
[Cancer Research 66, 2059-2066, February 15, 2006]
© 2006 American Association for Cancer Research
Cell, Tumor, and Stem Cell Biology |
Use of a Chemically Modified Antisense Oligonucleotide Library to Identify and Validate Eg5 (Kinesin-Like 1) as a Target for Antineoplastic Drug Development
Erich Koller1,
Stephanie Propp1,
Hong Zhang1,
Chenguang Zhao1,
Xiaokun Xiao1,
MingYi Chang1,
Scott A. Hirsch1,
Peter J. Shepard1,
Seongjoon Koo1,
Cain Murphy1,
Robert I. Glazer2 and
Nicholas M. Dean1
1 Department of Functional Genomics, Isis Pharmaceuticals, Carlsbad, California and 2 Department of Oncology and Lombardi Comprehensive Cancer Center, Georgetown University, Washington, District of Columbia
Requests for reprints: Erich Koller, Department of Functional Genomics, Isis Pharmaceuticals, 1896 Rutherford Road, Carlsbad, CA 92008. Phone: 760-603-2618; Fax: 760-268-4989; E-mail: ekoller{at}isisph.com or Nicholas M. Dean, Phone: 760-603-2364; E-mail: ndean{at}isisph.com.
 |
Abstract
|
|---|
A library of 2'-methoxyethyl-modified antisense oligonucleotides (2'MOE ASO) targeting 1,510 different genes has been developed, validated, and used to identify cell cycle regulatory genes. The most effective molecular target identified was Eg5 (kinesin-like-1), which when inhibited gave the largest increase in 4N DNA in various tumor cells. The Eg5 ASO reduced Eg5 levels, inhibited proliferation, increased apoptosis, and altered the expression of other cell cycle proteins, including survivin and Aurora-A. To examine the therapeutic utility of the Eg5 ASO, the compound was also evaluated in xenograft models. Treatment with Eg5 ASO produced a statistically significant reduction of tumor growth, reduction in Eg5 expression in the tumors, and changes in histone phosphorylation, consistent with a loss of Eg5 protein expression. These data show, for the first time, the utility of a 2'MOE ASO library for high-throughput cell culturebased functional assays and suggest that an Eg5 ASO also has potential in a therapeutic strategy. (Cancer Res 2006; (66)4: 2059-66)
 |
Introduction
|
|---|
Strategies developed to inhibit cell cycle progression, and hence proliferation, have led to the successful implementation of numerous therapeutics for various cancers. For example, the microtubule-targeting tubulin-polymerizing agents, paclitaxel and taxotere, are widely used to treat human epithelial cancers (1). This class of compounds typically arrests cancer cells in G2-M phase followed by induction of apoptosis. Many cellular proteins that regulate G2-M progression represent potential targets against which to develop novel antimitotic drugs (2, 3). It is hoped that these more targeted therapeutic approaches might have fewer dose-limiting toxicities than traditional chemotherapeutic mitotic inhibitors. A recent example of a molecular-targeted therapy directed against a cell cycle regulating protein is the development of a small-molecule inhibitor of Aurora kinases which displayed antitumor activity against a variety of tumor models (4). Although this and other targeted approaches are encouraging, identifying the most effective gene targets that will result in mitotic arrest is still a major challenge to the successful development of novel drugs targeting mitosis.
Recently, multiple, high-throughput screening approaches to identify gene functions have been developed. An small interfering RNA (siRNA) library was used to identify Drosophila kinases that regulate cell cycle (5) and 80 of 228 protein kinases were shown to regulate cell division. In mammalian systems, siRNA libraries have been used to characterize the role of kinases and phosphatases for cell survival (6), the family of deubiquitinating enzymes (7), to identify modulators of the tumor necrosis factorrelated apoptosis-inducing ligandinduced apoptosis (8), and to discover new genes involved in the nuclear factor
B signaling pathway (9). An endoribonuclease-prepared siRNA library representing inhibitors to 5,305 genes was used to identify genes required for cell division in HeLa cells, and a total of 37 genes (
0.7%) were identified (10). Although these current siRNA-based libraries can be very effective and valuable in cell culture, current siRNA antisense approaches seem to have limited use in vivo, probably due to the rapid degradation of unmodified RNA by nucleases in serum and tissues. The alternative strategy we have developed and described here is to combine high-throughput gene function studies in cell culture using a library of 2'-methoxyethyl-modified antisense oligonucleotide (2'MOE ASO) molecules with subsequent in vivo studies in animals. This chemical class of ASO was selected because previous studies have shown that these molecules are highly potent and selective in vitro, as well as effective at inhibiting target gene expression when given to animals (1116). The library currently includes validated ASO inhibitors to 1,510 genes of various functional classes. These Gene Ontology annotated classes include transporters, signal transducers, enzymes and ligands, as well as genes with unknown functions.
In the studies described here, the library of ASO inhibitors has proved highly effective at identifying multiple genes that regulate cell cycle progression through G2-M phase of the cell cycle. Many of these have previously been described in the literature and include cdc27, cyclin-dependent kinase 1 (CDK1), and Aurora kinases, as well as some more novel targets. One of the most effective ASOs identified targeted Eg5, a member of the Kinesin-5 family (previously referred to as BimC; ref. 17). Eg5 is required for bipolar spindle formation (18). Small-molecule inhibitors to Eg5 and microinjection of antibodies against human Eg5 block centrosome separation, arrest cells in mitosis, and lead to monoastral microtubule arrays (1926). Our Eg5 ASO inhibitor was broadly active against a variety of tumor cells in culture and treatment of cells reduced Eg5 protein levels, inhibited cell proliferation, and increased apoptosis. In addition, the compound reduced growth of U87-MG and MDA-MB-231 tumor xenografts. These results show for the first time the utility of an ASO library to identify gene functions in cell-based assays, confirm activity of this class of compounds in animal models, and suggest that compounds developed for these libraries may have value as therapeutics in their own right.
 |
Materials and Methods
|
|---|
Cells and reagents. Tissue culture medium, trypsin, and Lipofectin were purchased from Invitrogen (Gaithersburg, MD). Human MCF7, T47D, MDA-MB-231, A549, T-24, DU145, PC3, MiaPaca, Panc-1, HeLa, SKOV-3, U87-MG, Hep3B, 769-P, and B16-F10 cells were obtained from the American Type Tissue Collection (Manassas, VA) and cultured in DMEM supplemented with 10% FCS, streptomycin (0.1 µg/mL), and penicillin (100 units/mL). Human mammary epithelial cells (HMEC) were purchased from Cambrex (Baltimore, MD). Human umbilical vascular endothelial cells (HUVEC) were purchased from Cascade Biologics (Portland, OR). ASO treatment was done using Opti-MEM (Invitrogen) containing 3 µg/mL Lipofectin and the indicated amount of ASOs for 4 hours at 37°C as previously described (27, 28). Z-VAD was purchased from Enzyme Systems Products (Aurora, OH).
Antisense oligonucleotide synthesis and library generation. MOE antisense phosphorothioate oligonucleotides were synthesized on an automated DNA synthesizer (Applied Biosystems Model 380B) as previously described (29). All ASOs used were 20-mers and contained 2'-MOE modifications at the five terminal residues at both the 5' and 3' ends of the molecule with 10 contiguous oligodeoxy residues in the center. Oligonucleotides were analyzed by capillary gel electrophoresis and judged to be at least 85% full-length material. Initially, to generate the library, a total of either 37 or 78 oligonucleotides were designed and synthesized for each of the 1,510 gene targets, and evaluated in cell culture to identify the most active at reducing its respective gene target mRNA expression as previously described in T24 cells grown in 96-well plates (30). If the mRNA of interest was not expressed in T24 cells threshold cycle (CT value >30), then another cell type (A549, MCF7, HepG2, T47D, HUVEC, HMEC, preadipocytes, adipocytes, and dendritic cells) with high expression levels was chosen to screen the ASOs. Cells were transfected in the presence of Lipofectin (Invitrogen) at a concentration of 3 µg/mL Opti-MEM (Invitrogen) for 100 nmol/L oligonucleotides. The cells were washed with PBS and then treated with the transfection mixture. After 4 hours, the mixture was replaced with normal growth medium and harvested at the indicated time points. Total RNA was isolated using RNAeasy (Qiagen, Santa Clarita, CA). Two scrambled control ASOs were included in each experiment to control for nonspecific effects on target expression. mRNA levels were measured with quantitative real-time reverse transcription-PCR (RT-PCR) using target-specific primer/probe sets (27, 31). Ribogreen was used to normalize for equal amounts of RNA. ASOs against a total of 1,510 genes were evaluated and for each target; the most active ASO identified was resynthesized for further phenotypic studies.
The sequences of two active Eg5 ASOs, ISIS 183881 and ISIS 183891, are ATCCAAGTGCTACTGTAGTA and CCGAGCTCTCTTATCAACAG, respectively. ISIS 339395 with the sequence CCAGGCCTTCTATTCACAAG is an 8-mismatch control for ISIS 183891. The sequence for the mouse specific Eg5 ASO, ISIS 285747, is AGACTTTCAGTTCAACTACA.
TaqMan RT-PCR. The sequence for the human Eg5 primer/probe set used in the RT-PCR reaction is GTGGTGAGATGCAGACCATTTAAT for the forward primer, CTTTTCGTACAGGATCACATTCTACTATTG for the reverse primer, and TGGCAGAGCGGAAAGCTAGCGC for the probe.
Cell cycle analysis. Cells were grown on collagen-coated 24-well plates and were treated with the ASOs (four replicates per group). Cells were harvested 48 and 72 hours after ASO treatment, fixed with 80% ethanol, and stained with propidium iodide (Sigma, St. Louis, MO) containing RNase cocktail (Ambion, Austin, TX). The propidium iodidestained cells were analyzed on a FACScan (BD Biosciences, San Jose, CA). Cell cycle profile was calculated with ModFit LT (Verity Software House, Topsham, ME).
Western blotting. ASO-treated cells were lysed in radioimmunoprecipitation assay lysis buffer containing 1% Triton X-100, 0.1% SDS, 0.25% sodium deoxycholate, 150 mmol/L NaCl, Tris (pH 7.5), and complete protease inhibitor mix with EDTA (Roche, Indianapolis, IN). Equal amounts of protein were resolved on a SDS-PAGE gel and transferred to polyvinylidene difluoride membranes. The membranes were blocked for 1 hour in PBS containing 0.1% Tween 20 and 5% nonfat milk powder. Proteins were detected using mouse anti-human Eg5 (BD Transduction Laboratories), rabbit anti-histone H3, rabbit antiphospho-histone H3, rabbit antiAurora-A (Cell Signaling Technology, Beverly, MA), rabbit anti-survivin (R&D, Minneapolis, MN), and rabbit antiAurora-B (Abcam, Cambridge, MA). Caspase-7, caspase-9, and poly(ADP-ribose) polymerase (PARP) antibodies to study apoptosis were used from the Apoptosis sampler kit (Cell Signaling). After incubation with peroxidase-coupled secondary antibodies, blots were developed using enhanced chemiluminescence plus reagent (Perkin Elmer, Boston, MA) and exposed to X-ray films (Kodak, Rochester, NY).
Immunostaining for phospho-histone H3. Formalin-fixed, paraffin-embedded tissue sections of 4-µm thickness were cut from the blocks, deparaffinized through xylenes and alcohols, blocked in 4% donkey serum in PBS for 60 minutes, and treated with a 1:50 dilution of rabbit antiphospho-histone H3 antibody (Cell Signaling Technology) for 15 hours at 4°C. They were then stained with 3,3'-diaminobenzidine solution for 5 minutes and counterstained with hematoxylin.
Cell proliferation. U87-MG and MDA-MB-231 cells were treated as described above. Seventy-two hours after transfection, cell proliferation was measured with CellTiter 96 AQueous Cell Proliferation Assay (Promega, Madison, WI) according to the procedure of the manufacturer.
Xenograft and normal mice studies. U87-MG (5 x 106) or MDA-MB-231 (2 x 106) cells were suspended in a volume of 0.1 mL DMEM and inoculated s.c. into the left flank of athymic (nude) mice (Charles River, Wilmington, MA). One day after inoculation, animals were injected i.p. thrice a week with either saline, the human Eg5 ASO (ISIS 183891), or a control ASO sequence at a dose of 50 mg/kg in a volume of 0.1 mL saline. No visible toxicity was apparent in the animals. Tumor volume was determined by caliper measurement (LxHxHx0.52) every 4 days until control tumors reached
5% of body weight. At this point, animals were sacrificed and tumor tissues were removed. Samples were frozen in RNAlater (Ambion). The tumor tissue was homogenized in RLT buffer (Qiagen, Valencia, CA) and RNA was isolated following the instructions of the manufacturer.
 |
Results
|
|---|
Antisense library. We identified ASO inhibitors against a total of 1,510 genes. A minimum of 70% target mRNA reduction for each lead ASO was selected as an acceptance criterion to move an ASO into the library, and ASOs that were within the amplicon of the primer/probe set were not used for the library. An example of a screening experiment evaluating 78 ASOs targeting kinesin-like 1 (Eg5) in T-24 cells is shown in Supplementary Fig. S1A. The mRNA reduction for a series of lead ASOs against additional gene targets compared with the negative control is shown in Supplementary Fig. S1B. The gene targets shown represent those subsequently found to regulate mitosis (compare with Fig. 1B). The validated full library of ASO inhibitors was next evaluated for effects on cell cycle of two breast cancer cell lines (MCF7 and T47D). Cell cycle analysis was done 72 hours after ASO treatment. Although we anticipated that this time should lead to a significant reduction in expression of most proteins, this approach does have the potential to lead to some false negatives, as proteins with long half-lives (>48 hours) may not be significantly reduced. The assay was found to be robust, with only
3.5% of the ASO inhibitors leading to either an arrest in G1, S, or G2-M phase (4N DNA) or an increase in hypodiploid fluorescence representing apoptotic cells. Specifically, 0.2% of the inhibitors caused a G1-phase arrest, 0.5% an S-phase arrest, and 1.8% a G2-M-phase (4N DNA) arrest. We focused on identifying genes that regulate G2-M progression. Results from the full library screening are shown in Fig. 1A. The 4N cell population contains cells in G2 + M phase and binucleated cells resulting from a failure in cytokinesis. Some examples of genes that, when inhibited, were shown to increase cells with 4N DNA content (Fig. 1B) included BTAK (Aurora-A), CDK1, cdc27, and polo-like kinase (3237). Other less well-characterized genes include APC1, sprouty homologue 4, apelin, and inhibitor
B receptor (Fig. 1B). The ASO inhibitor of Eg5 (ISIS 183891) was found to be the most effective in accumulating cells with 4N DNA content in both MCF7 and T47D cells (Fig. 1A). ASO inhibitors to additional kinesin family members were evaluated. Of these, the oligonucleotides targeting kinesin-like 5 (KIF23) and rab6 led to a significant accumulation in cells with 4N DNA content (Fig. 1B). Next, the breadth of activity of the Eg5 ASO was determined and the ASO (ISIS 183891) induced a significant increase in cells with 4N DNA content in all cell lines examined, as well as in HUVEC and HMEC primary cells (Fig. 1C).
Characterization of Eg5 ASO-mediated gene inhibition. To further characterize the effect of ASO-mediated Eg5 inhibition, a second Eg5 ASO (ISIS 183881) was identified and compared with ISIS 183891. HeLa, U87-MG, and MDA-MB-231 cells were treated with increasing concentrations of the two Eg5 ASOs. Both ASOs reduced expression of Eg5 mRNA (Fig. 2A), with ISIS 183891 being slightly more potent than ISIS 183881. A control ASO had no effect on Eg5 mRNA levels (Fig. 2A). To examine if Eg5 target reduction correlated with an increase of cells with 4N DNA content, HeLa, MDA-MB-231, and U87-MG cells were treated with both Eg5 ASOs and the cell cycle profiles were determined by flow cytometry. Treatment of cells with both ASOs led to a concentration-dependent increase in cells with 4N DNA (Fig. 2B). ISIS 183891 also produced a concentration-dependent reduction in Eg5 protein (Fig. 2C). In addition to an increase in 4N DNA content, we also observed an increase in cells in the "hypodiploid" region that reflects reduced fluorescence due to chromatin condensation in apoptotic cells (Fig. 2D).

View larger version (19K):
[in this window]
[in a new window]
|
Figure 2. Effect of multiple Eg5 ASOs on Eg5 mRNA, protein expression, and 4N DNA content. Cells indicated were transfected with increasing concentrations of Eg5 targeting ASOs ( , ISIS 183891; , ISIS 183881) or control ASO ( , ISIS 335395) and, 48 hours later, Eg5 mRNA expression (A) and 4N DNA content (B) were determined. Points, mean of three (A) and four replicates (B), respectively; bars, SD. C, HeLa cells were transfected with increasing concentrations of ASOs and Eg5 protein expression determined by Western blotting. Lane 1, untreated control; lanes 2 to 5, control ASO 335395 treated (12.5, 25, 50, and 100 nmol/L); lanes 6 to 10, Eg5 ASO 183891 treated (6.25, 12.5, 25, 50, and 100 nmol/L). D, HeLa cell cycle profiles of cells treated with Eg5 ASO (ISIS 183891) for 48 hours.
|
|
Characterization of Eg5 ASO-mediated increase in cells with 4N DNA content. Microtubule morphology and DNA segregation were examined by double-staining microtubules and DNA in Eg5 ASO-treated cells. Untreated control cells had a typical bipolar spindle and normal chromosome separation (Supplementary Fig. S2A). In contrast, Eg5 ASO-treated cells developed monopolar spindles and rosette-like microtubule arrays surrounded by chromosomes. Treatment of asynchronously growing T47D cells with the Eg5 ASO also produced a rounded morphology (Supplementary Fig. S2B).
Expression of Eg5 protein was strongly inhibited 24, 48, 72, and 96 hours after treatment with ISIS 183891 (Fig. 3A). To further characterize the increase in cells with 4N DNA content, the expression of a number of cell cycleregulated proteins was determined. At 24 and 48 hours after ASO treatment, levels of survivin, a protein known to be increased during G2-M, was increased in response to inhibiting Eg5 (Fig. 3A). Nocodazole produced a similar but more dramatic effect. Phosphorylation of histone H3 at Ser10 by the Aurora kinases is known to begin before prophase and is necessary for cells to initiate chromatin condensation to enter mitosis (3841). Therefore, we examined the status of histone H3 phosphorylation using a phospho-histone H3specific antibody (Fig. 3B). Treatment of HeLa cells with the Eg5 ASO for 48 hours led to a concentration-dependent increase in histone H3 phosphorylation whereas overall levels of histone H3 protein remained unchanged. Aurora A and B phosphorylation was next evaluated indirectly by monitoring the appearance of a more slowly migrating band on Western blotting using either an Aurora A or Bspecific antibody. Apparent Aurora-A phosphorylation increased in response to Eg5 inhibition; in contrast, the level of phosphorylated Aurora-B protein did not change (Fig. 3B). Taken together, these data show that the increase in cells with 4N DNA content represents a blockage of cells in mitosis.

View larger version (58K):
[in this window]
[in a new window]
|
Figure 3. Effect of Eg5 inhibition in HeLa cells on cell cycleregulated proteins. A, HeLa cells were treated with 50 nmol/L of either Eg5 ASO (ISIS 183891), control ASO, lipofectin, or nocodazole (100 ng/mL). At the indicated time point, protein was extracted and either Eg5, survivin, or glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression was determined by Western blotting. B, HeLa cells were treated with increasing concentrations of either Eg5 ASO (ISIS 183891) or control ASO (ISIS 335395) for 48 hours. Lane 1, untreated control; lanes 2 to 5, control ASO (12.5, 25, 50, and 100 nmol/L); lanes 6 to 0, Eg5 ASO (6.25, 12.5, 25, 50, and 100 nmol/L). At this point, protein was extracted and either Eg5, ph-H3, H3, Aurora-A, Aurora-B, or GAPDH expression was determined by Western blotting.
|
|
Induction of apoptosis and inhibition of cell proliferation. Cells treated with Eg5 ASO displayed a distinct rounded morphology 48 hours after ASO treatment. For example, when ASO-treated HeLa cells were stained with Hoechst, they exhibited a fragmented nuclear morphology consistent with cells undergoing apoptosis (Fig. 4A). To further characterize the apoptotic response, cells were treated with the Eg5 ASO and cleavage of PARP was evaluated (Fig. 4B). At 24 hours after treatment, there was no change in PARP cleavage compared with control; however, the appearance of cleaved PARP increased with time until 96 hours after ASO treatment when all PARP protein was cleaved (Fig. 4B). In addition to cleaved PARP, we observed an ASO concentration-dependent cleavage of caspase-7 and caspase-9 48 hours after cells were treated with Eg5 ASO (Fig. 4C). As mentioned above, treatment of HeLa cells with Eg5 ASO led to an increase in hypodiploid fluorescence representing apoptosis. Apoptosis could be blocked with the caspase inhibitor Z-VAD (Fig. 4D). The inhibition of apoptosis with Z-VAD was similar 48 and 72 hours after ASO treatment. In contrast, Z-VAD treatment had no effect on the number of cells with 4N DNA (data not shown). Finally, we examined the effect of inhibiting Eg5 on proliferation of U87-MG glioma and MDA-MB-231 breast tumor cells. These cells were chosen because we planned to use them for xenograft studies. Proliferation of both cell types was inhibited 48 and 72 hours after ASO treatment (Fig. 5). Lipofectin has no effect on cell proliferation (data not shown).

View larger version (39K):
[in this window]
[in a new window]
|
Figure 4. Effect of Eg5 inhibition on induction of apoptosis in HeLa cells. A, HeLA cells were treated with Eg5 ASO (ISIS 183891) at 50 nmol/L or lipofectin alone for 72 hours. Cells are shown in phase contrast (top) and stained with Hoechst (bottom). B, HeLa cells were treated with 50 nmol/L of either Eg5 ASO (ISIS 183891), control ASO, lipofectin, or nocodazole (100 ng/mL). At the indicated time, protein was extracted and extent of PARP protein cleavage determined by Western blotting. C, HeLa cells were treated with increasing concentrations of either Eg5 ASO (ISIS 183891) or control ASO (ISIS 335395) for 48 hours. Lane 1, untreated control; lanes 2 to 5, control ASO (12.5, 25, 50, and 100 nmol/L); lanes 6 to 10, Eg5 ASO (6.25, 12.5, 25, 50, and 100 nmol/L). At this point, protein was extracted and protein levels of caspase-7, caspase-9, Eg5, and GAPDH were determined by Western blotting. D, HeLa cells were treated with lipofectin only, 50 nmol/L control ASO (ISIS 335395), or 50 nmol/L Eg5 ASO (ISIS 183891) in the presence (gray columns) or absence (black columns) of 50 µmol/L Z-VAD. Forty-eight hours later, cells were fixed with ethanol, stained with propidium iodide, and samples were analyzed on a FACScan to quantitate cells in sub-G1.
|
|
In vivo studies. Human U87-MG glioma cells and MDA-MB-231 breast tumor cells were selected for tumor xenograft studies. When grown in culture, treatment of these cells with an Eg5 ASO resulted in a decrease in Eg5 mRNA (Fig. 2A), an increase in cells with 4N DNA content (Figs. 1C and 2B), and inhibition of proliferation (Fig. 5). Tumor cells were implanted in athymic (nude) mice. Beginning 1 day after implantation, the mice were treated thrice a week with either saline, ISIS 183891 ASO, or a control ASO. Tumor growth was assessed by tumor volume measurement over time. Treatment of the animals with ISIS 183891 led to a statistically significant reduction in tumor growth (P < 0.05) in both U87-MG and MDA-MB-231 tumor xenografts (Fig. 6A and D). In the U87-MG xenograft study, tumors from mice treated with one dose of 50 mg/kg were harvested 24 hours after the last dose. RNA was extracted from these tumors and analyzed for Eg5 mRNA levels. Tumors from the mice treated with the Eg5 ASO showed a statistically significant reduction in Eg5 mRNA levels (Fig. 6B). An additional U87-MG xenograft study was done to determine the dose-dependent ASO effects on Eg5 protein expression. Mice were treated with either 25 or 50 mg/kg Eg5 ASO or 50 mg/kg control ASO for 9 days, which resulted in a statistically significant dose-dependent reduction in Eg5 protein at both doses (Supplementary Fig. S4A). To verify the mechanism by which the Eg5 ASO reduces tumor growth rates in vivo, levels of PARP and tumor cell morphology were examined. First, full-length PARP was found to be reduced significantly compared with control in Eg5 ASO-treated tumors (Fig. 6C). Second, histologic examination of MDA-MB-231 tumors revealed an increase in cells containing monopolar spindles in ASO-treated animals, a morphology typically seen when Eg5 is depleted (Fig. 6E).

View larger version (75K):
[in this window]
[in a new window]
|
Figure 6. Effect of Eg5 Inhibition on growth of U87-MG and MDA-MB-231. Athymic mice were implanted with either U87-MG (A-C) or MDA-MB-231 (D and E) human tumor xenografts. Mice were treated with either saline, Eg5 ASO (ISIS 183891), or control ASO (at 50 mg/kg i.p. injection) every other day over 30 days (A) or thrice a week over 41 days (D). Points, mean tumor volume from 12 mice; bars, SE. B, forty-eight hours after the final ASO injection, U87-MG tumors were dissected and Eg5 mRNA expression levels determined by RT-PCR. Points, Eg5 mRNA level from six mice; bars, SE. C, athymic mice were implanted with U87-MG tumor xenograft on day 1. Mice were dosed daily starting on day 4 over 9 days with 50 mg/kg of either an Eg5 ASO, control ASO, or saline. On day 13, tumors were harvested and both Eg5 protein and full-length PARP protein expression were determined by Western blotting. X-linked inhibitor of apoptosis protein levels were used to control for equal loading. E, ASO-treated MDA-MB-231 tumors were removed and fixed and paraffin sections were stained with phospho-histone H3 antibody to visualize mitotic figures. Tumors from saline-treated animals (top) seem to have normal mitotic figures whereas tumors from Eg5 ASO-treated animals (bottom) display monopolar spindles.
|
|
To assess potential toxicities caused by inhibiting Eg5 in mice, C57/BL6 mice were treated for 8 weeks (twice a week) with 12.5 and 50 mg/kg with a mouse specific Eg5 ASO (ISIS 285747). This ASO has been shown to reduce Eg5 mRNA levels in mouse B16-F10 melanoma cells and to cause an increase in cells with 4N DNA content (data not shown). No apparent toxic effects were obvious in the mice after this extended treatment. Animal liver, kidney, and spleen weights were unchanged (Supplementary Fig. S4B). There were no significant changes in serum, gastrointestinal appearance, and blood and bone marrow. However, we have also determined that Eg5 expression is undetectable in various normal mouse tissues (bladder, brain, kidney, small and large intestine, liver, and skeletal muscles; data not shown).
 |
Discussion
|
|---|
The overall goal of these studies has been to identify genes that represent potential targets for the development of antisense-based therapeutics in cancer. Thus, we have developed and used a library of validated ASOs to identify genes involved in regulating G2-M cell cycle progression. To our knowledge, this represents the first time such a library screening approach using RNase Hbased ASOs is described. The use of the library proved straightforward and effective against a number of different human cell lines, and as each ASO has been confirmed to reduce target reduction, greatly reduces the risk of false negatives in phenotypic assays. In addition, multiple control ASOs did not affect the accumulation of cells with 4N DNA content, indicating the specificity of ASO effects. Of the ASOs evaluated,
2% gave significant increases in the number of cells with 4N DNA content and the majority of these were active in both T47D and MCF7 cells. Some of the genes identified were not unexpected (e.g., cdc27 and CDK1). ASOs to multiple members of the anaphase promoting complex (APC) signaling pathway (42) also produced a phenotypic effect, including BTAK, BUB1, NIMA-related kinase 2, and polo-like kinase, although we have not investigated these in more detail. A recent analysis of gene expression profiles in premalignant compared with invasive human breast cancer identified 39 genes (of
12,000) with increased expression associated with ductal carcinoma in situ and invasive ductal carcinoma transition (43). Interestingly, the five APC member genes identified above by us also appeared in this list. We have extended these findings and also found that Eg5 mRNA expression is elevated in tumor samples compared with adjacent normal tissues in breast, colon, lung, ovary, rectal, and uterus (Supplementary Fig. S3). Our data, combined with the reported expression analysis, indicates that proteins of the APC pathway play an important role in breast and other cancers and may contribute to the maintenance of the malignant phenotype. It is not yet clear, however, whether the reported elevated expression of Eg5 in tumor tissues is a consequence of the rapid proliferative rates of some tumors or reflects specific gene amplification in those tumors. Therefore, inhibition of this pathway may be an effective therapeutic approach to treat a variety of tumor types. A number of less well-characterized genes also increased 4N DNA content, including ASOs targeting BiP-associated, inhibitor-
B receptor, Apelin, sprouty homologue 4, and APC1. Further work will be necessary to characterize the specific roles played by these genes in regulating mitosis. Included in the library were ASOs targeting members of the kinesin family of genes. In addition to Eg5, two kinesin ASO inhibitors that caused an increase in cells with 4N DNA content were identified; these targeted rab6 and KIF23. These targets when inhibited have been shown to cause a failure in cytokinesis yielding binucleated cells with 4N DNA content (44). However, the most effective ASO identified in the library resulting in 4N DNA content in both MCF7 and T47D cells targeted Eg5.
To further characterize ASO-mediated Eg5 inhibition, HeLa, U87-MG, and MDA-MB-231 cells were treated with two different ASOs against Eg5. This resulted in a concentration-dependent reduction in Eg5 mRNA and protein expression concurrent with an increase in 4N DNA content (Figs. 2 and 3). In addition, Eg5 ASO treatment of multiple additional tumor cell lines from a variety of cancers (lung, bladder, pancreas, prostate, cervix and liver) increased 4N DNA content (Fig. 1C). Eg5 inhibition induces a monoastral phenotype in cells treated in vitro (Supplementary Fig. S2A) and in vivo in tumor xenografts (Fig. 6D), probably due to the involvement of Eg5 in centrosome separation and bipolar spindle formation (18, 19, 45). In addition, cells exhibited a rounded morphology reminiscent of taxol-treated cells (Fig. 4). Reduction of Eg5 inhibited cell proliferation in U87-MG and HeLa cells. Consistent with an arrest in mitosis, we observed an increase in histone H3 phosphorylation. It has been shown in Xenopus eggs that an Aurora-related protein kinase associates with Eg5 and then phosphorylates Eg5 (46, 47). The inhibition of Eg5 with ASO 183891 led to an increase in Aurora-A phosphorylation, indicating that Eg5 is not necessary for Aurora-A phosphorylation. Aurora-B, a chromosome passenger protein, phosphorylates histone H3. We have not seen a defect in histone H3 phosphorylation in Eg5 ASO-treated cells, suggesting that Eg5 protein is not necessary for Aurora-B to phosphorylate histone H3. Judged by the appearance of an apoptotic "sub-G1" population in cell cycle profiles, caspase-7, caspase-9, and PARP cleavage and formation of fragmented nuclei, apoptosis was the second major phenotype we observed in Eg5-depleted cells (Fig. 4). Kittler et al. (10) did a siRNA screen in human cells to identify genes important for cell division. Nineteen of 37 siRNAs that caused mitotic arrest led to cell death after prolonged latency in mitosis. These genes may stop the cells from progressing further through mitosis and ultimately induce cell death. Thus, apoptosis after a prolonged block in mitosis seems to be a common phenomenon.
Our cell culture data encouraged us to explore the Eg5 ASO antitumor activity in vivo. To do this, the Eg5 ASO was given thrice a week at 50 mg/kg to mice bearing xenografts of the breast tumor carcinoma MDA-MB-231 and the glioblastoma U87-MG, both of which are responsive to Eg5 inhibition in cell culture. Treatment with Eg5 ASO led to a statistically significant reduction of tumor growth in both types of xenografts as well as a reduction in Eg5 expression. In addition, the appearance of monopolar cells in MDA-MB-231 xenografts indicates that the Eg5 ASO is inducing a similar phenotype to that seen in cell culture. In these studies, no ASO-mediated toxicities were apparent subsequent to dosing the mice with the human specific Eg5 ASO. However, this ASO does not cross-react with mouse Eg5 and therefore will not suppress murine Eg5 expression in mouse tissue. To examine for any potential gene mediated toxicities associated with Eg5 reduction in the mouse, an ASO selective for murine Eg5 was developed. Dosing mice with 12.5 and 50 mg/kg twice a week for 8 weeks with this compound did not show any apparent toxicities (e.g. animal weights; Supplementary Fig. S4B), liver transaminases, gastrointestinal appearances, and blood marrow (data not shown). Eg5, however, is expressed at a very low level, if at all, in most mouse tissues, which may account for the apparent lack of ASO-mediated toxicity, and therefore may increase the therapeutic index of compounds targeting this gene. Previously reported xenograft studies with CK0106023, a small-molecule inhibitor to Eg5, also showed significant antitumor activity at 25 mg/kg without any reported weight change (48), further supporting a therapeutic strategy targeting Eg5 in cancer.
A key question that remains, however, is can our results translate into clinical activity for an ASO either targeting Eg5 or other molecular targets? Although a number of failed clinical trials with antisense in cancer have occurred (49, 50), these were all done using phosphorothioate oligodeoxynucleotides. The antisense chemistry used here contains the 2'MOE modification, which is both more potent and more nuclease resistant than phosphorothioate oligodeoxynucleotides. This chemical modification therefore has a much improved pharmacodynamic profile in animals compared with phosphorothioate oligodeoxynucleotides. Very recently, the first report of activity for this class of ASO in a cancer clinical trial was described (49). A 2'MOE ASO targeting clusterin (OGX-011) has been shown to both accumulate in and to induce target down-regulation in prostate cancer tissues. These preliminary results are highly encouraging and support the continued clinical development of this class of compound.
In conclusion, our data show the utility and value of an ASO library as a tool to identify gene regulators of mitosis. This process is relatively rapid and the reagents developed can subsequently be used for additional in vitro and in vivo studies. We have identified Eg5 as critical in maintaining the growth and proliferative capacity of many cells and our data suggest that Eg5 would be a good target for therapeutic intervention in cancer.
 |
Acknowledgments
|
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank the RTS team (Joe Baroldi, Scott Davis, Eigen Peralta, and Andrew Watt) for identifying the lead ASOs; Boyd Conklin for ASO synthesis; and Tracey Reigle, Eric Marcusson, and Jon K. Bodnar for help in the preparation of the manuscript.
 |
Footnotes
|
|---|
Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/).
Received 5/ 6/05.
Revised 11/15/05.
Accepted 12/ 8/05.
 |
References
|
|---|
- Bhalla KN. Microtubule-targeted anticancer agents and apoptosis. Oncogene 2003;22:907586.[CrossRef][Medline]
- Nigg EA. Mitotic kinases as regulators of cell division and its checkpoints. Nat Rev Mol Cell Biol 2001;2:2132.[CrossRef][Medline]
- Kawabe T. G2 checkpoint abrogators as anticancer drugs. Mol Cancer Ther 2004;3:5139.[Abstract/Free Full Text]
- Harrington EA, Bebbington D, Moore J, et al. VX-680, a potent and selective small-molecule inhibitor of the Aurora kinases, suppresses tumor growth in vivo. Nat Med 2004;10:2627.[CrossRef][Medline]
- Bettencourt-Dias M, Giet R, Sinka R, et al. Genome-wide survey of protein kinases required for cell cycle progression. Nature 2004;432:9807.[CrossRef][Medline]
- MacKeigan JP, Murphy LO, Blenis J. Sensitized RNAi screen of human kinases and phosphatases identifies new regulators of apoptosis and chemoresistance. Nat Cell Biol 2005;7:591600.[CrossRef][Medline]
- Trompouki E, Hatzivassiliou E, Tsichritzis T, et al. CYLD is a deubiquitinating enzyme that negatively regulates NF-
B activation by TNFR family members. Nature 2003;424:7936.[CrossRef][Medline] - Aza-Blanc P, Cooper CL, Wagner K, et al. Identification of modulators of TRAIL-induced apoptosis via RNAi-based phenotypic screening. Mol Cell 2003;12:62737.[CrossRef][Medline]
- Zheng L, Liu J, Batalov S, et al. An approach to genomewide screens of expressed small interfering RNAs in mammalian cells. Proc Natl Acad Sci U S A 2004;101:13540.[Abstract/Free Full Text]
- Kittler R, Putz G, Pelletier L, et al. An endoribonuclease-prepared siRNA screen in human cells identifies genes essential for cell division. Nature 2004;432:103640.[CrossRef][Medline]
- McKay RA, Miraglia LJ, Cummins LL, et al. Characterization of a potent and specific class of antisense oligonucleotide inhibitor of human protein kinase C-
expression. J Biol Chem 1999;274:171522.[Abstract/Free Full Text] - Butler M, McKay RA, Popoff IJ, et al. Specific inhibition of PTEN expression reverses hyperglycemia in diabetic mice. Diabetes 2002;51:102834.[Abstract/Free Full Text]
- Zinker BA, Rondinone CM, Trevillyan JM, et al. PTP1B antisense oligonucleotide lowers PTP1B protein, normalizes blood glucose, and improves insulin sensitivity in diabetic mice. Proc Natl Acad Sci U S A 2002;99:1135762.[Abstract/Free Full Text]
- Sloop KW, Cao JX, Siesky AM, et al. Hepatic and glucagon-like peptide-1-mediated reversal of diabetes by glucagon receptor antisense oligonucleotide inhibitors. J Clin Invest 2004;113:157181.[CrossRef][Medline]
- Zhang H, Cook J, Nickel J, et al. Reduction of liver Fas expression by an antisense oligonucleotide protects mice from fulminant hepatitis. Nat Biotechnol 2000;18:8627.[CrossRef][Medline]
- Lee Y, Vassilakos A, Feng N, et al. GTI-2040, an antisense agent targeting the small subunit component (R2) of human ribonucleotide reductase, shows potent antitumor activity against a variety of tumors. Cancer Res 2003;63:280211.[Abstract/Free Full Text]
- Dagenbach EM, Endow SA. A new kinesin tree. J Cell Sci 2004;117:37.[Free Full Text]
- Cole DG, Saxton WM, Sheehan KB, Scholey JM. A "slow" homotetrameric kinesin-related motor protein purified from Drosophila embryos. J Biol Chem 1994;269:229136.[Abstract/Free Full Text]
- Blangy A, Lane HA, d'Herin P, et al. Phosphorylation by p34cdc2 regulates spindle association of human Eg5, a kinesin-related motor essential for bipolar spindle formation in vivo. Cell 1995;83:115969.[CrossRef][Medline]
- Mayer TU, Kapoor TM, Haggarty SJ, et al. Small molecule inhibitor of mitotic spindle bipolarity identified in a phenotype-based screen. Science 1999;286:9714.[Abstract/Free Full Text]
- Kapoor TM, Mayer TU, Coughlin ML, Mitchison TJ. Probing spindle assembly mechanisms with monastrol, a small molecule inhibitor of the mitotic kinesin, Eg5. J Cell Biol 2000;150:97588.[Abstract/Free Full Text]
- Nakazawa J, Yajima J, Usui T, et al. A novel action of terpendole E on the motor activity of mitotic Kinesin Eg5. Chem Biol 2003;10:1317.[CrossRef][Medline]
- DeBonis S, Simorre JP, Crevel I, et al. Interaction of the mitotic inhibitor monastrol with human kinesin Eg5. Biochemistry 2003;42:33849.[CrossRef][Medline]
- Maliga Z, Kapoor TM, Mitchison TJ. Evidence that monastrol is an allosteric inhibitor of the mitotic kinesin Eg5. Chem Biol 2002;9:98996.[CrossRef][Medline]
- Ma VY, Bisby MA. Increased activation of nuclear factor
B in rat lumbar dorsal root ganglion neurons following partial sciatic nerve injuries. Brain Res 1998;797:24354.[CrossRef][Medline] - Marcus AI, Peters U, Thomas SL, et al. Mitotic kinesin inhibitors induce mitotic arrest and cell death in Taxol-resistant and -sensitive cancer cells. J Biol Chem 2005;280:1156977.[Abstract/Free Full Text]
- Dean NM, McKay R, Condon TP, Bennett CF. Inhibition of protein kinase C-
expression in human A549 cells by antisense oligonucleotides inhibits induction of intercellular adhesion molecule 1 (ICAM-1) mRNA by phorbol esters. J Biol Chem 1994;269:1641624.[Abstract/Free Full Text] - Dean NM, Griffey RH. Identification and characterization of second-generation antisense oligonucleotides. Antisense Nucleic Acid Drug Dev 1997;7:22933.[Medline]
- Baker BF, Lot SS, Condon TP, et al. 2'-O-(2-Methoxy)ethyl-modified anti-intercellular adhesion molecule 1 (ICAM-1) oligonucleotides selectively increase the ICAM-1 mRNA level and inhibit formation of the ICAM-1 translation initiation complex in human umbilical vein endothelial cells. J Biol Chem 1997;272:119942000.[Abstract/Free Full Text]
- Waring JF, Ciurlionis R, Clampit JE, et al. PTP1B antisense-treated mice show regulation of genes involved in lipogenesis in liver and fat. Mol Cell Endocrinol 2003;203:15568.[CrossRef][Medline]
- Vickers TA, Koo S, Bennett CF, et al. Efficient reduction of target RNAs by small interfering RNA and RNase H-dependent antisense agents. A comparative analysis. J Biol Chem 2003;278:710818.[Abstract/Free Full Text]
- Marumoto T, Honda S, Hara T, et al. Aurora-A kinase maintains the fidelity of early and late mitotic events in HeLa cells. J Biol Chem 2003;278:5178695.[Abstract/Free Full Text]
- Huang JY, Raff JW. The dynamic localisation of the Drosophila APC/C: evidence for the existence of multiple complexes that perform distinct functions and are differentially localised. J Cell Sci 2002;115:284756.[Abstract/Free Full Text]
- Topper LM, Campbell MS, Tugendreich S, et al. The dephosphorylated form of the anaphase-promoting complex protein Cdc27/Apc3 concentrates on kinetochores and chromosome arms in mitosis. Cell Cycle 2002;1:28292.[Medline]
- Elez R, Piiper A, Giannini CD, Brendel M, Zeuzem S. Polo-like kinase1, a new target for antisense tumor therapy. Biochem Biophys Res Commun 2000;269:3526.[CrossRef][Medline]
- Norbury C, Nurse P. Animal cell cycles and their control. Annu Rev Biochem 1992;61:44170.[CrossRef][Medline]
- Flanagan WM, Su LL, Wagner RW. Elucidation of gene function using C-5 propyne antisense oligonucleotides. Nat Biotechnol 1996;14:113945.[CrossRef][Medline]
- Hendzel MJ, Wei Y, Mancini MA, et al. Mitosis-specific phosphorylation of histone H3 initiates primarily within pericentromeric heterochromatin during G2 and spreads in an ordered fashion coincident with mitotic chromosome condensation. Chromosoma 1997;106:34860.[CrossRef][Medline]
- Hendzel MJ, Kruhlak MJ, Bazett-Jones DP. Organization of highly acetylated chromatin around sites of heterogeneous nuclear RNA accumulation. Mol Biol Cell 1998;9:2491507.[Abstract/Free Full Text]
- Hendzel MJ, Nishioka WK, Raymond Y, et al. Chromatin condensation is not associated with apoptosis. J Biol Chem 1998;273:244708.[Abstract/Free Full Text]
- Chadee DN, Hendzel MJ, Tylipski CP, et al. Increased Ser-10 phosphorylation of histone H3 in mitogen-stimulated and oncogene-transformed mouse fibroblasts. J Biol Chem 1999;274:2491420.[Abstract/Free Full Text]
- Castro A, Bernis C, Vigneron S, Labbe JC, Lorca T. The anaphase-promoting complex: a key factor in the regulation of cell cycle. Oncogene 2005;24:31425.[CrossRef][Medline]
- Ma XJ, Salunga R, Tuggle JT, et al. Gene expression profiles of human breast cancer progression. Proc Natl Acad Sci U S A 2003;100:59749.[Abstract/Free Full Text]
- Zhu C, Zhao J, Bibikova M, et al. Functional analysis of human microtubule-based motor proteins, the kinesins and dyneins, in mitosis/cytokinesis using RNA interference. Mol Biol Cell 2005;16:318799.[Abstract/Free Full Text]
- Sawin KE, Mitchison TJ. Mutations in the kinesin-like protein Eg5 disrupting localization to the mitotic spindle. Proc Natl Acad Sci U S A 1995;92:428993.[Abstract/Free Full Text]
- Giet R, Uzbekov R, Cubizolles F, Le Guellec K, Prigent C. The Xenopus laevis aurora-related protein kinase pEg2 associates with and phosphorylates the kinesin-related protein XlEg5. J Biol Chem 1999;274:1500513.[Abstract/Free Full Text]
- Giet R, Prigent C. The Xenopus laevis aurora/Ip11p-related kinase pEg2 participates in the stability of the bipolar mitotic spindle. Exp Cell Res 2000;258:14551.[CrossRef][Medline]
- Sakowicz R, Finer JT, Beraud C, et al. Antitumor activity of a kinesin inhibitor. Cancer Res 2004;64:327680.[Abstract/Free Full Text]
- Gleave M, Miyake H. Use of antisense oligonucleotides targeting the cytoprotective gene, clusterin, to enhance androgen- and chemo-sensitivity in prostate cancer. World J Urol 2005;23:3846.[CrossRef][Medline]
- Dean NM, Bennett CF. Antisense oligonucleotide-based therapeutics for cancer. Oncogene 2003;22:908796.[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
M. C. Henderson, Y.-J. Y. Shaw, H. Wang, H. Han, L. H. Hurley, G. Flynn, R. T. Dorr, and D. D. Von Hoff
UA62784, a novel inhibitor of centromere protein E kinesin-like protein
Mol. Cancer Ther.,
January 1, 2009;
8(1):
36 - 44.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Taniwaki, A. Takano, N. Ishikawa, W. Yasui, K. Inai, H. Nishimura, E. Tsuchiya, N. Kohno, Y. Nakamura, and Y. Daigo
Activation of KIF4A as a Prognostic Biomarker and Therapeutic Target for Lung Cancer
Clin. Cancer Res.,
November 15, 2007;
13(22):
6624 - 6631.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Rebacz, T. O. Larsen, M. H. Clausen, M. H. Ronnest, H. Loffler, A. D. Ho, and A. Kramer
Identification of Griseofulvin as an Inhibitor of Centrosomal Clustering in a Phenotype-Based Screen
Cancer Res.,
July 1, 2007;
67(13):
6342 - 6350.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Fujii, C. Zhu, Y. Wen, H. Marusawa, B. Bailly-Maitre, S.-i. Matsuzawa, H. Zhang, Y. Kim, C. F. Bennett, W. Jiang, et al.
HBXIP, Cellular Target of Hepatitis B Virus Oncoprotein, Is a Regulator of Centrosome Dynamics and Cytokinesis.
Cancer Res.,
September 15, 2006;
66(18):
9099 - 9107.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Koller, S. Propp, H. Murray, W. Lima, B. Bhat, T. P. Prakash, C. R. Allerson, E. E. Swayze, E. G. Marcusson, and N. M. Dean
Competition for RISC binding predicts in vitro potency of siRNA
Nucleic Acids Res.,
September 11, 2006;
34(16):
4467 - 4476.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Davis, B. Lollo, S. Freier, and C. Esau
Improved targeting of miRNA with antisense oligonucleotides.
Nucleic Acids Res.,
January 1, 2006;
34(8):
2294 - 2304.
[Abstract]
[Full Text]
[PDF]
|
 |
|