observed, inhibition of proteasome activity blocks the decrease, and mutation of specific residues involved in proteolytic processing blocks the effects of Bz-423 on both c-myc and growth inhibition. Collectively, these results identify a unique mechanism to regulate c-myc and suggest that Bz-423 may have activity against malignant diseases associated with deregulated myc expression.
| Materials and Methods |
|---|
|
|
|---|
-Difluoromethylornithine (DFMO), trichloroacetic acid (TCA), L-ornithine, SB-216763, and SB-415286 were purchased from Sigma-Aldrich (St. Louis, MO). Bortezomib was provided by V. Castle (University of Michigan). Bz-423 was synthesized as described previously and applied to cellular medium in aqueous DMSO (14), such that DMSO was present at a final concentration of 0.5% (v/v) in all experiments. Cell culture and transfections. Ramos B cells were purchased from American Type Culture Collection (Manassas, VA). Cells (106/mL) were maintained in RPMI 1640 (Mediatech, Herndon, VA) as described previously (10). pcDNA3-c-myc, an expression vector containing Flag-tagged human c-myc, was used for transfection. Mutation of threonine 58 (T58) and serine 62 (S62) in the pcDNA3-c-myc coding sequence was done using the QuickChange II XL Site-Directed Mutagenesis kit (Stratagene, La Jolla, CA) according to the manufacturer's protocol. Briefly, synthetic DNA primers (5'-GAGCTGCTGCCCGCTCCGCCCCTGTCCCCT-3' and 5'-AGGGGACAGGGGCGGAGCGGGCAGCAGCTC-3' for c-mycT58A, 5'-ACCCCGCCCCTGGCACCTAGCCGCCGC-3' and 5'-GCGGCGGCTAGGTGCCAGGGGCGGGGT-3' for c-mycS62A, and GAGCTGCTGCCCGCTCCGCCCCTGGCACCTAGCCGCCGC-3' and 5'-GCGGCGGCTAGGTGCCAGGGGCGGAGCGGGCAGCAGCTC-3' for c-mycT58A/S62A) were used in PCR with the template plasmid. For transfection into Ramos cells, 7.5 x 106 cells were electroporated with an Amaxa Nucleofector apparatus (Gaithersburg, MD) according to the manufacturer's protocol. After 24 hours, stably transfected cells were selected and maintained in RPMI 1640 containing geneticin (1.5 mg/mL; Life Technologies, Rockville, MD).
Gene expression profile. RNA was isolated from replicate samples of Ramos cells treated with Bz-423 (n = 2) or vehicle control (n = 4) for 4 hours using a RNeasy mini kit (Qiagen, Inc., Valencia, CA) and hybridized to HGU133A Affymetrix Gene Chips. Expression data were evaluated to identify genes with >2-fold change in expression with P < 0.01.
Measurement of ornithine decarboxylase activity. Ornithine decarboxylase (ODC) activity in Ramos cells treated with either Bz-423 or vehicle control was evaluated as described previously (15). ODC activity, quantified as the amount of [3H]putrescine produced from [3H]ornithine, was normalized to cellular protein content.
Measurement of cellular polyamines. Cellular polyamine content in Ramos cells treated with either Bz-423 or vehicle control was measured by reverse-phase high-performance liquid chromatography (RP-HPLC) using a Spherisorb C18 S3 ODS2 column (15 x 0.46 cm i.d.; 3 µm particle size; Waters Corp., Milliford, MA) as described previously (16).
Immunoblotting. Cells were lysed by resuspension in four times packed cell volume of lysis buffer as described previously (10). Lysates were separated by SDS-PAGE, transferred to polyvinylidene difluoride membranes, and incubated with primary antibodies for proteins of interest, including ODC (29), Flag (M2), and ß-tubulin (TUB2.1) purchased from Sigma-Aldrich. The ODC antizyme 1 (OAZ1) antibody (PW 8885) was purchased from Biomol International (Plymouth Meeting, PA). Antibodies for phospho-c-myc (T58/S62), cyclin-dependent kinase (CDK) 6 (DCS-83), retinoblastoma protein (pRb; 4H1), phospho-Rb (S780), phospho-Rb (S795), and phospho-Rb (S807/811) were purchased from Cell Signaling Technology (Beverly, MA). Antibodies for c-myc (9E10), ß-catenin (14), p27Kip1 (G17-524), p21Cip1 (SX118), cyclin D1 (DCS-9), cyclin D2 (G132-43), cyclin D3 (G107-565), cyclin E (HE12), CDK2 (55), and CDK4 (DCS-35) were purchased from BD PharMingen (San Jose, CA). Primary antibodies were detected using horseradish peroxidaselinked donkey anti-rabbit IgG or sheep anti-mouse IgG (Amersham Biosciences, Little Chalfont, Buckinghamshire, United Kingdom) and visualized by the enhanced chemiluminescence detection system (Amersham Biosciences). Protein levels were estimated by densitometry and normalized with respect to ß-tubulin, which was used as a loading control.
