| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Molecular Biology, Pathobiology, and Genetics |
1 Department of Cellular and Molecular Medicine, School of Medical Sciences, University of Bristol, Bristol, United Kingdom and 2 Department of Clinical Biochemistry, Rigshospitalet, Copenhagen, Denmark
Requests for reprints: A. Bassim Hassan, Department of Cellular and Molecular Medicine (formerly Pathology and Microbiology), School of Medical Sciences, University of Bristol, Bristol, BS8 1TD, United Kingdom. Phone: 44-117-928-7555; Fax: 44-117-928-7896; E-mail: Bass.Hassan{at}Bristol.ac.uk.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
10% of the human population may have LOI of IGF2 in peripheral blood lymphocytes and normal colonic tissue, but in cases of colorectal cancer, the correlation with biallelic expression increases to 30%, with an odds ratio of >3.5 (11). There is little information concerning the intestinal, adenoma, or carcinoma phenotype that is generated by only a 2-fold increase in allelic dosage of IGF2. Two mechanisms seem to account for the LOI and are the basis of molecular tests: hypomethylation of a differentially methylated region (DMR) close to the IGF2 coding region and hypermethylation of a CTCF binding region and DMR upstream of the noncoding H19 promoter, resulting in disruption of an enhancer boundary (1, 3). In these circumstances, alterations in IGF2 imprinting may simply reflect a bystander effect of global modification of DNA methylation that, in some circumstances, may be age related (12). However, direct functional information in the ApcMin/+ mouse, a model of human intestinal polyposis, has shown that IGF-II supply directly modifies intestinal growth and promotes adenoma progression when continuously expressed using a bovine keratin 10 promoter driven transgene (5), and that biallelic expression of Igf2 can increase adenoma burden (13). IGF-II is a potent embryonic and tumor growth factor that signals via the IGF-I receptor (IGF1R) through the Ras/mitogen-activated protein kinase, phosphatidylinositol 3-kinase/Akt/FOXO, and S6K/mammalian target of rapamycin (mTOR) signaling pathways to modify cell proliferation, cell survival, gene expression, and cell growth (8, 9, 14). IGF-I, the related ligand, accounts for postnatal growth and persists throughout adult life, with levels in the high reference range being correlated with increased risk of prostate and breast cancer (15). IGF-II can activate signaling via the IGF1R, isoform A of the insulin receptor, and chimeric forms of the IR and IGF1R (16). Specific IGF1R kinase inhibitors, therapeutic antibodies to IGF1R and to both ligands, have been developed and seem to inhibit colorectal cancer cell growth (17, 18). Unlike IGF1R and IGF-binding proteins (IGFBP), IGF2R is a type I membrane protein that specifically binds IGF-II with high affinity (Kd = 1010 mol/L) but does not lead to signal transduction (19). Rather, IGF2R functions to sequester IGF-II for internalization and degradation in the prelysosomal compartment and reflects its other main function as a mannose 6-phosphate receptor (19, 20).
Epigenetic modification and mutations of the IGF-II signaling system occur in human colorectal tumors (21). Supply of IGF-II is frequently up-regulated, and serial analysis of gene expression has shown IGF2 as a commonly overexpressed gene in human colorectal cancer cell lines and tumors (22), and inactivating mutations of IGF2R and loss of heterozygosity are often detected in hereditary nonpolyposis colorectal cancerderived tumors (23). Moreover, the proposed tumor suppressor function of IGF2R may also implicate other ligands, such as latent transforming growth factor-ß1 (TGF-ß1), which is activated once bound to the mannose 6-phosphate binding sites of the receptor (24). IGF-II supply is also a potent modifier of colorectal cancer cell line growth (21, 25, 26) and seems to be expressed in early colorectal adenoma (27).
In the mouse, Igf2 and Igf2r are reciprocally imprinted and expressed from the paternal and maternal alleles, respectively (2830). When detected with in situ hybridization, Igf2 mRNA is normally detected during post-implantation development, with expression restricted to the paternal inherited allele in later development and in the adult, except in the exchange tissues of the brain (30). Disruption of the paternal allele (Igf2+m/p) results in proportional dwarfism first detected between E9.5 to E11, when quantified by either cell number or weight, respectively (31, 32). LOI of Igf2 following maternal allele deletion of H19 and a CTCF boundary element (
H19m/+p) results in proportionate overgrowth that can be completely rescued by combination with Igf2+m/p, suggesting that loss of H19 generates no other Igf2-independent effects (33).
Here, we quantify the specific functional consequences of the Igf2 gene dosage in combination with the ApcMin/+ model using Igf2m/p (homozygous null), Igf2+m/p (maternal allele expressed alone), Igf2+m/+p (wild-type with paternal expressed allele intact), and
H19m/+p (biallelic expression). We then tested whether the phenotypes observed are due to increased ligand supply by the introduction of a bovine keratin 10driven transgene expressing a soluble full-length mouse Igf2r (K10
Igf2r), previously shown to act as a ligand trap and to limit IGF-II bioavailability (23, 3437).
| Materials and Methods |
|---|
|
|
|---|
H19m/+p breeding pairs were obtained from Christopher Graham, Agiris Efstratiadis, Andrew Silver, and Shirley Tilghman and generated as described (30, 33, 38). Mice were housed, fed, and maintained as described previously in nonspecific pathogen-free conditions (5). All mouse lines tested positive with PCR for stool Helicobacter species. Breeding schedules were as described (Table 1). DNA extraction from ear clips from 10-day-old mice and PCRs were done as previously described (5, 38), except for H19, which were genotyped using MutH19-For CTAGAGCTCGCTGATCAGCCT, MutH19-Rev GACAGTGGGAGTGGCACCTT, WtH19-For CCATCTTCATGGCCAACTCT, and WtH19-Rev AATGGGGAAACAGAGTCACG (annealing at 62°C).
|
RNA extraction and reverse transcription-PCR. For collection of tissue for reverse transcription-PCR (RT-PCR), tissues and adenoma were excised under a dissecting microscope, snap frozen in liquid nitrogen, and stored at 80°C. Total RNA was extracted using Trizol (Invitrogen, San Diego, CA), chloroform, and isopropanol precipitation. Following DNaseI treatment (Promega, Madison, WI), oligo-dT extraction (Promega), and reverse transcription, real-time PCR reactions with Taqman probes were done using a Stratagene MX3000P. For Igf2 (NM_010514) and Gapdh (NM_008084), mouse Qiagen Quantitect Taqman probe assays (Chatsworth, CA) were used (241110 and 241012, respectively). For endogenous Igf2r (NM_010515), JHForward 5'-ACCTGTTCTCCTGGTACACTT-3' and JHReverse 5'-CAGTAAGGCCAGCAAGCAG-3' primers amplified product, which included the trans-membrane domain, and a Taqman probe-JHTaq 5'-FAM-TCCGCTCTGAGAGTCCTTTATACTCTGGCC-TAMRA-3' were used for real-time product detection. For the K10
Igf2r transgene, primers JHForward and Reverse JHK10 5'-TCCCTTCTCTCCTTCTTACTAGT-3', with the 3' end corresponding to the inserted SpeI site in the deleted trans-membrane region. JHTaq was also used to detect transgene expression, and RNA from an independent nontransgenic line was used as a negative control. Reactions were done for 40 cycles using Qiagen Quantitect reagents (204343) and following manufacturer's instructions (38, 40). Reaction conditions were initial denaturing, 94°C; annealing, 56°C; and extension for all experiments, 76°C. Additional positive and negative controls were cDNA from Igf2+m/+p and Igf2m/p mouse embryonic fibroblasts (passage 1) and plasmids with Igf2r and K10
Igf2r cDNA. Target gene quantification was done relative to Gapdh controls (normalized to 100,000 copies) using calibration reactions.
Statistical analysis. Comparisons between genotypes were displayed as box plots and used nonparametric statistics throughout (Mann Whitney, two tailed). Expected and observed breeding outcomes used
2 with Yates correction. Calculations used Minitab release 14.
| Results |
|---|
|
|
|---|
H19m/+p (biallelic) were crossed with inbred ApcMin/+ (Table 1). Increased allelic expression of Igf2 resulted in increased intestinal growth by 120 days, as judged by overall surface area and crypt cell number (Fig. 1A-B; Supplementary Fig. S1; Supplementary Table S1). The effect of allelic dose did not seem uniform along the length of the small intestine and seemed more prominent in the proximal small intestine (Fig. 1A). Elongation of the crypt and villus proliferative zone was quantified using staining with an anti-MCM2 antibody that labels cells undergoing DNA replication (Fig. 1C-D, MCM2). Significant expansion of the proliferative zone was detected with increasing Igf2 allelic dosage and was confirmed by anti-BrdUrd staining (data not shown). Differentiation of the small intestine was assessed using antibodies to E-cadherin, villin, MUC2, and lysosyme and only showed subtle attenuation of villin staining in
H19m/+p, which seemed independent of altered intracellular distribution of ß-catenin (Fig. 1D; Supplementary Fig. S2).
|
H19m/+p but is not a direct 2-fold effect in most tissues at 120 days (Fig. 2A). There seems to be differences following comparison of Igf2 expression between mouse strains (129 and B6) without disrupted Igf2 supply. The magnitude of the increased expression in wild-type 129 compared with B6 is similar to comparison of wild-type B6 to
H19m/+p (B6/B6). Moreover, endogenous Igf2r expression on the 129 strain also seems higher than 129/B6 or B6/B6 expression (Fig. 2B), irrespective of expression of the K10
Igf2r/+ transgene (below, Fig. 2C-D). Overall, these observations suggest that continuous supply of ligand modifies crypt cell progenitor maturation independent of ApcMin/+.
|
H19m/+p, ApcMin/+ (biallelic), P = 0.0097 (B6/B6). However, when adenoma were normalized relative to growth of the small intestine and colon surface area, a significant decrease in total adenoma number was only detected in the small intestine of Igf2+m/p, ApcMin/+ (129/B6, P = 0.0002), confirming our previous data obtained with lines contaminated with unknown ApcMin/+ modifier alleles (ref. 5; Fig. 3A, normalized to intestinal growth). In comparison, a significant increase in normalized adenoma burden was only detected in
H19m/+p, ApcMin/+ (B6/B6) colon but not small intestine (Fig. 3B, normalized to colon growth). Inbreeding of Igf2+m/p against the parent C57Bl6 line was done for five generations, before we attempted to generate complete Igf2m/p, ApcMin/+ (homozygous Igf2 null mice) but failed to observe correct Mendelian segregation at birth (Supplementary Table S2). One Igf2m/p, ApcMin/+ (B6/B6) mouse survived into adulthood and had an adenoma burden equivalent to Igf2+m/p, ApcMin/+ controls [129/B6, 0.58 versus 0.54 ± 0.12 (mean ± SD) adenoma cm2]. Distribution of small intestine adenoma size was similar between genotypes, except in
H19m/+p, ApcMin/+, where a disproportionate number seemed larger compared with wild-type ApcMin/+ (Fig. 3C). Examination of adenoma sections, scored independently of genotype, revealed an increase in the proportion of adenoma containing at least a single focus of high-grade versus low-grade dysplasia in a mid-adenoma section of
H19m/+p, ApcMin/+ (68 of 85) versus ApcMin/+ controls (12 of 22), confirming an effect of Igf2 LOI on intestinal adenoma progression (Supplementary Fig. S3). Features of carcinoma in situ and stromal reaction were also detected in colonic adenoma from
H19m/+p, ApcMin/+, but no metastases were observed (Supplementary Fig. S3; ref. 39). Overall, this suggests that Igf2 has predominant effects on adenoma progression when compared at a single time point (120 days), which seem to become more marked with increasing time.3 Here, we cannot exclude modifier effects on adenoma initiation during crypt fission events in early intestinal development (42).
|
Igf2r/+; refs. 34, 38). Heterozygotes of the highest expressing transgenic line (Kipps), expressed the transgene in the stomach, small intestine, colon, and adenoma, as detected by a transgene specific Taqman quantitative RT-PCR (Fig. 2C-D). In all cases, the transgene was transmitted from a 129 background in coisogenic crosses with B6 (129/B6). No circulating serum protein was detected with an IGF2R ELISA (data not shown), and endogenous Igf2r expression was not significantly affected by transgene expression (Fig. 2B). Crossing K10
Igf2r/+ with ApcMin/+ (129/B6) resulted in a significant reduction of colonic crypt depth, MCM2 and phospho-IRS1 staining, and adenoma number to levels comparable with Igf2+m/p (Fig. 1B-D and Fig. 3A-C; Supplementary Fig. S1 and Table S1). In particular, significantly less adenoma formed in the distal small intestine compared with ApcMin/+ (Igf2, wild type) littermate controls (P = 0.0003; Fig. 3A). A second series of genetic crosses were used to evaluate Igf2-dependent and Igf2-independent effects of sIGF2R supply (Table 1). Combination of Igf2+m/p, ApcMin/+ (B6/B6) with the transgene K10
Igf2r/+ (129/129, n = 6) resulted in no further reduction of adenoma number in the small intestine compared with Igf2+m/p, ApcMin/+ controls (n = 3) and suggests that there is no significant Igf2-independent activity of sIGF2R (Fig. 4A). Combination of
H19m/+p, ApcMin/+ with the transgene also led to suppression of small intestinal MCM2 labeling (Fig. 1C), small intestine (Fig. 4B) and colonic (Fig. 4C) adenoma number, to levels equivalent to the K10
Igf2r/+, ApcMin/+ controls despite limited mouse numbers, and confirmed the Igf2-dependent activity of K10
Igf2r/+ as a specific inhibitor to the consequences of increased ligand supply generated by Igf2 LOI. Moreover, the effects of transgene expression are independent of overall growth effects in the mouse, as determined by intestinal surface area and whole body weight (Supplementary Table S1).
|
H19m/+p, ApcMin/+ adenoma of all sizes (23 of 28 adenoma from mid-adenoma sections has at least one obvious focus, n = 5 mice) compared with littermate ApcMin/+ controls (3 of 12, n = 5 mice; Fig. 4D). Staining of sections and Western blotting with E-cadherin antibodies failed to show significant down-regulation of E-cadherin in
H19m/+p, ApcMin/+ and suggests that the appearance of nuclear ß-catenin is independent of E-cadherin activity (data not shown). In all adenoma, more extensive phospho-IRS1 labeling was also evident in areas, where there was nuclear ß-catenin in
H19m/+p, ApcMin/+. Phospho-IRS1 staining seemed reduced in parallel processed specimens and was associated with a reduced extent of nuclear ß-catenin staining in K10
Igf2r/+,
H19m/+p, ApcMin/+ adenoma, although persistence of staining was observed in adenoma that did only form in the proximal small intestine, presumably because of the differential extent of transgene expression in this region (Fig. 4D). | Discussion |
|---|
|
|
|---|
Here, we show that biallelic expression of Igf2 following germ line disruption of an imprinting control region upstream of H19 results in marked intestinal phenotypic effects that seem independent of the generalized overgrowth phenotype (
130% of wild-type body weight). We then evaluated the consequences of this biallelic expression of Igf2 on the development of the ApcMin/+ intestinal adenoma phenotype and show that growth and differentiation effects seem to develop with increasing Igf2 expression. In particular, we found that comparison of the expression of a single paternal allele of Igf2 had significant effects on adenoma number as shown previously, whereas expression of both Igf2 alleles resulted in no significant alteration in adenoma number in the small intestine, but an alteration in adenoma differentiation with associated high-grade dysplasia, and an increase in colonic adenoma number (5). Similar differential dose response effects of the IGF1R receptor in the RIPTag model have been described, with initial expression modifying tumor proliferation and apoptosis and higher expression associated with invasion and tumor metastasis (9). Results of a similar nature to those reported here have been obtained recently, and both are relevant to the observation that humans that develop colorectal cancer seem to frequently have systemic loss of imprinting leading to biallelic Igf2 expression (2, 13). The data from Sakatani et al. (13) differ from those reported here, as we did not detect a significant increase in small intestinal adenoma number (when normalized for intestinal surface area) as a result of biallelic Igf2 expression presumably because of the effects of strain-dependent ApcMin/+ modifiers (13, 41). In this regard, although mRNA expression may not correlate with ligand supply, we note that global increases in relative Igf2 expression were observed in wild-type 129 compared with B6 strain, suggesting that crosses containing 129 may have increased relative Igf2 supply. In the context of
H19m/+p, ApcMin/+, although Igf2 expression increases compared with ApcMin/+ B6 controls, the eventual level of expression is only equivalent to that detected in the wild-type 129 line and may contribute to the differences in adenoma number between strains. However, the relative strain expression of Igf2r matches that of Igf2, and total adenoma number are lower in 129/B6 crosses than B6/B6, suggesting a more complex situation (see Figs. 2 and 3).
We directly tested the dose-dependent effect of Igf2 allelic supply by expressing a soluble IGF2R expressing transgene, previously shown to inhibit overgrowth effects in the intestine generated as a consequence of IGF-II overexpression (34, 42, 47). Our results show rescue of the bialleic Igf2 intestinal phenotype when combined with the ApcMin/+ mouse, an effect which we also determined not to be independent of Igf2 in parallel crosses with Igf2+m/p. This evidence suggests that the phenotypic effects observed are due to increased supply of ligand, as soluble IGF2R acts to limit IGF-II bioavailability. Previous studies in cell lines and tumors derived from them support the tumor suppressor function of membrane-bound and soluble IGF2R (3537, 48). In some circumstances, excess supply of IGF2R may lead to increased conversion of latent TGF-ß1 to active TGF-ß1, but the results of genetic crosses fail to show any significant Igf2-independent activity in the small intestine and colon.
We propose that the reason that we observed an increase in adenoma number in the colon and adenoma growth in the small intestine was as a direct result of Igf2 acting as a progression factor subsequent to the loss of initiating Apc tumor suppressor function (5, 8). The mechanism may be due to a combination of modification of cell survival, proliferation, growth, and differentiation. In addition, the mechanisms that underlie the modifier effects of Igf2 allelic dosage on the intestinal adenoma phenotype implicate potential direct interactions between the Igf2 and Wnt gene signaling systems. To date, evidence points towards modification of the bioavailability of ß-catenin and phosphorylated substrates of Akt. One obvious target may be glycogen synthase kinase 3 (GSK3ß), an Akt substrate and key modifier of Wnt signaling via phosphorylation of ß-catenin. However, structural constraints exerted by Apc/Axin complexes negate functional interactions with Akt (49). Akt activation as a consequence of overexpression IGF1R mediated signaling seems to down-regulate the supply of E-cadherin, which also regulates cellular ß-catenin, although we found no evidence to support this effect as a mechanism of nuclear ß-catenin accumulation in adenoma (9, 50). Previous work suggests that IGF-II expression modifies colorectal cell differentiation and the nuclear localization of ß-catenin (25, 26). In addition, expression of activated Akt can increase expression of luciferase reporter gene for ß-catenin/Tcf (51). Recently, direct binding of ß-catenin to FOXO transcription factors, phosphorylated and depleted from nuclei by IGF1R-and IR-mediated signaling, accounted for the increased activation of FOXO target genes (e.g., p27Kip1) by increased nuclear ß-catenin (52). Intriguingly, this evidence suggests that activated ß-catenin would generate cell cycle arrest and apoptosis via direct activation of FOXO target genes, an effect that is inhibited and tumor promoting in the presence of IGF-II and Akt activation. If true, the marked effect of reduction in IGF-II supply in the context of activated ß-catenin, as shown here in the context of ApcMin/+, may be accounted for by ß-catenin specifically sensitizing these cells to cell cycle arrest and cell death (52). Disruption of the FOXO target gene p27Kip1 increases progression of ApcMin/+, but not Smad3, intestinal adenoma, and is consistent with this hypothesis (53). Moreover, components of the IGF signaling pathway, such as mTOR and FOXO, may actually increase the rate of Apc loss of heterozygosity and increase adenoma-initiating events (54).
IGF-II ligand availability also seems to be modified by the ß-catenin/Tcfmediated overexpression of matrix metalloproteinase-7. Release of enzyme into the extracellular space then results in cleavage of IGFBP and increased local bioavailability of IGF-II ligand (55). The inhibitory consequences of Mmp7 disruption on ApcMin/+ adenoma is also consistent with this hypothesis but does not explain the apparent increase in Igfbp5 expression in adenoma detected using expression arrays (56, 57). More importantly, the 2-fold effect of Igf2 gene dosage would be normally omitted from array gene expression analysis and underscores the bias against potentially haploinsufficient gene phenotypes.
The potency of allelic dosage of Igf2 is evident from the alteration in phenotype of the intestine crypt in the mouse, and this evidence supports the significant correlation between LOI of Igf2 and the risk of developing sporadic colorectal cancer. Moreover, we have applied this validated genetic model to test potential therapeutic molecules that target this system. We tested the effects of a specific IGF-II intervention based on a soluble form of an endogenous receptor that normally functions to sequester IGF-II and is classed as a tumor suppressor. Similar use of ligand trap to other growth factors have been investigated in intestinal cancer (e.g., anti-vascular endothelial growth factor antibodies, soluble IGF1R, and soluble Noggin; refs. 5860). A number of alternative approaches have also been developed to directly inhibit IGF ligandmediated signaling, including IGF1R kinase inhibitors and antibodies directed at ligands and IGF1R (18, 58). We now provide genetic evidence that the consequences of excess supply of IGF-II ligand can be rescued by a specific high-affinity soluble IGF2 receptor, and this supports the rationale application of this novel IGF-IItargeted therapy for cancer.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Jenny Baker and Irene Withington for histology; Anne Hancock for quantitative PCR; Chris Graham (Department of Zoology, University of Oxford, Oxford, United Kingdom), Andrew Silver (St. Mark's Hospital, CR-UK, Harrow, United Kingdom), Wolf Reik (Babraham Institute, Cambridge, United Kingdom), Agiris Efstratiadis (Columbia University, New York, NY), and Shirley Tilghman (Princeton University, Princeton, NJ) for supply of mice; and Chris Graham and Chris Paraskeva for discussion.
| Footnotes |
|---|
Competing interests statement: The authors declare they have no competing financial interests.
3 Harper and Hassan, unpublished observations. ![]()
Received 6/10/05. Revised 12/ 5/05. Accepted 12/13/05.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
Y. Adachi, R. Li, H. Yamamoto, Y. Min, W. Piao, Y. Wang, A. Imsumran, H. Li, Y. Arimura, C.-T. Lee, et al. Insulin-like growth factor-I receptor blockade reduces the invasiveness of gastrointestinal cancers via blocking production of matrilysin Carcinogenesis, August 1, 2009; 30(8): 1305 - 1313. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Rezgui, C. Williams, S. A Savage, S. N Prince, O. J Zaccheo, E Y. Jones, M. P Crump, and A B. Hassan Structure and function of the human Gly1619Arg polymorphism of M6P/IGF2R domain 11 implicated in IGF2 dependent growth J. Mol. Endocrinol., April 1, 2009; 42(4): 341 - 356. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. B. Corcoran, T. Bachar Raveh, M. T. Barakat, E. Y. Lee, and M. P. Scott Insulin-like Growth Factor 2 Is Required for Progression to Advanced Medulloblastoma in patched1 Heterozygous Mice Cancer Res., November 1, 2008; 68(21): 8788 - 8795. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. M. Gallagher, D. M. O'Shea, P. Fitzpatrick, M. Harrison, B. Gilmartin, J. A. Watson, T. Clarke, M. O. Leonard, A. McGoldrick, M. Meehan, et al. Recurrence of Urothelial Carcinoma of the Bladder: A Role for Insulin-Like Growth Factor-II Loss of Imprinting and Cytoplasmic E-Cadherin Immunolocalization Clin. Cancer Res., November 1, 2008; 14(21): 6829 - 6838. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Chitnis, J. S.P. Yuen, A. S. Protheroe, M. Pollak, and V. M. Macaulay The Type 1 Insulin-Like Growth Factor Receptor Pathway Clin. Cancer Res., October 15, 2008; 14(20): 6364 - 6370. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Piao, Y. Wang, Y. Adachi, H. Yamamoto, R. Li, A. Imsumran, H. Li, T. Maehata, M. Ii, Y. Arimura, et al. Insulin-like growth factor-I receptor blockade by a specific tyrosine kinase inhibitor for human gastrointestinal carcinomas Mol. Cancer Ther., June 1, 2008; 7(6): 1483 - 1493. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. N. Prince, E. J. Foulstone, O. J. Zaccheo, C. Williams, and A. B. Hassan Functional evaluation of novel soluble insulin-like growth factor (IGF)-II-specific ligand traps based on modified domain 11 of the human IGF2 receptor Mol. Cancer Ther., February 1, 2007; 6(2): 607 - 617. [Abstract] [Full Text] [PDF] |
||||
![]() |
J Riedemann and V M Macaulay IGF1R signalling and its inhibition Endocr. Relat. Cancer, December 1, 2006; 13(Supplement_1): S33 - S43. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |