Cancer Research AACR Membership  Sign up for Cancer Research eTOC's
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yu, Y.
Right arrow Articles by Merlino, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yu, Y.
Right arrow Articles by Merlino, G.
[Cancer Research 66, 1982-1989, February 15, 2006]
© 2006 American Association for Cancer Research


Molecular Biology, Pathobiology, and Genetics

The Homeoprotein Six1 Transcriptionally Activates Multiple Protumorigenic Genes but Requires Ezrin to Promote Metastasis

Yanlin Yu1, Elai Davicioni2, Timothy J. Triche2 and Glenn Merlino1

1 Laboratory of Cell Regulation and Carcinogenesis, National Cancer Institute, NIH, Bethesda, Maryland and 2 Department of Pathology and Laboratory Medicine, Children's Hospital Los Angeles, University of Southern California Keck School of Medicine, Los Angeles, California

Requests for reprints: Glenn Merlino, Laboratory of Cell Regulation and Carcinogenesis, National Cancer Institute, NIH, Building 37, Room 5002, Bethesda, MD 20892-4264. Phone: 301-496-4270; Fax: 301-480-7618; E-mail: gmerlino{at}helix.nih.gov.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The vast majority of deaths associated with cancer are a consequence of a complex phenotypic behavior, metastasis, by which tumor cells spread from their primary site of origin to regional and distant sites. This process requires the tumor cell to make numerous adjustments, both subtle and dramatic, to successfully reach, survive, and flourish at favorable secondary sites. It has been suggested that molecular mechanisms accounting for metastatic behavior can recapitulate those employed during embryogenesis. We have shown that the homeodomain transcription factor Six1, known to be required for normal development of migratory myogenic progenitor cells, is sufficient to promote metastatic spread in a mouse model of the pediatric skeletal muscle cancer rhabdomyosarcoma. Here, we report that Six1 is able to activate the expression of a set of protumorigenic genes (encoding cyclin D1, c-Myc, and Ezrin) that can control cell proliferation, survival, and motility. Although the role of Ezrin in cytoskeletal organization and adhesion has been well studied, the means by which its expression is regulated are poorly understood. We now show that the gene encoding Ezrin is a direct transcriptional target of Six1. Moreover, Ezrin is indispensable for Six1-induced metastasis and highly expressed in a panel of representative pediatric cancers. Our data indicate that Ezrin represents a promising therapeutic target for patients with advanced-stage rhabdomyosarcoma and perhaps other malignancies. (Cancer Res 2006; 66(4): 1982-9)


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The ability to metastasize is the most devastating of tumor cell behaviors. To successfully metastasize, an opportunistic tumor cell will overcome and survive a series of challenges, including detachment from the primary tumor mass, invasion into blood or lymphatic vessels, transportation to a new site, migration through the endothelium, penetration into surrounding tissue structures, and colonization through sustained growth (13). Throughout this process, tumor cells must modify the manner in which they interact with both other cells and to the extracellular matrix (ECM). It has been noted that the behavior of metastatic tumor cells is reminiscent of migratory embryonic cell types, raising the possibility that the two behaviors may share common regulatory mechanisms. In fact, many genes with known essential developmental roles are mutated or aberrantly expressed in advanced tumors.

The process by which tissues and organs form is orchestrated through the regulation of complex behaviors in which cells change their relative positions in the embryo, ultimately becoming associated with other cell types. Skeletal muscle development, for example, requires somitic mesenchymal progenitor cells to successfully migrate from the hypaxial dermomyotome to distant sites where they survive to establish major muscle tissue in the body and limbs. This choreographed series of steps, like metastasis, requires precise modifications of cell-cell and cell-ECM interactions. Delamination, migration, and survival of the muscle progenitor cells are regulated by several factors, including Pax3, c-Met, Lbx1, Mox2, and Six1 (4, 5).

SIX1 is a vertebrate homologue of the sine oculis gene, first identified in Drosophila, where it functions in concert with eyeless (Pax), eyes absent (Eya), and dachshund (Dac) to regulate eye development (6). Sine oculis is expressed largely in migrating cells associated with invagination, and its absence is incompatible with Drosophila life (7). Six1 is a member of the Six1 family of homeodomain proteins known to transcriptionally activate muscle genes during myogenesis. Mice deficient in Six1 exhibit abnormal development of skeletal muscle and other organs and do not survive (812). Six1 has also been implicated in the autosomal developmental disorder branchio-oto-renal syndrome (13), the regulation of cellular proliferation at the G2-M cell cycle checkpoint (14, 15), and is overexpressed and can be amplified in some cancers (14, 1618). Recently, we reported the use of microarray expression profiling to identify Six1 as a regulator of metastasis in a mouse model of the pediatric cancer rhabdomyosarcoma, although the mechanism by which Six1 stimulated metastasis was unknown (19). Another prometastasis protein, Ezrin, was identified in the same microarray screen whose expression seemed to correlate with that of Six1.

Ezrin, encoded by Vil2, is a member of the Ezrin-Radixin-Moesin (ERM) family within the band 4.1 superfamily. Ezrin serves as a physical link between the plasma membrane and the actin-based cytoskeleton; however, it has also been implicated in signal transduction pathways involving protein kinase A, Rho, phosphatidylinositol 3-kinase/Akt, mitogen-activated protein kinase (MAPK), and Src (2023). Ezrin activity is dictated by its phosphorylation status, and Ezrin is a target of the tyrosine kinase receptor c-Met (24, 25). Ezrin is known to influence cell-cell and cell-ECM interactions through its association with CD44, intercellular adhesion molecules, E-cadherin, and ß-catenin (26). Ezrin thus regulates normal cellular morphology, motility, invasiveness, and adhesiveness, all functions that could be subverted by the metastasizing cancer cell. The placement of Ezrin at the nexus of these critical pathways would suggest a significant role in cancer and its progression. In fact, Ezrin had been implicated in the metastasis of mammary and pancreatic adenocarcinoma (27, 28) and osteosarcoma (29, 30) as well as in our rhabdomyosarcoma model (19). Although much is known about how Ezrin functions, very little is known about how expression of Vil2 is regulated.

Here, we show for the first time that the developmental homeoprotein Six1 transcriptionally activates Ezrin as well as the cell cycle regulator cyclin D1. Notably, RNA interference (RNAi)–based knockdown of Ezrin fully inhibited the ability of Six1 to promote metastasis in rhabdomyosarcoma cells. The discovery of a key role for Ezrin and perhaps other ERM members in this metastatic pathway, as well as in the response of cancer cells to chemotherapy (31, 32), identifies a family of candidate therapeutic targets for advanced-stage disease.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell culture, transfection, and antibodies. All rhabdomyosarcoma cell lines were derived from rhabdomyosarcoma tumors arising in hepatocyte growth factor/scatter factor (HGF/SF)-transgenic, Ink4a/Arf-deficient mouse (19) and maintained in RPMI 1640 supplemented with 10% fetal bovine serum (FBS; Invitrogen, Carlsbad, CA). Swiss3T3 cell line was obtained from the American Type Culture Collection (Manassas, VA) and maintained in DMEM plus 10% FBS. The mouse Six1 expression plasmid was a generous gift from Dr. Pascal Maire (Institut Cochin, INSERM, Paris, France). Flag-Six1 and Flag-Six1-CT plasmids were constructed by placing the full-length Six1 and the Six1 CT (182-284 amino acids) fragments into p3XFLAG-myc CMV26 (Sigma, St. Louis, MO); the CT fragment encodes the COOH-terminal end, missing both homeodomain and SIX domain. For stable expression of short hairpin RNA (shRNA), dsDNA directed against nucleotides 174 to 194 and 135 to 155 of the mouse ezrin (XM_123004) and six1 (X80339) coding regions, respectively, were synthesized and cloned into the pSUPER vector (19). The luciferase reporter system was constructed using pGL3 luciferase reporter vectors (Promega, Madison, WI). The deletion of the Six1 binding core sequence (TCAGG) in the Ezrin promoter was done using the Quikchange Site-Directed Mutagenesis kit (Stratagene, La Jolla, CA). Transfection assays were done using LipofectAMINE 2000 (Invitrogen). Immunoblots were done on lysates generated from cultured cells and tissues solubilized in radioimmunoprecipitation assay buffer (33). Antibodies used included anti-Ezrin (Upstate Biotechnology, Charlottesville, VA); anti-Six1, anti-ß-actin, anti–cyclin D1, anti–cyclin A (recognizes both A1 and A2), anti–cyclin B1, anti–cyclin E1, and anti-c-Myc (Santa Cruz Biotechnology, Santa Cruz, CA); anti-Flag M2 (Sigma); anti-phospho-Akt(Ser473)4E2 monoclonal, anti-Akt polyclonal, anti-phospho-p42/44, and anti-p42/44 (Cell Signaling, Beverly, MA).

Luciferase reporter assays. Luciferase assays were done in 24-well plates in triplicate. Cells (4 x 104) were seeded into 24-well plates 1 day before transfection. At 24 hours post-transfection, the cells were harvested and lysed in 200 µL cell lysis buffer (PharMingen, San Diego, CA). The luciferase activity was measured using the Lumat LB 9507 (Wallac, Inc., Gaithersburg, MD) with 70 µL cell lysate and 200 µL assay buffer (PharMingen). The luciferase values were normalized using ß-galactosidase activity as an internal control. Ezrin promoter fragments used in luciferase reporter assays included the full –1,616 to –1 region, the –1,106 to –870 region containing the MEF3-like motif TTCAGGA, and the –230 to –121 control region. The –944 to –1 cyclin D1 promoter fragment was used for the luciferase reporter.

Adhesion assay. The adhesion assay was developed based on previously described assays (34, 35). All adhesion assays were done in 96-well plates in triplicate. Fibronectin (100 µL; 10 µg/mL; Sigma) was added to the appropriate wells, leaving sufficient blank wells to determine 100% attachment at three cell concentrations and to determine background binding of crystal violet to plastic, and the plates were incubated overnight at 4°C. Before seeding the cells, the fibronectin solution was removed by aspiration, and heat-denatured bovine serum albumin (BSA) solution (200 µL; 10 mg/mL) was added to each sample well and incubated for 30 minutes at room temperature. This step was omitted to determine 100% attachment. During that time, a sufficient number of working cell suspensions (5 x 105/mL in DMEM containing 10% BSA) was prepared and incubated for 10 minutes at 37°C. After washing the sample wells with 100 µL Dulbecco's PBS (DPBS), 50 µL working cell suspensions were added to the sample wells followed by 50 µL DPBS and incubated for 30 minutes. The 20%, 50%, and 100% diluted cells of the working cell suspension were added to uncoated wells in the same volume for estimating 100% attachment. The experimental sample wells, but not those being used to determine 100% attachment, were gently washed thrice with 100 µL DPBS, and all wells were supplemented with 100 µL of 5% (w/v) glutaraldehyde (Sigma) and incubated for 20 minutes at room temperature. After washing wells thrice with 100 µL water, 0.1% (w/v) crystal violet solution (100 µL) was added to wells for 60 minutes at room temperature. After the wells were washed thrice with 400 µL water, 10% (v/v) acetic acid (100 µL) was added and incubated for 5 minutes on an orbital shaker at 150 rpm at room temperature. Absorbance was measured at 570 nm using a microtiter plate reader. The final value was determined by subtracting the background crystal violet staining from all experimental and 100% attachment results. Data were plotted from the 20%, 50%, and 100% inocula (A570 versus cell density) and the values for 100% attachment were determined by extrapolation. This value was used to express experimental data as a percent attachment.

Electromobility shift assay. Two complementary oligonucleotides containing the Six1 binding core sequences were annealed and the recess 3'-end filled with [{alpha}-32P]dCTP in the presence of DNA polymerase (Klenow fragment; ref. 36). Recombinant human Six1 protein (50 ng), purchased from Abnova (Taiwan), were used per binding assay. Electromobility shift assay (EMSA) was done according to the manufacturer's instructions (Panomics, Redwood City, CA) using 2 ng probe and 1 µg anti-Six1 antibody (A-20, Santa Cruz Biotechnology). Competition was done using 100 ng cold probe. Sequences from the Ezrin and cyclin D1 promoters used for the EMSA assays were CCCCAATAGAAATTCAGGAGCAGCTCG and GGGGATCCTTTAAAGTTCAGATACCCCTCTGG, respectively.

Chromatin immunoprecipitation. To prepare chromatin, cells were formaldehyde cross-linked for 15 minutes at room temperature by adding 0.1 volume of cross-linking solution directly to the culture medium in the plates. Cross-linking was stopped by the addition of glycine to a final concentration of 125 µmol/L. Cells were washed twice with ice-cold PBS, harvested in PBS by scraping, and subjected to chromatin immunoprecipitation (ChIP) analysis following the manufacturer's instructions (Upstate Biotechnology). Immunoprecipitated DNAs were analyzed by PCR using the following primers: Ezrin promoter –1,106 to –870, GTAGCAAAAGGCTCCACAG and ACCCTTCCAGTGCAGTACC; Ezrin promoter –230 to –121, ATCCCAGTTTGTGAAGAAAAGG and GCAGGTTTCACTTCGTGTAG; cyclin D1 promoter –919 to –614, AGACAAATCTCAGATCCCACC and GACCCATTGCTTAGAAATCCC; and cyclin D1 promoter –233 to –103, TTTTCTCTGCCCGGCTTTG and GTCTGTAGCTCTCTGCTACTG.

Relative quantitative reverse transcription-PCR. Total RNA was extracted from cells using TRIzol reagent (Invitrogen). RNA concentration, purity, and integrity were determined by UV spectrophotometry. Total RNA (2 µg) was incubated with 30 ng random primer at 42°C for 30 minutes in a final volume of 20 µL reaction mixture containing 1x reaction buffer, 5 mmol/L deoxynucleotide triphosphate (dNTP), 10 mmol/L DTT, 0.5 unit/µL RNasin (Promega), and 200 units SuperScript RNase H-Moloney murine leukemia virus reverse transcriptase (Invitrogen); reaction mixtures were incubated at 95°C for 10 minutes. Reaction mixtures (1 µL) were amplified in 25 µL PCR reaction mixture containing 1x PCR reaction buffer, 1.5 mmol/L MgCl2, 100 µmol/L dNTP, 5 pmol primers, and 1 µL 18S rRNA primer set (Ambion, Austin, TX) as internal standards and 1 unit Taq DNA polymerase (Invitrogen) for 30 cycles at 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 30 seconds. Following PCR, 10 µL of the reaction were run in a 2% agarose gel, the PCR bands were imaged using Eagle Eye II (Stratagene), and data were analyzed using NIH image software. The sense and antisense primers used were GGAGAACACCGAAAACAATAAC and GGCCTGGAAGAGAATAGTTTG for mouse Six1, respectively, and TGCTTTGCTGAAAAGCCAC and CACAACAAAACAAACCACACAC for mouse cyclin D1, respectively.

Experimental metastasis assays. For tail vein injection assays, 106 cells were i.v. injected via the tail vein of 5- to 6-week-old male athymic nude mice. Tumor numbers were obtained by visual inspection of tissues in mice euthanized 21 days post-transplantation (19, 33).

Oligonucleotide microarray analysis. Frozen tumor samples were obtained from the Pediatric Cooperative Human Tissue Network tumor bank (Columbus, OH) and the Children's Hospital Los Angeles institutional tumor bank. Histopathologic diagnoses for rhabdomyosarcoma tumors were based on the International Classification of Rhabdomyosarcoma criteria (37). All data management and analysis were conducted using the Genetrix suite of tools for microarray analysis (Epicenter Software, Pasadena, CA). Probe set modeling and data preprocessing were derived using the ProbeProfiler algorithm (Corimbia, Berkeley, CA). The Affymetrix (Santa Clara, CA) U133A GeneChip tumor microrray data set, sample clinical covariates, and microarray protocols can be found on the National Cancer Institute Director's Challenge3 and University of Southern California/Children's Hospital Los Angeles Genome Core4 Web sites. ANOVA was also used for statistical analysis of differential gene expression between rhabdomyosarcoma subtypes and other soft-tissue sarcomas.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Six1 transcriptionally activates the gene encoding Ezrin. We reported previously that Six1 and Ezrin were both up-regulated in highly metastatic mouse rhabdomyosarcoma cell lines relative to those that were poorly metastatic. Furthermore, we found that Ezrin expression seemed to correlate with Six1 expression in human rhabdomyosarcoma and posited that they might be acting in the same pathway (19). To test this notion, the effect of altering Six1 expression levels on Ezrin expression was examined. Figure 1A shows that when a Six1 expression vector was introduced into the poorly metastatic cell line RMS772, which expresses low levels of both Six1 and Ezrin, Ezrin expression was enhanced. Conversely, when a Six1 shRNA expression vector was used to knockdown expression of Six1 expression in the highly metastatic cell line RMS14, which expresses relatively high levels of both Six1 and Ezrin, Ezrin expression was reduced (Fig. 1A).


Figure 1
View larger version (38K):
[in this window]
[in a new window]
 
Figure 1. Six1 binds to the Ezrin gene (vil2) promoter and regulates Ezrin expression. A, Ezrin protein expression was analyzed by Western blotting in the indicated stable rhabdomyosarcoma cell lines transfected with either a Six1 or a shRNA (shSix1) expression vector. Ectopic Six1 expression stimulated Ezrin expression in RMS772, whereas knockdown of endogenous Six1 through a RNAi mechanism inhibited Ezrin expression in RMS14. C, empty vector control. B, the physical interaction of Six1 to chromatin containing the Ezrin promoter was assessed by ChIP assay. Flag-tagged Six1 ectopically expressed in RMS772 cells (a) and native Six1 in RMS14 cells (b) were analyzed using anti-Flag M2 and anti-Six1 antibodies, respectively. Six1 bound to the –1,106 to –870 region of the Ezrin promoter, containing the MEF3-like motif TTCAGGA, but not to the irrelevant –230 to –121 region. Inp, input; M, markers. C, Ezrin promoter (–1,616 to –1) activity was shown to be responsive to increasing amounts of a Six1 expression vector (in µg) using a firefly luciferase (Luc) reporter. D, using the same luciferase assay, addition of shSix1 expression vector inhibited luciferase activity driven by the Ezrin promoter. E, a nonfunctional Six1 deletion mutant consisting of only the COOH-terminal end (Flag-Six1-CT) cannot stimulate Ezrin promoter-driven luciferase expression. F, a 237-bp fragment of the Ezrin promoter (–1,106 to –870) shown to bind Six1 by ChIP assay (B) was sufficient to induce full luciferase activation by ectopic Six1 expression; an irrelevant downstream 110-bp fragment (–230 to –121) was not. G, the ability of this 237-bp fragment to stimulate Ezrin promoter activity was greatly reduced when its MEF3-like motif TCAGG was deleted. H, EMSA showing that purified Six1 can bind to an oligonucleotide containing this MEF3-like motif. This binding is competed by a 50-fold excess of cold probe. Arrow, Six1-DNA complex; arrowhead, Six1 antibody supershifted band.

 
These data indicate that Six1 can regulate Ezrin expression and raise the possibility that this homeoprotein transcriptionally activates the gene encoding Ezrin (vil2). To determine if Six1 directly binds to the Ezrin promoter in chromatin, a ChIP assay was done. Three candidate Six1 binding sites consisting of MEF3-like motifs (38) were found within the 5'-flanking region (between –1,616 and –1 bp) of the Ezrin promoter. Figure 1B shows that Six1 can bind to the Ezrin promoter between –1,106 and –870, a region containing the MEF3-like motif TTCAGGA, but not to an irrelevant site near the start of transcription. Binding was readily detected using either native Six1 or a Flag-tagged Six1. To determine if Six1 can stimulate Ezrin transcription, an Ezrin promoter-luciferase reporter construct was employed. Figure 1C shows that Six1 can stimulate luciferase activity in RMS772 cells harboring an Ezrin promoter-luciferase expression vector in a dose-dependent fashion, an effect that can be reversed with a Six1 shRNA expression vector (Fig. 1D). Moreover, an inactive Six1 mutant failed to stimulate luciferase activity in these same RMS772 cells (Fig. 1E). The 237-bp fragment of the Ezrin promoter, identified by ChIP assay to bind Six1, was found to be sufficient to induce full luciferase activation by ectopic Six1 expression (Fig. 1F). However, deletion of the TCAGG binding site in this fragment blocked the ability of Six1 to activate the Ezrin promoter (Fig. 1G). Moreover, EMSA showed that Six1 binds to an oligonucleotide containing this Ezrin promoter MEF3-like motif sequence (Fig. 1H).

Six1 can regulate proliferation through induction of cyclin and Myc. We and others have shown that Six1 can stimulate cellular proliferation (14, 15, 19, 39), an observation that prompted an examination of the effects of Six1 on expression of regulators of the cell cycle in several cell types. Figure 2A shows that ectopic Six1 expression in Swiss3T3 fibroblasts up-regulated expression of two cyclins, cyclin D1 and cyclin A, but not cyclin B1 or cyclin E1. Six1 was also able to up-regulate cyclin D1 expression in rhabdomyosarcoma tumor cells, although the background expression level was higher than that observed in fibroblasts (Fig. 2B). We found that there was a significant correlation (P < 0.001) between the expression of Six1 and cyclin D1 in our original panel of rhabdomyosarcoma cell lines derived from the HGF/SF-transgenic, Ink4a/Arf-deficient mouse (refs. 19, 40; Fig. 3A). Two candidate Six1 binding sites were found within the cyclin D1 gene (ccnd1) 5'-flanking region. A ChIP assay was done to show that Six1 binds to the cyclin D1 promoter between –919 and –614, a region containing the two MEF3-like motifs (TCAGAT and TTCAGAT), either as native Six1 or as a Flag-tagged form (Fig. 3B). In contrast, an irrelevant sequence near the transcriptional start site did not bind Six1. Transcriptional activation of cyclin D1 by Six1 was shown using a cyclin D1 promoter-luciferase construct; activity was competed by expression of Six1 shRNA (Fig. 3C). Figure 3D shows that a nonfunctional Six1 mutant cannot induce luciferase activity in this assay. Furthermore, EMSA showed that Six1 binds to an oligonucleotide containing the cyclin D1 promoter MEF3-like motif TTCAGAT (Fig. 3E).


Figure 2
View larger version (50K):
[in this window]
[in a new window]
 
Figure 2. Six1 induces expression of specific cyclin genes and stimulates MAPK and AKT activity. Analyses of expression of various cyclins and the phosphorylation status of MAPK and AKT by Western blotting in two stable cell lines ectopically overexpressing Six1: Swiss3T3 fibroblasts (A) and RMS772 rhabdomyosarcoma cells (B). C, empty vector control.

 

Figure 3
View larger version (37K):
[in this window]
[in a new window]
 
Figure 3. Six1 binds to the cyclin D1 gene (ccnd1) promoter and regulates cyclin D1 expression. A, relative quantitative RT-PCR analyses of cyclin D1 and Six1 RNA transcripts in 35 mouse rhabdomyosarcoma cell line samples (19). B, the physical interaction of Six1 to the cyclin D1 promoter in chromatin was shown using a ChIP assay. Flag-tagged Six1 ectopically expressed in RMS772 cells (a) and native Six1 in RMS14 cells (b) were analyzed using anti-Flag M2 and anti-Six1 antibodies, respectively. Six1 can bind to the –919 to –614 region (containing 2 MEF3-like motifs) of the cyclin D1 promoter but not to the irrelevant –233 to –103 region. C, cyclin D1 promoter (–944 to –1) activity was shown to be responsive to increasing amounts of a Six1 expression vector using a luciferase gene reporter. Inhibition of cyclin D1 promoter-driven luciferase by expression of shSix1 was also observed in these cells. D, the Six1 COOH-terminal deletion mutant (Flag-Six1-CT) cannot stimulate cyclin D1 promoter-driven luciferase reporter expression. E, EMSA showing that purified Six1 can bind to an oligonucleotide containing the MEF3-like motif TTCAGAT. Binding is competed with a 50-fold excess of cold probe. Arrow, Six1-DNA complex; arrowhead, Six1 antibody supershifted band.

 
Because Six1 was found to regulate the cell cycle through genes encoding the cyclins, we examined the effect of Six1 on expression of another cell cycle regulator, c-Myc. Figure 4A shows that Six1 also induced c-Myc expression in RMS772 cells as well as other rhabdomyosarcoma cell lines (data not shown).


Figure 4
View larger version (55K):
[in this window]
[in a new window]
 
Figure 4. Assessment of the relationship between Six1 and Ezrin and their downstream targets. A, change in c-Myc expression as a consequence of ectopic Six1 expression was analyzed by Western blotting in RMS772 cells. C, empty vector control. B, analysis of the consequences of stable knockdown of Ezrin expression using a shRNA (shEzrin) in RMS772 rhabdomyosarcoma cells ectopically expressing Six1. Knocking down Ezrin reversed the stimulatory effects of Six1 on Ezrin expression and AKT activity but had little effect on expression of Six1, c-Myc, and cyclin D1 or on MAPK activity. –, transfection with an empty vector; +, transfection with the expression vector for either Six1 or shEzrin.

 
Six1 requires Ezrin to promote metastatic dissemination. Our data show that the homeoprotein transcription factor Six1 is able to activate a set of protumorigenic agents. We reported previously that Ezrin, as well as Six1, was a critical factor in rhabdomyosarcoma cell metastasis (19). To determine to what extent Six1-mediated metastasis was dependent on Ezrin, an Ezrin shRNA expression vector was introduced into RMS772 cells whose metastatic potential had already been enhanced through ectopic Six1 expression. Figure 5A shows that, as expected, Six1 significantly enhanced metastatic spread of RMS772 cells to the lung; however, this metastatic potential was found to be fully dependent on Ezrin function. It is worth noting that although Ezrin shRNA was highly effective at knocking down Ezrin expression, it did not appreciably affect expression of the other Six1 protumorigenic transcriptional targets, cyclin D1 and c-Myc (Fig. 4B).


Figure 5
View larger version (18K):
[in this window]
[in a new window]
 
Figure 5. Phenotypic effects of Six1 and Ezrin in rhabdomyosarcoma cells and assessment of their expression in a panel of pediatric solid tumors. A, knockdown of Ezrin reverses the prometastatic effects of Six1. RMS772 cells were stably transfected with empty vector (–), Six1 expression vector alone, or Six1 plus shEzrin expressing vectors. Tumor cells were i.v. injected via the tail vein into athymic nude mice, and numbers of metastatic lesions were obtained by visual inspection of lungs. *, P < 0.02 (Student's t test). B, ECM-associated adhesion of RMS772 cells was analyzed following stable transfection of Ezrin, Six1, and/or shEzrin expression vectors. *, P < 0.02 (Student's t test). C, expression of SIX1 and EZRIN in a panel of human primary pediatric tumors, including alveolar rhabdomyosarcoma samples containing a PAX-FKHR translocation (RMS+), rhabdomyosarcoma samples lacking a PAX-FKHR translocation (RMS–), synovial sarcomas (STS), Ewing's sarcomas and primitive neuroectodermal tumor (EW), neuroblastoma (NB), and osteosarcoma (OS). Data were obtained from an oligonucleotide microarray analysis. N, number of tissues analyzed for each tumor type.

 
What Six1-mediated cellular behaviors are dependent on Ezrin, and what downstream pathways govern them? Six1 was found to activate pathways that could potentially regulate both tumor cell growth (MAPK; Fig. 2B) and survival (Akt; Fig. 2B). However, ectopic Ezrin expression did not enhance proliferation of cultured RMS772 cells (data not shown). Furthermore, knocking down Ezrin through shRNA expression in Six1-transfected rhabdomyosarcoma cells did not block extracellular signal-regulated kinase 1/2 activation but inhibited Akt phosphorylation (Fig. 4B), consistent with the notion that Ezrin-mediated prosurvival pathways are important for successful metastatic spread in sarcoma (41). However, analysis of Akt activity in our original panel of highly and poorly metastatic rhabdomyosarcoma cells revealed no overt correlation with metastatic potential (19).

We did find that RMS772 cells ectopically expressing either Six1 or Ezrin showed a significant increase in ECM-associated adhesion relative to their parental counterparts, suggestive of a role in metastasis (Fig. 5B). Notably, addition of shEzrin to Six1-RMS772 cells blocked the enhanced adherence gained through ectopic Six1 expression (Fig. 5B). This result indicates that as with metastatic potential the effect of Six1 on adhesion is highly dependent on Ezrin.

Relationship between SIX1 and EZRIN in human pediatric solid tumors. Previously, we quantified SIX1 and EZRIN expression by reverse transcription-PCR (RT-PCR) in human rhabdomyosarcoma tissues and found that both genes exhibited significantly elevated expression in rhabdomyosarcoma, correlating with stage of progression (19). To determine if the discovered relationship between SIX1 and EZRIN was unique to the childhood cancer rhabdomyosarcoma, we screened an oligonucleotide microarray data set of pretreatment diagnostic biopsies of primary pediatric solid tumors. We found that whereas Ezrin was highly expressed in most tumors examined, SIX1 overexpression was characteristic of only rhabdomyosarcoma, expressed in both alveolar and embryonal subtypes (Fig. 5C). These data suggest that although SIX1 plays an important role in regulating expression of EZRIN in tumors thought to be derived from skeletal muscle progenitors in which SIX1 is known to play a key developmental role, EZRIN may be involved in other nonrhabdomyosarcoma malignancies, where its expression is apparently controlled by other factors.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The homeoprotein transcription factor Six1 was shown recently to strongly influence the metastatic potential of rhabdomyosarcoma cells (19). Here, we report that SIX1, found to be highly expressed in most advanced human rhabdomyosarcoma tumors, can stimulate the expression of a battery of protumorigenic genes, including those that regulate cytoskeletal organization, adhesion, survival, and cell cycle. Interestingly, the coordinated up-regulation in metastatic cells of such key gene products may well reprise the normal role of Six1 in embryonic development. Six1 is expressed in migrating myogenic progenitor cells and is required for the development of most migratory hypaxial muscles, including forelimb muscle, diaphragm, and tongue (8, 9). Six1, along with Six4, was recently reported to control myogenic cell delamination and migration from the somite (42). One could envision a scenario in which conversion to a metastatic state by opportunistic tumor cells would be facilitated by subverting multiple molecular pathways/cellular behaviors through inappropriate expression of a few master transcription factors, such as SIX1. Gene products that are controlled by SIX1 include cell cycle regulators, such as cyclin and Myc family members, as well as Ezrin.

Ezrin, whose expression also correlated with rhabdomyosarcoma progression in our original analysis (19), was found to be a direct transcriptional target of Six1. Significantly, Ezrin was a prime metastasis factor, as the effect of Six1 on other transcriptional targets was insufficient to induce metastasis in an environment deficient in functional Ezrin. The significance of Ezrin in metastasis could be explained through its association with myriad potential prometastasis pathways (2023). Interestingly, Ezrin is a direct target of the c-Met tyrosine kinase (25), a receptor frequently implicated in metastatic behavior (43, 44). Aberrant c-Met signaling drives rhabdomyosarcoma genesis in the HGF/SF-transgenic, Ink4a/Arf-deficient mouse model and is commonplace in human osteosarcoma (43), also reported to be dependent on Ezrin for high metastatic potency (29, 30). It is worth noting that c-Met signaling is also required for myogenic progenitor cell migration (45) and has been suggested as a Six1 transactivation target (42). However, several factors prompted us to consider in particular the role of cell adhesion–associated pathways in metastatic rhabdomyosarcoma cells.

Adhesion-dependent events, which can profoundly affect invasive and metastatic cellular behavior, are mediated through complex, carefully coordinated interactions between the integrin family of transmembrane adhesion receptors and the Rho family of GTPases (46, 47). For example, integrins serve as primary sensors of the ECM environment, and cell-ECM interactions can initiate signaling pathways to the cytoskeleton through Rho members RhoA, Rac1, and CDC42 (48). Previously, we reported significant differences in expression between several integrins (i.e., {alpha}3-integrin and ß4-integrin) during a cDNA microarray-based screen of highly metastatic and poorly metastatic rhabdomyosarcoma cells; we also found that RhoA was involved in Ezrin-mediated metastatic potential of rhabdomyosarcoma cells (19). Here, we show that Ezrin expression significantly influences the ability of rhabdomyosarcoma cells to adhere to ECM as has been reported in other cellular contexts (4951). More importantly, Ezrin function was required for Six1-enhanced adhesion, reminiscent of its mandatory role in Six1-enhanced experimental rhabdomyosarcoma metastasis.

The importance of Ezrin in cancer progression was supported by the fact that every type of human pediatric tumor examined expressed relatively high levels of Ezrin. In contrast, Six1 overexpression was generally restricted to skeletal muscle–derived sarcomas. These data suggest that the importance of the role of Six1 in regulating pro-oncogenic factors is greater in tumors derived from a lineage in which it is known to have a critical embryonic role. Other homeodomain transcription factors may operate under similar conditions.

Six1 is known to control transit through the cell cycle; in fact, Six1 expression stimulates proliferation of rhabdomyosarcoma cell lines (19). Six1 has been reported to be critical for G2-M checkpoint control and is also expressed throughout G1-S (14, 15), raising the possibility that Six1 could help regulate both checkpoints of the cell cycle. This notion is supported by data presented here showing that Six1 can up-regulate expression of both cyclin D1 and cyclin A and by the work of Ford et al. that Six1 regulates transcription of cyclin A1 in the mammary gland and in breast tumors (39). This is noteworthy because it indicates that cyclins regulating cyclin-dependent kinases operating at both the G1 checkpoint and at the transition from S to M can be stimulated through the activity of a single transcriptional regulator. However, the regulation of cyclin D1, overexpressed in numerous cancers (52), is complex. Cyclin D1 is up-regulated by growth factor stimulation through the MAPK pathway (53), and this pathway is still required for cyclin D1 expression in rhabdomyosarcoma cells even in the presence of excess Six1 (data not shown). Expression of c-Myc, another critical regulator of cell cycle checkpoint function deregulated in many human tumors, was also enhanced in rhabdomyosarcoma cells through Six1 expression. This result is in agreement with Li et al. who showed that expression of c-Myc is stimulated in C2C12 mouse myoblasts ectopically expressing a VP16-Six1 fusion protein and that Six1 binds directly to the c-Myc promoter (9).

The data presented here support the notion that transcription factors that function as key regulators of organogenesis can be exploited by tumor cells derived from such organs to promote their metastatic program. Six1 is expressed in migrating somitic mesenchymal progenitor cells and is required for embryonic skeletal muscle development. In rhabdomyosarcoma cells, Six1 can up-regulate several influential proto-oncogenes to promote proliferation, survival, and metastatic spread. Despite this broad sphere of influence, successful metastasis in rhabdomyosarcoma cells is fully dependent on the Six1 transcriptional target Ezrin, which regulates cytoskeletal organization and adhesion. Our data indicate that Ezrin should be considered as a molecular target for treatment of patients with advanced rhabdomyosarcoma.


    Acknowledgments
 
Grant support: Intramural Research Program of the NIH, National Cancer Institute, Center for Cancer Research.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Dr. Pascal Maire for the mouse Six1 expression vector, Dr. Alan Howe for advice on adhesion protocols, and Drs. Lalage Wakefield and Chand Khanna for useful discussions and for critical review of this article.


    Footnotes
 
3 http://dc.nci.nih.gov/index.html. Back

4 http://genomecore-chla.usc.edu/GenomeCore/GenomeCore.html. Back

Received 7/ 6/05. Revised 11/22/05. Accepted 12/16/05.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Chambers AF, Groom AC, MacDonald IC. Dissemination and growth of cancer cells in metastatic sites. Nat Rev Cancer 2002;2:563–72.[CrossRef][Medline]
  2. Fidler IJ. Critical determinants of metastasis. Semin Cancer Biol 2002;12:89–96.[CrossRef][Medline]
  3. Bogenrieder T, Herlyn M. Axis of evil: molecular mechanisms of cancer metastasis. Oncogene 2003;22:6524–36.[CrossRef][Medline]
  4. Birchmeier C, Brohmann H. Genes that control the development of migrating muscle precursor cells. Curr Opin Cell Biol 2000;12:725–30.[CrossRef][Medline]
  5. Buckingham M. Skeletal muscle formation in vertebrates. Curr Opin Genet Dev 2001;11:440–8.[CrossRef][Medline]
  6. Kawakami K, Sato S, Ozaki H, Ikeda K. Six family genes—structure and function as transcription factors and their roles in development. Bioessays 2000;22:616–26.[CrossRef][Medline]
  7. Serikaku MA, O'Tousa JE. Sine oculis is a homeobox gene required for Drosophila visual system development. Genetics 1994;138:1137–50.[Abstract]
  8. Laclef C, Hamard G, Demignon J, Souil E, Houbron C, Maire P. Altered myogenesis in Six1-deficient mice. Development 2003;130:2239–52.[Abstract/Free Full Text]
  9. Li X, Oghi KA, Zhang J, et al. Eya protein phosphatase activity regulates Six1-Dach-Eya transcriptional effects in mammalian organogenesis. Nature 2003;426:247–54.[CrossRef][Medline]
  10. Zheng W, Huang L, Wei ZB, Silvius D, Tang B, Xu PX. The role of Six1 in mammalian auditory system development. Development 2003;130:3989–4000.[Abstract/Free Full Text]
  11. Xu PX, Zheng W, Huang L, Maire P, Laclef C, Silvius D. Six1 is required for the early organogenesis of mammalian kidney. Development 2003;130:3085–94.[Abstract/Free Full Text]
  12. Ozaki H, Nakamura K, Funahashi J, et al. Six1 controls patterning of the mouse otic vesicle. Development 2004;131:551–62.[Abstract/Free Full Text]
  13. Ruf RG, Xu PX, Silvius D, et al. SIX1 mutations cause branchio-oto-renal syndrome by disruption of EYA1-1-DNA complexes. Proc Natl Acad Sci U S A 2004;101:8090–5.[Abstract/Free Full Text]
  14. Ford HL, Kabingu EN, Bump EA, Mutter GL, Pardee AB. Abrogation of the G2 cell cycle checkpoint associated with overexpression of HSIX1: a possible mechanism of breast carcinogenesis. Proc Natl Acad Sci U S A 1998;95:12608–13.[Abstract/Free Full Text]
  15. Ford HL, Landesman-Bollag E, Dacwag CS, Stukenberg PT, Pardee AB, Seldin DC. Cell cycle-regulated phosphorylation of the human SIX1 homeodomain protein. J Biol Chem 2000;275:22245–54.[Abstract/Free Full Text]
  16. Khan J, Bittner ML, Saal LH, et al. cDNA microarrays detect activation of a myogenic transcription program by the PAX3-FKHR fusion oncogene. Proc Natl Acad Sci U S A 1999;96:13264–9.[Abstract/Free Full Text]
  17. Li CM, Guo M, Borczuk A, et al. Gene expression in Wilms' tumor mimics the earliest committed stage in the metanephric mesenchymal-epithelial transition. Am J Pathol 2002;160:2181–90.[Abstract/Free Full Text]
  18. Reichenberger KJ, Coletta RD, Schulte AP, Varella-Garcia M, Ford HL. Gene amplification is a mechanism of Six1 overexpression in breast cancer. Cancer Res 2005;65:2668–75.[Abstract/Free Full Text]
  19. Yu Y, Khan J, Khanna C, Helman L, Meltzer PS, Merlino G. Expression profiling identifies the cytoskeletal organizer ezrin and the developmental homeoprotein Six-1 as key metastatic regulators. Nat Med 2004;10:175–81.[CrossRef][Medline]
  20. Louvet-Vallee S. ERM proteins: from cellular architecture to cell signaling. Biol Cell 2000;92:305–16.[CrossRef][Medline]
  21. Bretscher A, Edwards K, Fehon RG. ERM proteins and merlin: integrators at the cell cortex. Nat Rev Mol Cell Biol 2002;3:586–99.[CrossRef][Medline]
  22. Shiue H, Musch MW, Wang Y, Chang EB, Turner JR. Akt2 phosphorylates ezrin to trigger NHE3 translocation and activation. J Biol Chem 2005;280:1688–95.[Abstract/Free Full Text]
  23. Srivastava J, Elliott BE, Louvard D, Arpin M. Src-dependent ezrin phosphorylation in adhesion-mediated signaling. Mol Biol Cell 2005;16:1481–90.[Abstract/Free Full Text]
  24. Krieg J, Hunter T. Identification of the two major epidermal growth factor-induced tyrosine phosphorylation sites in the microvillar core protein ezrin. J Biol Chem 1992;267:19258–65.[Abstract/Free Full Text]
  25. Crepaldi T, Gautreau A, Comoglio PM, Louvard D, Arpin M. Ezrin is an effector of hepatocyte growth factor-mediated migration and morphogenesis in epithelial cells. J Cell Biol 1997;138:423–34.[Abstract/Free Full Text]
  26. Martin TA, Harrison G, Mansel RE, Jiang WG. The role of the CD44/ezrin complex in cancer metastasis. Crit Rev Oncol Hematol 2003;46:165–86.[Medline]
  27. Akisawa N, Nishimori I, Iwamura T, Onishi S, Hollingsworth MA. High levels of ezrin expressed by human pancreatic adenocarcinoma cell lines with high metastatic potential. Biochem Biophys Res Commun 1999;258:395–400.[CrossRef][Medline]
  28. Nestl A, Von Stein OD, Zatloukal K, et al. Gene expression patterns associated with the metastatic phenotype in rodent and human tumors. Cancer Res 2001;61:1569–77.[Abstract/Free Full Text]
  29. Khanna C, Khan J, Nguyen P, et al. Metastasis-associated differences in gene expression in a murine model of osteosarcoma. Cancer Res 2001;61:3750–9.[Abstract/Free Full Text]
  30. Khanna C, Wan X, Bose S, et al. The membrane-cytoskeleton linker ezrin is necessary for osteosarcoma metastasis. Nat Med 2004;10:182–6.[CrossRef][Medline]
  31. Luciani F, Molinari A, Lozupone F, et al. P-glycoprotein-actin association through ERM family proteins: a role in P-glycoprotein function in human cells of lymphoid origin. Blood 2002;99:641–8.[Abstract/Free Full Text]
  32. Gajate C, Mollinedo F. Cytoskeleton-mediated death receptor and ligand concentration in lipid rafts forms apoptosis-promoting clusters in cancer chemotherapy. J Biol Chem 2005;280:11641–7.[Abstract/Free Full Text]
  33. Yu Y, Merlino G. Constitutive c-Met signaling through a nonautocrine mechanism promotes metastasis in a transgenic transplantation model. Cancer Res 2002;62:2951–6.[Abstract/Free Full Text]
  34. Beviglia L, Kramer RH. HGF induces FAK activation and integrin-mediated adhesion in MTLn3 breast carcinoma cells. Int J Cancer 1999;83:640–9.[CrossRef][Medline]
  35. Trikha M, Zhou Z, Timar J, et al. Multiple roles for platelet GPIIb/IIIa and {alpha}vß3 integrins in tumor growth, angiogenesis, and metastasis. Cancer Res 2002;62:2824–33.[Abstract/Free Full Text]
  36. Zhu X, McPhie P, Lin K, Cheng S. The differential hormone-dependent transcriptional activation of thyroid hormone receptor isoforms is mediated by interplay of their domains. J Biol Chem 1997;272:9048–54.[Abstract/Free Full Text]
  37. Newton WA, Gehan EA, Webber BL, et al. Classification of rhabdomyosarcomas and related sarcomas. Pathologic aspects and proposal for a new classification—an Intergroup Rhabdomyosarcoma Study. Cancer 1999;76:1073–85.
  38. Spitz F, Demignon J, Porteu A, et al. Expression of myogenin during embryogenesis is controlled by Six/sine oculis homeoproteins through a conserved MEF3 binding site. Proc Natl Acad Sci U S A 1998;95:14220–5.[Abstract/Free Full Text]
  39. Coletta RD, Christensen K, Reichenberger KJ, et al. The Six1 homeoprotein stimulates tumorigenesis by reactivation of cyclin A1. Proc Natl Acad Sci U S A 2004;101:6478–83.[Abstract/Free Full Text]
  40. Sharp R, Recio JA, Jhappan C, et al. Synergism between INK4a/ARF inactivation and aberrant HGF/SF signaling in rhabdomyosarcomagenesis. Nat Med 2002;8:1276–80.[CrossRef][Medline]
  41. Wan X, Mendoza A, Khanna C, Helman LJ. Rapamycin inhibits ezrin-mediated metastatic behavior in a murine model of osteosarcoma. Cancer Res 2005;65:2406–11.[Abstract/Free Full Text]
  42. Grifone R, Demignon J, Houbron C, et al. Six1 and Six4 homeoproteins are required for Pax3 and Mrf expression during myogenesis in the mouse embryo. Development 2005;132:2235–49.[Abstract/Free Full Text]
  43. Birchmeier C, Birchmeier W, Gherardi E, Vande Woude GF. Met, metastasis, motility and more. Nat Rev Mol Cell Biol 2003;4:915–25.[CrossRef][Medline]
  44. Gentile A, Comoglio PM. Invasive growth: a genetic program. Int J Dev Biol 2004;48:451–6.[CrossRef][Medline]
  45. Bladt F, Riethmacher D, Isenmann S, Aguzzi A, Birchmeier C. Essential role for the c-met receptor in the migration of myogenic precursor cells into the limb bud. Nature 1995;376:768–71.[CrossRef][Medline]
  46. Schmitz AA, Govek EE, Bottner B, Van Aelst L. Rho GTPases: signaling, migration, and invasion. Exp Cell Res 2000;261:1–12.[CrossRef][Medline]
  47. Sahai E, Marshall CJ. RHO-GTPases and cancer. Nat Rev Cancer 2002;2:133–42.[CrossRef][Medline]
  48. Lee JW, Juliano R. Mitogenic signal transduction by integrin- and growth factor receptor-mediated pathways. Mol Cells 2004;17:188–202.[Medline]
  49. Takeuchi K, Sato N, Kasahara H, et al. Perturbation of cell adhesion and microvilli formation by antisense oligonucleotides to ERM family members. J Cell Biol 1994;125:1371–84.[Abstract/Free Full Text]
  50. Martin M, Andreoli C, Sahuquet A, Montcourrier P, Algrain M, Mangeat P. Ezrin NH2-terminal domain inhibits the cell extension activity of the COOH-terminal domain. J Cell Biol 1995;128:1081–93.[Abstract/Free Full Text]
  51. Hiscox S, Jiang WG. Ezrin regulates cell-cell and cell-matrix adhesion, a possible role with E-cadherin/ß-catenin. J Cell Sci 1999;112:3081–90.[Abstract]
  52. Fu M, Wang C, Li Z, Sakamaki T, Pestell RG. Cyclin D1: normal and abnormal functions. Endocrinology 2004;145:5439–47.[Abstract/Free Full Text]
  53. Lavoie JN, L'Allemain G, Brunet A, Muller R, Pouyssegur J. Cyclin D1 expression is regulated positively by the p42/p44MAPK and negatively by the p38/HOGMAPK pathway. J Biol Chem 1996;271:20608–16.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
S.-Y. Gao, E.-M. Li, L. Cui, X.-F. Lu, L.-Y. Meng, H.-M. Yuan, J.-J. Xie, Z.-P. Du, J.-X. Pang, and L.-Y. Xu
Sp1 and AP-1 Regulate Expression of the Human Gene VIL2 in Esophageal Carcinoma Cells
J. Biol. Chem., March 20, 2009; 284(12): 7995 - 8004.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
R. D. Coletta, K. L. Christensen, D. S. Micalizzi, P. Jedlicka, M. Varella-Garcia, and H. L. Ford
Six1 Overexpression in Mammary Cells Induces Genomic Instability and Is Sufficient for Malignant Transformation
Cancer Res., April 1, 2008; 68(7): 2204 - 2213.
[Abstract] [Full Text] [PDF]


Home page
Integr. Comp. Biol.Home page
G. Schlosser
How old genes make a new head: redeployment of Six and Eya genes during the evolution of vertebrate cranial placodes
Integr. Comp. Biol., September 1, 2007; 47(3): 343 - 359.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. Behbakht, L. Qamar, C. S. Aldridge, R. D. Coletta, S. A. Davidson, A. Thorburn, and H. L. Ford
Six1 Overexpression in Ovarian Carcinoma Causes Resistance to TRAIL-Mediated Apoptosis and Is Associated with Poor Survival
Cancer Res., April 1, 2007; 67(7): 3036 - 3042.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
K. Wu, A. Li, M. Rao, M. Liu, V. Dailey, Y. Yang, D. Di Vizio, C. Wang, M. P. Lisanti, G. Sauter, et al.
DACH1 Is a Cell Fate Determination Factor That Inhibits Cyclin D1 and Breast Tumor Growth.
Mol. Cell. Biol., October 1, 2006; 26(19): 7116 - 7129.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yu, Y.
Right arrow Articles by Merlino, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yu, Y.
Right arrow Articles by Merlino, G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online