RNA analyses. RNA was isolated from Ramos cells treated with Bz-423 or vehicle control using a RNeasy mini kit. Semiquantitative reverse transcription-PCR (RT-PCR) was done as described (17) using the following primers: ODC (forward GAGCACATCCCAAAGCAAAGT and reverse TCCAGAGTCTGACGGAAAGTA), OAZ1 (forward AGCAGTGAGAGTTCCAGGGTC and reverse ACTGCAAAGCTGTCCTTGCTC), c-Myc (forward TTCGGGTAGTGGAAAACCAG and reverse CAGCAGCTCGAATTTCTTCC), and ß-actin (forward TGGCATTGTTACCAACTGGGACG and reverse GCTTCTCTTTGATGTCACGCAQCG). ß-Actin was used as an internal standard for RNA normalization, and expression patterns were determined from two separate experiments.
Assessment of DNA content by flow cytometry. DNA content was assessed by incubating cells in labeling solution (50 µg/mL propidium iodide in PBS containing 0.2% Triton X-100 and 10 µg/mL RNase A) for 24 hours followed by analysis with a FACSCalibur flow cytometer equipped with CellQuest software (BD Immunocytometry, San Diego, CA).
Measurement of growth inhibition. Growth inhibition of wild-type and c-myc-overexpressing Ramos cells was quantified using the sulforhodamine B assay as described previously (18).
| Results |
|---|
|
|
|---|
To test this hypothesis, we determined if Bz-423 reduces ODC activity by measuring the amount of [3H]putrescine Ramos cells produced using [3H]ornithine as a substrate in the presence of Bz-423 or vehicle alone as described previously (15). As expected, Bz-423 reduced apparent ODC activity within 4 hours to a similar extent as DFMO, a specific inhibitor of ODC (ref. 21; Fig. 1A). Based on the induction of OAZ1 gene expression and the observed decrease in ODC activity, we predicted that Bz-423 decreased ODC activity and protein levels by a post-translational mechanism involving OAZ1-dependent inhibition and subsequent proteolytic degradation. As such, Bz-423 was expected to decrease ODC protein but not affect ODC mRNA levels. To evaluate this hypothesis, Ramos cells were treated with Bz-423, and lysates were analyzed by immunoblotting and RT-PCR to measure ODC and OAZ1 protein and mRNA levels. As predicted, growth-inhibitory concentrations of Bz-423 substantially reduced levels of ODC protein by 8 hours (Fig. 1B). Unexpectedly, however, Bz-423 significantly decreased ODC mRNA levels by 3 hours, whereas OAZ1 protein and mRNA levels were unchanged over the same period (Fig. 1B). Taken together, these findings suggest that OAZ1 does not mediate the decrease in ODC protein.
|
Bz-423 decreases c-Myc and modulates expression of cell cycle regulatory proteins. The absence of an effect of Bz-423 on OAZ1 protein argues against a mechanism whereby Bz-423 targets ODC for proteasomal degradation by a post-translational mechanism. Moreover, the decrease in ODC mRNA suggests that Bz-423 might affect the transcriptional activity of the odc gene. c-Myc is the principal transcriptional activator of odc, and there are two high-affinity c-myc-binding sites within the first intron of the odc gene (22). Therefore, we hypothesized that Bz-423 might reduce c-myc expression or activity to account for the observed changes in odc mRNA and potentially its affects on cell proliferation. Consistent with this expectation, immunoblots of lysates from Ramos cells treated with Bz-423 showed that c-myc protein was decreased significantly by 4 hours and by >90% after 24 hours (Fig. 2).
|
In Bz-423-treated Ramos cell lysates, CDK4 decreased to <20% of basal levels (within 2 hours of treatment) and expression of CDK2 and CDK6 was reduced after 8 hours. Cyclin D3 and E were reduced by Bz-423, whereas cyclin D1 and D2 remained constant over the same period. In untreated Ramos cells, cyclin D3 seemed to be expressed at a significantly greater level than either cyclin D1 or cyclin D2 (data not shown), indicating that in Ramos cells cyclin D3 is the predominant D-type cyclin. p21Cip1 was barely detectable in untreated Ramos cells and did not increase after Bz-423 treatment. Finally, Bz-423 induced a small but significant increase in p27Kip1 by 24 hours (Fig. 2). Collectively, these results indicate that Bz-423 alters expression of cell cycle regulatory genes in a pattern consistent with the observed decrease in c-myc protein and G1 cell cycle arrest.
The primary substrates of the CDKs are the pRb family of pocket proteins (pRb, p107, and p130; ref. 26). In their hypophosphorylated state, pocket proteins bind to members of the E2F family of transcription factors, preventing transcription of E2F-regulated genes that drive S-phase entry. Phosphorylation of the pocket proteins by CDKs results in derepression of E2F-dependent gene transcription and progression through the G1-S checkpoint (26). Bz-423 reduces expression of D- and E-type cyclins as well as CDK2, CDK4, and CDK6. Consequently, Bz-423 was expected to decrease the levels of phosphorylated pRb, p107, and p130. In untreated Ramos cells, pRb is highly expressed, whereas p107 and p130 are barely detectable (data not shown). Following treatment with Bz-423, the phosphorylation state of pRb decreased as shown by an increase in its mobility on SDS-PAGE (Fig. 2). In G1, complexes of D-type cyclins with either CDK2 or CDK4 phosphorylate serine residues located throughout pRb, including S780, S795, S807, and S811 (27). Cyclin E-CDK2 complexes phosphorylate a subset of these residues, including S795, during the passage through the G1-S checkpoint (27). Phospho-Rb antibodies specific for S780, S795, and S807/S811 were used to assess the in vivo activities of CDK2, CDK4, and CDK6 (28). The results of immunoblotting with these antibodies were consistent with decreased CDK2, CDK4, and CDK6 activities corresponding to the Bz-423-induced decrease in expression of these CDKs (Fig. 2). In summary, Bz-423 alters expression of cell cycle regulatory genes resulting in diminished pRb phosphorylation and decreases ODC expression and cellular polyamine levels. In Ramos cells, inhibition of either ODC, with the specific inhibitor DFMO (ref. 21; GI50, 0.61 ± 0.07 mmol/L), or the CDK2-cyclin E complex, with roscovitine (GI50, 14 ± 2 µmol/L; ref. 29), causes growth arrest. Thus, Bz-423-induced growth arrest is mediated by two paths, decreased polyamines and pRb phosphorylation, either of which independently blocks proliferation.
O2 mediates the Bz-423-induced decrease in c-Myc and downstream effects on polyamine metabolism. The manganese superoxide dismutase mimetic, MnTBAP, scavenges Bz-423-induced O2 and blocks the subsequent effects on cell proliferation or viability (10, 11). Consequently, we predicted this antioxidant would prevent the decrease in c-myc as well as the drop in ODC expression and depletion of cellular polyamines induced by Bz-423 if these responses were coupled to Bz-423 binding to the OSCP target via a O2 signal. To test this predicted linkage, Ramos cells were pretreated with MnTBAP and then incubated with Bz-423. MnTBAP prevented the decrease in c-myc protein levels as well as the drop in ODC protein and mRNA (Fig. 3A). MnTBAP also prevented the Bz-423-induced reduction in ODC activity and maintained normal polyamine levels (Fig. 3B and C). Next, we treated cells with other agents that increase reactive oxygen species to determine if the O2 induced by Bz-423 is sufficient to reduce c-myc levels. Ramos cells were treated with hydrogen peroxide, t-butyl hydroperoxide, and arsenic trioxide (As2O3), an agent that generates O2 by targeting mitochondrial function (30). Interestingly, whereas neither hydrogen peroxide nor t-butyl hydroperoxide affected c-myc levels (data not shown), As2O3 reduced c-myc to a similar extent as Bz-423 (Fig. 3D). These data indicate that a specific relationship may exist between mitochondrially derived O2 and the pathway leading to rapid c-myc degradation and that this is not recapitulated by treatment with exogenous oxidants. Collectively, these results couple binding of Bz-423 to its cellular target, O2 generation, and reduction in c-myc with subsequent effects on polyamine metabolism and transcription.
|
|
We expected the Bz-423-induced decrease in c-myc might result from increased proteasomal degradation and predicted that the phosphosensitive residue T58 was involved. To test this hypothesis, we treated Ramos cells with Bz-423 together with bortezomib, a dipeptidyl boronic acid inhibitor of the 26S proteasome (38). Blocking proteasome function in Ramos cells by pretreating with bortezomib before incubation with Bz-423 prevented the decreases in c-myc and cyclin D3, one of the c-myc-dependent gene products affected by Bz-423 (Fig. 4B).
Having identified a role for the proteasome in Bz-423-mediated degradation of c-myc, we stably transfected Ramos cells to express Flag epitope-tagged wild-type c-myc and c-myc mutants in which T58, S62, or both residues were substituted with alanine. We generated these cells to test whether Bz-423-induced c-myc degradation required these specific cis-acting MB1 elements commonly involved in ubiquitin-mediated proteolysis. In addition, if the mutation of T58 prevented Bz-423-induced c-myc degradation, cells transfected with this mutant construct would allow us to determine if the decrease in c-myc was necessary for Bz-423-induced growth inhibition and cell cycle arrest.
When stably transfected cells expressing these proteins were exposed to Bz-423, the levels of Flag-tagged wild-type c-myc and the c-mycS62A mutant decreased in a time course similar to the decrease of endogenous c-myc in cells transfected with a vector control (Fig. 5A). As predicted above, the c-mycT58A mutant and the double mutant c-mycT58A/S62A proteins were substantially resistant to Bz-423-induced degradation at all times and concentrations tested, relative to transfected wild-type c-myc and endogenous c-myc in vector control cells (Fig. 5A). From these results, we conclude that T58 is critical for Bz-423-induced degradation of c-myc.
|
Because T58 phosphorylation promotes ubiquitin-mediated proteasomal degradation, it is possible that Bz-423 is acting to induce increased T58 phosphorylation to trigger c-myc degradation. To explore this possibility, Bz-423-treated cells were immunoblotted with anti-phospho-c-myc (T58/S62), which recognizes c-myc either singly phosphorylated at T58 or doubly phosphorylated at T58 and S62. This antibody does not bind to singly phosphorylated S62 or unphosphorylated c-myc (34, 36). Surprisingly, no increase in phospho-c-myc species detected by this antibody was observed. Instead, the c-myc phosphoprotein levels decreased with identical kinetics to total c-myc protein (Fig. 6A). As a control, lysates were also prepared from Ramos cells following B-cell receptor stimulation with anti-IgM (28, 33). When these activated cells were immunoblotted for total and T58 phosphorylated c-myc, an initial accumulation of both c-myc and phospho-c-myc (T58/S62) was seen, with a maximum reached at 4 hours followed by a decrease in both species to sub-basal levels by 24 hours (Fig. 6A). The absence of an early increase in phosphospecies induced by Bz-423 argues that the decrease in c-myc does not involve a mechanism that increases T58 phosphorylation.
|
| Discussion |
|---|
|
|
|---|
In general, c-myc protein stability is determined by the phosphorylation status of key residues within a highly conserved region from residues 45 to 63 known as MB1 (44). Phosphorylation of S62 increases c-myc half-life but also primes the protein for T58 phosphorylation by GSK-3ß, which targets c-myc for ubiquitination and proteasomal degradation (45). Our results show that Bz-423 decreases total c-myc and phospho-T58-c-myc with identical kinetics. Because an initial increase in phospho-T58 would be expected if the Bz-423-induced degradation of c-myc was mediated by increased phosphorylation of this residue, we conclude that Bz-423 is not acting by increasing T58 phosphorylation. Moreover, GSK-3ß inhibitors did not block the Bz-423-induced decrease in c-myc. This observation further supports our conclusion that inducible T58 phosphorylation is not required for the response and provides direct evidence that GSK-3ß is specifically not required.
Nevertheless, cells expressing c-myc with either single alanine substitution at T58 or double substitution of T58 and S62 are resistant to Bz-423-induced changes in cell cycle and are less sensitive to Bz-423-induced growth arrest as evidenced by an increase in the GI50 values compared with cells transfected with wild-type c-myc. Correspondingly, the mutant c-myc proteins were resistant to Bz-423-induced degradation compared with wild-type transfected or endogenous c-myc protein. These results support a direct link between the reduction of c-myc and the antiproliferative response to Bz-423 and, along with the observed changes in cell cycle regulatory proteins, strongly indicate that the growth-inhibitory response is a result of c-myc depletion.
In addition to phosphorylation, T58 is a target for O-glycosylation by O-linked N-acetylglucosamine (46), and a dynamic interplay exists between O-glycosylation and phosphorylation of this residue (36). Because increased T58 phosphorylation or evidence for involvement of GSK-3ß in Bz-423-induced degradation was not observed, it is possible that T58 glycosylation regulates Bz-423-induced c-myc proteasomal degradation. It is also possible that Bz-423 does not induce any specific T58 or S62 post-translational modifications but instead acts further downstream to increase the efficiency at which c-myc is processed by the proteasome. Rate-limiting steps in proteasomal degradation include both protein-specific modifications, such as phosphorylation, and the enzymatic attachment of ubiquitin to target proteins (47). Interestingly, reactive oxygen species stimulate cellular ubiquitin-ligase activity (48, 49). Therefore, Bz-423-induced O2 may enhance proteolytic processing of c-myc by increasing the expression and/or activity of specific ubiquitin ligases. In support of this possibility, we have observed recently that Bz-423 also induces the rapid, proteasome-dependent degradation of ß-catenin (Supplementary Fig. S1), an oncogenic transcription factor that plays a critical role in Wnt signaling (50). However, Bz-423 does not alter expression of cyclin D1 and D2 (Fig. 2), indicating that some degree of specificity exists regarding which short-lived proteins are targeted following Bz-423 treatment.
In summary, this study identifies depletion of the oncogenic transcription factor c-myc as a key element in the mechanism leading G1 arrest induced by the immunomodulatory benzodiazepine, Bz-423. The close connection between c-myc protein levels and neoplastic growth suggests that Bz-423 may have therapeutic potential against human neoplastic disease where deregulated c-myc expression underlies pathogenesis.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| Footnotes |
|---|
Received 9/28/05. Revised 11/11/05. Accepted 11/17/05.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
I. Kim, C.-W. Shu, W. Xu, C.-W. Shiau, D. Grant, S. Vasile, N. D. P. Cosford, and J. C. Reed Chemical Biology Investigation of Cell Death Pathways Activated by Endoplasmic Reticulum Stress Reveals Cytoprotective Modulators of ASK1 J. Biol. Chem., January 16, 2009; 284(3): 1593 - 1603. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Nyanguile, F. Pauwels, W. Van den Broeck, C. W. Boutton, L. Quirynen, T. Ivens, L. van der Helm, G. Vandercruyssen, W. Mostmans, F. Delouvroy, et al. 1,5-Benzodiazepines, a Novel Class of Hepatitis C Virus Polymerase Nonnucleoside Inhibitors Antimicrob. Agents Chemother., December 1, 2008; 52(12): 4420 - 4431. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Bhagavathula, K. C. Nerusu, A. Hanosh, M. N. Aslam, T. B. Sundberg, A. W. Opipari Jr., K. Johnson, S. Kang, G. D. Glick, and J. Varani 7-Chloro-5-(4-hydroxyphenyl)-1-methyl-3-(naphthalen-2-ylmethyl)-4,5-dihydro-1H-benzo[b][1,4]diazepin-2(3H)-one (Bz-423), a Benzodiazepine, Suppresses Keratinocyte Proliferation and Has Antipsoriatic Activity in the Human Skin-Severe, Combined Immunodeficient Mouse Transplant Model J. Pharmacol. Exp. Ther., March 1, 2008; 324(3): 938 - 947. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |