Cancer Research Cell Death Mechanisms and Cancer Therapy  EMT and Cancer Progression and Treatment
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wu, F. Y.
Right arrow Articles by Arteaga, C. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wu, F. Y.
Right arrow Articles by Arteaga, C. L.
[Cancer Research 66, 2162-2172, February 15, 2006]
© 2006 American Association for Cancer Research


Cell, Tumor, and Stem Cell Biology

Reduction of Cytosolic p27Kip1 Inhibits Cancer Cell Motility, Survival, and Tumorigenicity

Frederick Y. Wu1, Shizhen Emily Wang2, Melinda E. Sanders3,4, Incheol Shin2,5, Federico Rojo6, Jose Baselga6 and Carlos L. Arteaga1,2,4

Departments of 1 Medicine, 2 Cancer Biology, and 3 Pathology and 4 Breast Cancer Research Program, Vanderbilt-Ingram Comprehensive Cancer Center, Vanderbilt University School of Medicine, Nashville, Tennessee; 5 Department of Life Sciences, Hanyang University, Seoul, South Korea; and 6 Oncology Service, Vall d'Hebron University Hospital, Barcelona, Spain

Requests for reprints: Carlos L. Arteaga, Division of Oncology, Vanderbilt University Medical Center, 2220 Pierce Avenue, 777 PRB, Nashville, TN 37232-6307. Phone: 615-936-3524; Fax: 615-936-1790; E-mail: carlos.arteaga{at}vanderbilt.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We generated a p27Kip1 mutant (p27{Delta}NLS) that localized exclusively in cell cytosol. Expression of p27{Delta}NLS in MCF7 breast cancer cells down-regulated RhoA and increased motility, survival, and Akt levels without an effect on cell cycle distribution. RNA interference of p27 in U87 glioma cells, which express p27 predominantly in the cytoplasm, inhibited motility and survival. Conversely, knockdown of p27 in COS7 cells, with >95% nuclear p27 expression, accelerated proliferation but had no effect on motility or survival. U87 cells in which p27 had been eliminated by RNA interference exhibited lower Akt levels, shorter Akt turnover, and markedly impaired tumorigenicity in vivo. These xenografts were less invasive and exhibited increased apoptosis compared with p27-expressing tumors. Expression of cytosolic p27 in primary human breast carcinomas correlated linearly with Akt content as measured by immunohistochemistry. These data suggest that cytoplasmic p27 can exert oncogenic functions by modulating Akt stability, cell survival, and tumorigenicity. (Cancer Res 2006; 66(4): 2162-72)


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
p27Kip1 is a member of the Kip family of cyclin-dependent kinase (Cdk) inhibitors initially discovered as having a Cdk-inhibitory activity induced by extracellular antimitogenic signals (1, 2). It accumulates in serum-starved and density-arrested cells and its overexpresssion results in cell cycle arrest in G1 and/or apoptosis. Consistent with its role as a tumor suppressor, p27-null mice develop multiorgan hyperplasia and increased susceptibility to cancer (3). Loss of a single allele of p27 confers increased susceptibility to carcinogen-induced tumors in mice (4) and low levels of p27 protein have been associated with poor prognosis in several human cancers (5, 6). Inactivation of the cell cycle inhibitory activity of p27 is commonly observed in several cancers by mechanisms that mainly involve accelerated proteolysis, sequestration by cyclin D-Cdk complexes, and posttranslational modifications leading to nuclear export and/or retention in the cytosol (7).

Cytoplasmic translocation of p27 has been increasingly recognized in primary human tumors associated with poor survival whereas nuclear expression confers a more favorable outcome (5, 6). The oncogenic kinase Akt and the growth factor–dependent human kinase-interacting stathmin have been causally associated with cytoplasmic retention and nuclear export of p27 (811), respectively, further implying a link between mislocalized p27 and enhanced transformation. A simple explanation as to how the cytoplasmic redistribution of p27 may contribute to transformation is derepression and activation of nuclear Cdk2. Interestingly, p27 does not fit Knudson's "two-hit" criterion for most tumor suppressor genes in that inactivating mutations or homozygous deletions of both p27 alleles are exceedingly rare (3). This suggests lack of a selective pressure to lose p27 completely perhaps as the result of "gain-of-function" effects of low levels of mislocalized p27.

Several mechanistic data suggest that cytosolic p27 has functions opposite to its tumor suppressor role. In the cytosol, p27 assembles cyclin D/Cdk4 complexes and promotes their import into the nucleus (12, 13). Transduction of TAT-p27 fusion protein into HepG2 hepatocellular cancer cells results in enhanced cell migration (14). Treatment with hepatocyte growth factor induces Ser10 phosphorylation-dependent nuclear export of p27. Once in the cytoplasm, p27 stimulates Rac-dependent migration of HepG2 cells and embryonic fibroblasts (15). In this study, a region in the COOH-terminal domain of p27, independent of its Cdk-inhibitory activity, was required for growth factor–stimulated migration. In a more recent report, Besson et al. (16) showed that p27 regulates cell migration by titrating the function of the RhoA GTPase as a result of direct binding to RhoA and inhibition of activation by its guanine nucleotide exchange factors. Thus, by decreasing actin stress fiber formation and adhesion, p27 alters the balance between RhoA and Rac and thus allows cell movement. Taken together, these data suggest that p27 may act as a tumor suppressor or as an oncogene depending on its subcellular localization.

Therefore, to study gain-of-function effects of cytoplasmic p27 on transformation, we engineered a p27 mutant that exclusively localized in the cytosol. Expression of this mutant in MCF7 cells increased cell motility and survival while up-regulating Akt protein stability. To extend these observations, we hypothesized that elimination of p27 by RNA interference would have opposite effects in cells with predominant nuclear versus cytosolic localization. Knockdown of p27 in PTEN-null U87 tumor cells with predominant cytosolic p27 resulted in reduced cell motility, enhanced apoptosis, and lower levels and stability of Akt in vitro, as well as reduced tumorigenicity, tumor cell viability, and invasiveness in vivo. However, in COS7 cells with >95% nuclear p27, RNA interference of p27 only accelerated cell cycle progression without affecting cell survival or motility. These data support the oncogenic role of cytoplasmic mislocalized p27 and its potential use as a therapeutic target. The results also suggest that this approach would have opposite consequences depending as to where in the tumor cell p27 is predominantly localized.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell lines, plasmids, and retroviruses. All cell lines were from the American Type Culture Collection (Rockville, MD). MCF-7, human embryo kidney cells 293T, African green monkey fibroblast kidney cells COS7, Phoenix-Ampho cells, and U87-MG glioma cells were grown in DMEM (Cambrex, Walkersville, MD) containing 10% fetal bovine serum (FBS; Hyclone, Logan, UT) in a humidified 5% CO2 incubator at 37°C. The p27 (–/–) mouse embryonic fibroblasts were generated as described previously (17) and were maintained in DMEM/10% FBS.

To generate a p27 mutant with aspartic acid substitutions at Ser10 and Thr157 (referred herein as Flag-p27DD), we used the pcDNA 5' Flag-p27 plasmid (11) as the parent vector and the Stratagene QuickChange Multi Site-Directed Mutagenesis kit with two primers, namely (a) Ser10 mutant-F: 5'-phospho-GAGTGTCTAACGGGGACCCTAGCCTGGAGC-3' and (b) Thr157 mutant-F: 5'-phospho-AATAAGGAAGCGACCTGCAGACGACGATTCTTCTACTCAA-3', according to the Stratagene Mutagenesis Protocol. To generate a mutant p27 with neutral hydrophobic residues replacing positive residues in the nuclear localization sequence (Flag-p27{Delta}NLS; 152RKR to ALA and 165KR to LA), four primers were generated and two of them contained specific nucleotide mutations: (a) FYW3: 5'-TCGCGGATCCAATGTCAAACGTGCGAGTGTCT-3', (b) FYW4: 5'-GCCGGAATTCTTACGTTTGACGTCTTCTGAG-3', (c) FYW5: 5'-CCTGCAACCGACGATTCTTCTACTCAAAACCTCGCAGCCACCA GAACAGAAGAAAATGTTTCA-3', and (d) FYW6: 5'-GTTTTGAGTAGAAGAATCGTCGGTTGCAGGTGCTAACGCTATTCCTGCGCATTGCTCCGCTAACCC-3'. First, using pcDNA-p27 as template, two different overlapping fragments of p27 genes were obtained by PCR amplifications with primers FYW3 and FYW6, FYW5, and FYW4, respectively. Second, 1 µL of each of the two fragments were pooled together and a second round PCR was conducted with primers FYW3 and FYW4 to generate the full-length p27{Delta}NLS cDNA fragment, which was cloned into the pcDNA-Flag vector to generate pcDNA-Flag-p27{Delta}NLS. Subsequently, the wild-type and mutant fragments were excised by BamHI/EcoRI restriction enzyme digestion and cloned into the pBMN-Ires-EGFP retroviral vector (18) to generate pBMN-IRES-EGFP-Flag-p27 plasmids. These were transduced into Phoenix-Ampho packaging cells (19) to generate GFP-encoding retroviruses.

To generate retroviruses that express short hairpin RNAs (shRNA) against human p27, two complementary oligonucleotides: 5'-phospho-GATCCCCGCACTGCAGAGACATGGAATTCAAGAGATTCCATGTCTCTGCAGTGCTTTTTGGAAT and 5'-phospho-AGCTATTCCAAAAAGCACTGCAGAGACATGGAATCTCTTGAATTCCATGTCTCTGCAGTGCGGG were annealed and inserted into the BglII/HindIII sites of pSUPER.retro vector (20). The plasmid was transfected into Phoenix-Ampho cells to produce infectious p27-shRNA retroviruses. Virion-containing supernatants were harvested at 48 hours after transfection. As control, oligonucleotides 5'-phospho-GATCCCCGCACTGCCGGGATATGGAATTCAAGAGATTCCATATCCCGGCAGTGCTTTTTGGAAT and 5'-phospho-AGCTATTCCAAAAAGCACTGCCGGGATATGGAATCTCTTGAATTCCATATCCCGGCAGTGCGGG were annealed and inserted into the same vector, which is specific against mouse p27 gene and, thus, should not interfere with human p27 gene expression.

Transfection and retroviral transduction. COS7, 293T, and p27 (–/–) mouse embryonic fibroblasts were transfected with pcDNA-Flag-vector or Flag-p27 (wild-type and mutants) plasmids using FuGENE6 Transfection Reagent (Roche, Indianapolis, IN) as described (21). MCF-7 cells were transduced with pBMN-Ires-EGFP-Flag-27 (or vector alone) retroviruses (MOI 50:1) as described (22). After sorting GFP-positive cells by flow cytometry, stably transduced cells were selected in medium containing 1 mg/mL G418 (Research Products International Corp., Mt. Prospect, IL). U87 and COS7 cells were transduced with retroviruses encoding shRNAs for mouse and human p27 [multiplicity of infection (MOI) 50:1] and selected in 1 ng/mL puromycin (Calbiochem, San Diego, CA). Drug-resistant single cell colonies expressing p27-shRNA were isolated and expanded in puromycin-containing media. Expression of p27 was confirmed by immunoblot analysis of cell lysates.

Immunoprecipitation, immunoblotting, and Rho/Rac assays. MCF-7, COS7, or 293T cells were washed twice with ice-cold PBS and lysed in NP40 lysis buffer [20 mmol/L Tris (pH 7.4), 150 mmol/L NaCl, 1% NP40, 0.1 mmol/L EDTA, plus protease inhibitors and phosphatase inhibitors]. After sonication for 10 seconds at the minimal setting and centrifugation, the supernatant was collected and total protein concentration in it was measured using the BCA assay reagent (Pierce, Rockford, IL). For immunoprecipitation, 500 µg protein sample were diluted in immunoprecipitation buffer [50 mmol/L Tris-Cl (pH 7.9), 50 mmol/L NaCl, 0.1 mmol/L EDTA, 1% glycerol, 0.2% NP40, 1 mmol/L DTT, 0.5 mmol/L phenylmethylsulfonyl fluoride] to make a 500 µL final volume, and incubated with 2 µg antibodies overnight at 4°C. Fifty microliters of a 50% slurry of 1:1 mixed protein A/G-Sepharose beads were added to each sample and incubated for 1 hour at 4°C. The beads were then washed thrice with cold immunoprecipitation buffer at 15-minute intervals, resuspended in 2x SDS-gel loading buffer, and boiled for 5 minutes before SDS-PAGE. For immunoblotting, 30 µg protein extracts were separated by 10% SDS-PAGE and transferred to nitrocellulose membranes. Membranes were incubated with primary and horseradish peroxidase–conjugated secondary antibodies (Promega, Madison, WI) as described (21). Primary antibodies included Flag monoclonal antibody (mAb), Flag rabbit polyclonal antibody (pAb), actin mAb, and human vinculin mAb (Sigma, St. Louis, MO); p27 mAb (Transduction Laboratories, San Diego, CA); phosphotyrosine, RhoA, FAK rabbit pAb (Santa Cruz Biotechnology, Santa Cruz, CA); total Akt, S473 phospho-Akt, phospho-GSK3{alpha}/ß rabbit pAb, and total GSK3ß mAb (Cell Signaling, Beverly, MA); Rac mAb (BD Biosciences, San Diego, CA); proliferating cell nuclear antigen (PCNA) mAb (PharMingen, San Diego, CA) total and T202/Y204 phospho-mitogen-activated protein kinase (MAPK) rabbit pAb (Promega). To pull down GTP-bound form of Rho or Rac, a glutathione S-transferase (GST) fusion protein with Rhotekin-Rho binding domain (RBD) or a GST-Pak binding domain (PBD) fusion, respectively, each precoupled to agarose-glutathione beads (Cytoskeleton, Inc., Denver, CO) were used as described previously (22, 23). In brief, 20 µg beads were added to 250 µg cleared cell lysates and incubated for 30 minutes at 4°C. Eluted RhoA and Rac1 were detected by immunoblot.

Cell cycle analysis. Cells were harvested by trypsinization, washed twice with ice-cold PBS, resuspended in cold PBS, and fixed by adding absolute ethanol (while vortexing) to a final ethanol concentration of 67%. After fixing overnight at –20°C and rehydrating in PBS for 30 minutes on ice, cell nuclei were stained for 30 minutes in the dark with 50 µg/mL propidium iodide (Sigma) containing 125 units/mL protease-free RNase (Calbiochem), both diluted in PBS. Cells were filtered through a 5 µm pore size nylon mesh (Small Parts, Inc., Miami Lakes, FL). A total of 15,000 stained nuclei were analyzed using the BD CellQuest Pro software package coupled to a FACSCalibur flow cytometer (Becton Dickinson, Mansfield, MA) as described (21).

Cell motility and adhesion. Transwell motility assays were done using 5 µm pore, 6.5-mm polycarbonate transwell filters (Corning Costar Corp., Cambridge, MA). Cells (1.5 x 105) suspended in medium containing 0.1% FBS were seeded on the upper surface of the filters and allowed to migrate toward 0.1% FBS or 10% FBS-containing media in the bottom compartment for 20 hours. The cells remaining on the upper surface were wiped off with a cotton swab and the cells that had migrated to the underside of the transwell filters were fixed, stained with Diff-Quick kit (Dudingen, Switzerland), and counted by bright field microscopy at x200 in five random fields. For wound closure assay, stably transfected p27 (–/–) mouse embryonic fibroblasts in full medium were allowed to reach >90% confluence on six-well plates and then switched to serum-free medium for 30 hours. The monolayers were next scraped with a plastic pipette tip as described (24). Phase-contrast images were photographed at 0, 12, and 24 hours after wounding. To measure adhesion, cells were trypsinized and resuspended in DMEM/10% FBS. About 2 x 105 cells per well were added to uncoated six-well tissue culture plates and allowed to attach at 37°C. After 1, 2, or 4 hours, cells that had not attached were removed and the attached cells were trypsinized and measured using a Coulter counter. Cell adhesion was calculated as the percentage of attached cells over the total input per well.

Apoptosis and cell viability. Five hundred thousand cells per well in six-well plates were incubated in serum-free DMEM for 72 hours. Both attached and suspended cells were harvested and washed with PBS, before being subjected to APO-BRDU analysis with the use of an apo-BrdUrd assay kit (Phoenix Flow Systems, San Diego, CA) according to the protocol of the manufacturer. FITC-positive apoptotic cells were quantitated in a FACSCalibur Flow Cytometer (BD Biosciences). Assessment of DNA fragmentation in serum-starved cells was done as described previously (25). DNA fragments were separated in 1.5% agarose gels. Cell viability was also assessed by trypan blue exclusion. For this, after 3 days in serum-free medium, floating and adherent cells were collected and incubated in 0.2% trypan blue for 2 minutes at room temperature. Trypan blue–positive cells were counted manually and their percentage calculated over the total cell input.

Indirect immunofluorescence assay. Cells grown on coverslips were fixed in methanol for 20 minutes at –20°C and then rehydrated in PBS for 30 minutes on ice. After blocking with 3% nonfat milk in PBS for 30 minutes, cells were incubated for 60 minutes with primary antibodies (1:500) diluted in 1% milk, and then with fluorescent secondary antibodies or phalloidin (1:500) for 30 minutes at room temperature. Cell nuclei were stained with 1 µg/mL Hoechst for 10 minutes at room temperature. Coverslips were mounted on 25 x 75 mm microslides (VWR Scientific, Atlanta, GA) using AquaPolyMount (Polysciences, Warrington, PA). Fluorescent images were captured using a Princeton Instruments cooled charge-coupled device digital camera from a Zeiss Axiophot upright microscope. Fluorescent antibodies were as follows: Oregon green-{alpha}-mouse IgG, Texas red-{alpha}-rabbit IgG and Texas red-phalloidin (Molecular Probes, Eugene, OR).

35S metabolic labeling and pulse-chase. Cells grown on six-well plates were washed and incubated with methionine- and cysteine-free DMEM (Life Technologies Invitrogen, Carlsbad, CA) at 37°C for 30 minutes. Cells were next labeled with 200 µCi/mL Trans35S-Label (MP Biomedicals, Irvine, CA) in 0.5 mL methionine/cysteine-free DMEM at 37°C for 30 minutes, washed twice with fresh DMEM, and incubated with DMEM/10% FBS. At variable times after the addition of serum-containing medium, cells were washed with ice-cold PBS and harvested in 200 µL NP40 lysis buffer (above). Three hundred micrograms of protein were precipitated with 2 µg of an Akt antibody (Cell Signaling). The 35S-labeled immune complexes were resolved by SDS-PAGE and visualized by autoradiography.

Xenograft studies. U87 cells (5 x 106) in a 0.25 mL volume were injected s.c. via a 22-gauge needle in the dorsal space of 4- to 5-week-old athymic mice (Harlan Sprague-Dawley, Madison, WI). Mice were examined thrice a week for tumor development. Tumor diameters were measured with calipers and volume calculated by the formula [volume = width2 x length / 2]. Apoptosis in the xenografts was measured by terminal deoxynucleotidyl transferase-mediated nick end labeling (TUNEL) analysis with the Apoptag Detection kit (Serologicals Corp., Norcross, GA) as described previously (17). p27 content in tumors was assessed by immunohistochemistry using a p27 monoclonal antibody (Transduction Laboratories) following previously published methods (11).

Immunohistochemistry of primary breast cancers. Sections (4 µm) from formalin-fixed, paraffin-embedded blocks of 100 invasive breast cancers were subjected to immunohistochemistry as described previously (11). Akt, S473 P-Akt, and MAPK protein content was expressed as a Histo-score, which was calculated as a combination of intensity and percentage of antibody-stained cancer cells in 10 high-power fields: score = (% cells with weak staining) x1 + (% cells with medium staining) x2 + (% cells with high staining) x3. By this analysis, four groups were generated: negative, 1 to 100 (weak), 101 to 200 (medium), and >200 (intense). Tumors with p27 in both cytosol and nucleus were scored as cytosolic p27, whereas exclusive nuclear staining was scored as nuclear. A minimum of 1,000 cells were scored in each specimen.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
p27{Delta}NLS localizes exclusively in the cytosol. We sought to generate a mutant of p27 with exclusive cytosolic localization. p27 is phosphorylated in S10 by human kinase–interacting stathmin and this modification promotes its binding to exportin CRM1 (26, 27). Subsequently, in mid-G1 phase of the cell cycle, Akt has been shown to phosphorylate p27 in T157; this modification in the NLS of p27 inhibits complex formation with importin {alpha}, thus resulting in retention of p27 in the cytosol (8, 28). Therefore, we generated a phospho-mimicking mutant at S10 and T157 by replacing these two residues with aspartic acid (Flag-p27-DD). Similar to wild-type p27, p27-DD localized predominantly in the nucleus of COS7 cells (Fig. 1B), suggesting that phosphorylation at S10 and T157 are not sufficient for cytosolic retention. In a second mutant, we replaced the positive residues 152RKR and 165KR in the bipartite NLS with neutral hydrophobic residues ALA and LA, respectively (Fig. 1A). As measured by Flag immunofluorescence assay, p27{Delta}NLS in COS7 cells was exclusively cytosolic (Fig. 1B). Similar results were observed in MCF-7 (Fig. 2A) and 293T cells (Supplementary Fig. IA). Based on these data, we used p27{Delta}NLS in subsequent studies addressing the role of cytoplasmic p27.


Figure 1
View larger version (29K):
[in this window]
[in a new window]
 
Figure 1. Cellular localization of p27 mutants. A, schema showing site-specific mutagenesis of p27. In p27-DD, S10 and T157 residues were replaced with aspartic acid (D) to mimic phosphorylation. In p27{Delta}NLS, positive amino acids within the NLS of p27 were replaced with neutral hydrophobic residues. B, immunofluorescence assay showing subcellular localization of p27 wild-type and mutants in COS7 cells. Transfected p27 was visualized with Flag mAb and FITC-labeled anti-mouse IgG as described in Materials and Methods. Hoescht, nuclear staining. The p27{Delta}NLS mutant was completely cytoplasmic whereas p27-DD retained nuclear localization.

 

Figure 2
View larger version (46K):
[in this window]
[in a new window]
 
Figure 2. p27{Delta}NLS inhibits RhoA and adhesion and increases MCF-7 cell motility. A, Flag immunofluorescence assay of MCF-7 cells stably transduced with Flag-p27 and Flag-p27{Delta}NLS retroviral vectors also encoding GFP. GFP+ (transduced) cells were sorted by fluorescence-activated cell sorting before analysis. MCF7-vector cells contained pBMN-IRES-GFP alone. Hoechst, nuclear staining. B, Flag immunoblot of lysates from stably transduced MCF-7 cells. C, the GTP-bound form of RhoA and Rac1 were pulled down from the indicated cell lysates using GST-RBD and GST-PBD fusion proteins, respectively, each precoupled to agarose-glutathione beads. Eluates from the beads as well as total cell lysates were immunoblotted with RhoA and Rac1 antibodies. GST-RBD and GST-PBD were visualized by Ponceau staining to show equal loading. D, cell adhesion. After trypsinization and suspension in DMEM/10% FBS, cells were seeded on six-well plates and allowed to attach for 1, 2, and 4 hours at 37°C. Adherent cells were trypsinized, counted in a Coulter counter, and expressed as percentage of the total number of cells plated. Columns, mean of three wells; bars, SD. E, cell motility. Cells were seeded on 5 µm pore size transwell filters and allowed to migrate toward 0.1% or 10% FBS. After 20 hours, cells on the underside of the filters were fixed, stained, and counted as indicated in Materials and Methods. Columns, mean of three wells; bars, SD.

 
Cytosolic p27 down-regulates RhoA and cell adhesion but increases cell motility and survival. We stably transduced MCF-7 human breast cancer cells with retroviruses expressing wild-type and p27{Delta}NLS. Both ectopic proteins were expressed at equal levels but Flag immunofluorescence assay showed predominantly nuclear localization of wild-type p27 whereas p27{Delta}NLS was only detectable in the cytosol (Fig. 2A and B). MCF-7/p27 cells exhibited a reduced S and increased G1 phase fractions compared with vector controls. On the other hand, MCF-7/p27{Delta}NLS cells exhibited a cell cycle profile identical to control cells (Fig. 3A), supporting the absence of p27{Delta}NLS in the nucleus and, hence, its inability to inhibit Cdk2 and delay cell proliferation.


Figure 3
View larger version (48K):
[in this window]
[in a new window]
 
Figure 3. p27{Delta}NLS inhibits apoptosis without altering cell proliferation. A, DNA histograms of propidium iodide–labeled MCF-7 cells stably transduced with the indicated vectors. The percentage of gated cells in G1, S, and G2-M phases of the cell cycle are indicated. GFP+ (transduced) cells were sorted by fluorescence-activated cell sorting before analysis. Mean and SD values are representative of three independent experiments. B, similarly treated cells were subjected to APO-BrdUrd assay as indicated in Materials and Methods. Percent indicates the proportion of gated FITC+ apoptotic cells. C, subconfluent cell monolayers were maintained in serum-free medium for 72 hours and then washed and lysed in NP40 lysis buffer followed by SDS-PAGE and immunoblot analysis with the indicated antibodies.

 
Because p27 has been shown to inhibit RhoA activation and induce cell motility, we next examined if the cytosolic mutant was more potent than wild-type p27 on regulating these functions. RhoA activity was 15-fold lower in MCF-7/p27{Delta}NLS and 5-fold lower in MCF-7/p27 compared with vector controls. Rac activity did not change (Fig. 2C). This difference may reflect the increased availability of p27{Delta}NLS in the cytosol where it titrates RhoA. Similar results were obtained in 293T cells transfected with wild-type and {Delta}NLS p27 (Supplementary Fig. IC). Time-dependent adhesion was impaired by stable expression of cytosolic p27 with MCF-7/p27{Delta}NLS cells exhibiting a 40% reduction in adhesion at 4 hours compared with cells transfected with wild-type p27 or vector alone (Fig. 2D). p27{Delta}NLS-expressing MCF-7 cells exhibited a >3-fold increased migration through transwells toward 10% FBS compared with cells transduced with wild-type p27 (Fig. 2E). Similar results were obtained in wound closure assays with p27-null mouse embryonic fibroblasts. Fibroblasts transfected with p27{Delta}NLS migrated into and closed the wounded area within 20 hours whereas in monolayers of mouse embryonic fibroblasts transfected with wild-type p27 or vector alone the wound remained open (Supplementary Fig. IIB).

Despite their reduced adhesion, cells expressing p27{Delta}NLS did not display an impaired viability. Because cytoplasmic localization of p27 has been associated with anchorage-independent growth of tumor cells and more virulent tumor behavior (5), we speculated on an antiapoptotic effect of the cytosolic mutant. After 72 hours under serum-free conditions, there were 40% to 50% less MCF-7/p27{Delta}NLS apoptotic cells compared with cells transduced with wild-type p27 or vector alone (Fig. 3B). Immunoblot analysis of signaling molecules involved in cell survival showed marked up-regulation of total Akt, P-Akt, and P-GSK3ß in cells expressing the cytosolic mutant of p27. Total MAPK and P-MAPK did not change (Fig. 3C). Although to a lesser degree, similar results were obtained in COS7 cells transfected with the same vectors (Supplementary Fig. IIIA). Consistent with the cell cycle inhibitory effect of wild-type p27, MCF-7/p27 cells contained reduced PCNA levels compared with MCF-7/p27{Delta}NLS cells (Fig. 3C).

RNA interference of p27 inhibits tumor cell motility and survival. If cytosolic p27 exerts oncogenic functions, we hypothesized that elimination of endogenous p27 in cells with predominant expression of p27 in the cytosol will inhibit the transformed phenotype. On the other hand, in cells with p27 predominantly localized in the nucleus, where its Cdk-inhibitory and tumor suppressor functions are dominant, elimination of p27 would have an oncogenic effect. Therefore, we stably transduced a retroviral vector expressing short hairpin (sh) human or mouse (control) p27 RNAs in U87 and COS7 cells. U87 are PTEN-null human glioma cells with high levels of active phosphatidylinositol 3-kinase (PI3K) and Akt (29) and with >50% expression of p27 in the cytosol. COS7 are monkey kidney cells transformed with SV40 large T antigen and with >95% of p27 detectable in the nucleus even under logarithmic growth conditions (Fig. 4A). Cells expressing human p27 shRNAs (referred as knock-down or kd) but not mouse (control) p27 shRNAs exhibited variable levels of p27 down-regulation (Fig. 4B). U87 clone 7 and COS7 clone 10 were selected and expanded for further experiments.


Figure 4
View larger version (58K):
[in this window]
[in a new window]
 
Figure 4. Knockdown of p27 inhibits U87 cell motility. A, detection of endogenous p27 in U87 and COS7 cells by immunofluorescence assay using p27 mAb and Oregon green anti-mouse IgG. U87 cells exhibit >50% of p27 in the cytosol whereas COS7 cells express >95% of p27 in the nucleus. Hoechst, nuclear staining. B, puromycin-resistant single-cell colonies of U87 and COS7 cells transduced with human and mouse (control) p27shRNA retroviruses were expanded and subjected to p27 immunoblot. Clones 7 and 10 were selected for subsequent studies. C, cells were seeded on 5 µm pore size transwell filters and allowed to migrate toward 10% FBS. After 20 hours, cells on the underside of the filters were fixed, stained, and counted as indicated in Materials and Methods. Data are quantitated in bar graph at bottom. Columns, mean of three wells; bars, SD. D, GTP-bound RhoA in the indicated cell lysates was eluted from GST-RBD coupled to agarose-glutathione beads. Eluates were immunoblotted with a RhoA antibody (top). Middle graph, RhoA activity from three independent experiments quantitated by densitometry. Total cell lysates (50 µg/lane) were separated by SDS-PAGE and subjected to immunoblot analysis with RhoA, PCNA, and vinculin antibodies. E, focal adhesions were visualized with human vinculin (hVin-1) mAb and Oregon green anti-mouse IgG. Knockdown of p27 resulted in a reduction of focal adhesions (arrows) in U87 but not COS7 cells.

 
Cells were seeded on transwells and allowed to migrate toward 10% FBS. After 20 hours, the U87 hp27-kd cells showed markedly impaired motility compared with U87 mp27-kd and wild-type cells. In contrast, COS7 hp27-kd cell motility was minimally inhibited compared with controls (Fig. 4C). Consistent with inhibitory effect of cytosolic p27 on RhoA, U87 hp27-kd cells exhibited higher RhoA activity compared with controls but this was not observed in COS7 hp27-kd cells (Fig. 4D). The down-regulation of RhoA suggested an increase in cell adhesiveness. Indeed, U87 hp27-kd cells exhibited extensive staining with a vinculin antibody along the cell edge, whereas, in control cells, vinculin was mainly detectable at membrane ruffles and lamellipodia, suggestive of increased adhesion in knockdown cells. Conversely, COS7 hp27-kd cells exhibited the same pattern of vinculin staining than control cells (Fig. 4E). In all cells, vinculin content as measured by immunoblot was similar (Fig. 4D). Supporting a functional significance to these findings, time-dependent adhesion was increased in U87 hp27-kd cells with ≥90% of cells attached at 2 hours compared with <80% at 4 hours in both U87 m27-kd controls and wild-type cells (Supplementary Fig. IIIB).

RNA interference of p27 in U87 cells did not alter their cell cycle distribution (Fig. 5A). Opposite to this, knockdown of p27 in COS7 cells resulted in an approximate 50% reduction in cells in G1 and close to a doubling of the proportion of cells in S phase (Fig. 5A). Finally, we examined survival in U87 cells. By three different assays, APO-BRDU (TUNEL), DNA laddering in agarose gels, and trypan blue exclusion, a higher level of apoptosis was detectable in serum-starved U87 hp27-kd cells compared with controls (Fig. 5B and C). The proportion of apoptotic COS7 hp27-kd, COS7 mp27-kd, and vector controls was similar (data not shown). Finally, we compared three U87 clones (1, 3, and 7 in Fig. 4B) with different levels of p27 as a result of RNA interference. RhoA activity, total Akt, P-Akt, P-GSK3ß, migration through transwells, and survival under serum-free conditions were different than controls and this difference correlated with the endogenous level of p27 (Supplementary Fig. IV).


Figure 5
View larger version (39K):
[in this window]
[in a new window]
 
Figure 5. RNA interference of p27 inhibits U87 cell survival without altering cell cycle progression. A, DNA histograms of propidium iodide–labeled U87 and COS7 cells stably transduced with the indicated vectors. The percentage of gated cells in G1, S, and G2-M phases are indicated. Mean and SD values are representative of three independent experiments. B, cells (5 x 105 per well in six-well plates) were incubated in serum-free DMEM for 72 hours and then subjected to APO-BrdUrd assay as indicated in Materials and Methods. Percent indicates the proportion of (gated) FITC+ apoptotic cells. U87 cells transduced with the human p27 siRNA retrovirus exhibited a 3.5-fold greater proportion of apoptotic cells compared with controls. C, cells were incubated in serum-free DMEM for 72 hours. Adherent and floated cells were then pooled, their DNA was collected, and evaluated for evidence of internucleosomal fragmentation in 1.5% agarose gels as indicated in Materials and Methods. D, cells incubated in serum-free DMEM for 72 were stained with 0.2% trypan blue. Columns, mean percentage of trypan blue+ cells of three wells; bars, SD.

 
Cytosolic p27 stabilizes Akt. The effect of p27 knockdown on U87 cell survival and the up-regulation of Akt levels in MCF-7 cells transduced with p27{Delta}NLS (Fig. 3C) prompted us to examine Akt levels in U87 hp27-kd cells. In these cells, protein levels of total Akt, P-Akt, and P-GSK3ß were lower than in controls (Fig. 6A). Because p27 has been shown to couple to Akt (11), we next examined if the cytosolic mutant associated better than wild-type p27 with Akt. As determined by Flag immunoblot, precipitation of Akt in MCF-7 cells with a subsaturating concentration of Akt antibody pulled down a higher amount of Flag-tagged p27{Delta}NLS that wild-type p27 per the amount of precipitated Akt (Fig. 6B). Thus, we speculated that cytosolic p27 could stabilize Akt. Hence, we examined the turnover of metabolically labeled, newly synthesized endogenous Akt in U87 and MCF-7 cells. In U87 hp27-kd cells, the half-life of 35S-labeled Akt was <1 hour whereas in controls it was ~4 hours (Fig. 6C). Conversely, expression of p27{Delta}NLS in MCF-7 cells prolonged Akt half-life to ~8 hours compared with 1 to 2 hours in MCF-7/vector cells (Fig. 6D).


Figure 6
View larger version (51K):
[in this window]
[in a new window]
 
Figure 6. p27 binds to and stabilizes Akt protein. A, the indicated U87 cells were prepared in NP40 lysis buffer and subjected to immunoblot analysis for total and P-Akt and total and P-GSK3ß. B, MCF-7 cells (500 µg) were prepared in immunoprecipitation (IP) buffer and precipitated with an Akt antibody and protein A/G Sepharose beads. Immune complexes were divided in equal parts and subjected to SDS-PAGE followed by Flag and Akt immunoblot analyses (top two panels). Bottom, Flag immunoblot of cell lysates before immunoprecipitation. C, the indicated cell lines were pulse-labeled with 200 µCi/mL trans-35S-label in methionine/cysteine–free DMEM. After 30 minutes, serum was added and cells were harvested at variable times thereafter. Cell lysates were prepared and precipitated with an Akt antibody. 35S-labeled immune complexes were separated by SDS-PAGE and visualized by autoradiograpy (left). Right, radioactive bands were quantitated by densitometry and expressed as percentage of control (time 0).

 
Suppression of p27 impairs tumorigenicity. To examine the effect of p27 knockdown in U87 tumorigenicity, we implanted cells in athymic nude mice. All mice injected with parental cells (seven of seven) or with control cells transduced with mouse p27 shRNAs (seven of seven) developed tumors of ≥3 mm in minimal diameter. However, only three of eight (37%) mice injected with U87 hp27-kd cells formed palpable tumors within 15 days after tumor cell inoculation. Expression of p27 by immunohistochemistry was almost undetectable in U87 hp27-kd tumors arguing against loss of the shRNAs in vivo (Fig. 7E and F). U87 hp27-kd tumors were encapsulated and exhibited a lower histologic grade and volume as well as a higher degree of TUNEL+ apoptotic cells (Fig. 7B, D, H, and I; and Table 1). On the other hand, control tumors were larger, of high grade, locally invasive, and with significantly less TUNEL+ cells (Fig. 7A, C, G, and I; Table 1).


Figure 7
View larger version (65K):
[in this window]
[in a new window]
 
Figure 7. RNA interference of p27 inhibits tumor cell invasiveness and viability in vivo. A to D, H&E sections of U87-hp27 shRNA and U87-mp27 shRNA (control) xenografts. Xenografts in which p27 had been knocked down were encapsulated and contained more necrotic areas than control tumors. E to F, immunohistochemical detection of p27 as described in Materials and Methods. G to H, detection of TUNEL+ (apoptotic) cells in U87 tumor sections by immunohistochemistry. I, total number of TUNEL+ tumor cell nuclei in twenty x40 fields from a total of three individual tumor tissue sections per group (P < 0.05; Student's t test).

 

View this table:
[in this window]
[in a new window]
 
Table 1. U87 cell tumorigenicity

 
Cytosolic p27 correlates with total Akt content in primary breast cancers. Activated Akt phosphorylates p27 in T157 and T198, resulting in binding to 14.3.3. These modifications prevent p27 from binding to importin {alpha}, thus blocking nuclear import (28, 30, 31). Therefore, activated Akt has been shown to correlate with presence of p27 in tumor cell cytosol. This does not rule out the possibility that cytosolic p27 may, in turn, stabilize and correlate with total Akt protein levels. Thus, we subjected 100 primary breast cancers to immunohistochemistry using antibodies against p27 and total and S473 P-Akt. Tumors were divided in four groups (negative, weak, intermediate, and intense) according to the level of Akt and P-Akt expression. Only four specimens did not stain for p27. Only 26, 33, and 16 tumors were negative for Akt, P-Akt, and total MAPK, respectively. All levels of total Akt correlated linearly with the proportion of specimens expressing p27 in tumor cell cytosol (68.8%, 45.8%, 30%, and 0% in the intense, intermediate, weak, and negative Akt groups, respectively; P < 0.05, Pearson {chi}2). Conversely, levels of p42/44 MAPK (Erk) did not change as a function of presence of p27 in the cytosol (P > 0.05). Levels of P-Akt staining also correlated with presence of p27 in tumor cell cytosol, although this association was not as linear as with total Akt expression (Fig. 8).


Figure 8
View larger version (60K):
[in this window]
[in a new window]
 
Figure 8. Cytosolic p27 correlates with total Akt content in primary breast tumors. Sections from 100 primary breast carcinomas were subjected to immunohistochemistry to detect total Akt, S473 P-Akt, and p27 as described in Materials and Methods. Tumor I, invasive breast cancer with presence of p27 in both cytosol and nucleus and high content of total Akt and P-Akt. Tumor II, invasive breast cancer with p27 only detectable in tumor cell nuclei and no detectable total Akt and P-Akt. All levels of total Akt expression correlate linearly and statistically with detectable levels of cytosolic p27 (P < 0.05; Pearson {chi}2).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have examined the oncogenic effects of the tumor suppressor p27. A phospho-mimicking mutant of p27 in which S10 and T157 had been replaced with aspartic acid localized predominantly in the cell nucleus. Like for T157, Akt-dependent phosphorylation of T198 also results in cytoplasmic retention of p27 (31). Indeed, in Akt-transfected HEK293 cells, single T157A or T198A mutants of p27 localize in the cytoplasm, whereas a double p27 T157A/T198A mutant is completely resistant to Akt-mediated cytoplasmic relocalization (32). In agreement with these data, phosphorylation of both T157 and T198 have been shown to be required for binding 14.3.3, the anchor proteins that keep p27 in the cytoplasmic compartment (30, 31). These data suggest that T198 phosphorylation is required for cytoplasmic localization and potentially explain the inability of the p27 S10A/T157A mutant to be retained in the cytosol. However, p27{Delta}NLS, with neutral hydrophobic residues replacing positive residues in the NLS (Fig. 1), localized exclusively in the cytosol and increased motility and survival with no effect on cell cycle distribution. These data agree with a previous report by McAllister et al. (15), in which deletions or mutations in the COOH-terminal region of p27 affected cell migration but not cell cycle arrest. Further, a truncated form of p27 containing amino acids 1 to 103 binds Cdk2 and induces G1 arrest without affecting cell scattering or filopodia formation (14), implying that p27{Delta}NLS had not lost Cdk2 binding.

Multiple data suggest that partial loss and/or mislocalization of p27 is associated with enhanced transformation and, second, that complete loss of p27 might oppose proliferation and maintenance of the transformed phenotype. For example, homozygous deletions of the p27 gene are exceedingly rare in human cancers (3). Loss of a single allele of p27 confers increased susceptibility to carcinogen-induced lung, intestine, and pituitary tumors in mice (4) as well as tumors induced by oncogenes or by loss of tumor suppressor genes in genetically engineered mice (17, 33). In the latter group, tumors occurring in p27+/– mice exhibit higher levels of nuclear and/or total cyclin D1, consistent with the role of p27 in the assembly of cyclin D1/Cdk4 complexes and facilitation of cyclin D1 translocation to the nucleus (12, 34). Furthermore, the wild-type p27 allele is retained in the p27+/– tumors. Consistent with this, p27-null mammary glands display low proliferation, severely altered morphogenesis, and low cyclin D1 levels (13). A second study did not confirm these last findings although enhanced mammary gland apoptosis was observed during pregnancy (35). Finally, malignant behavior and cyclin D1 levels are inhibited in p27–/– transgenic tumors compared with tumors with wild-type p27 (17, 33). Taken together, these data suggest that cancers with low p27 levels or with p27 haploinsufficiency lack a selective pressure to lose p27 function completely, as this would result in loss of cyclin D1/Cdk4 function.

Cytoplasmic localization of p27 has been associated with anchorage-independent growth of tumor cells, higher tumor stage, and poor patient outcome in some cancer types (9, 3640). Oncogenic effects of cytoplasmic p27, other than cyclin D1/Cdk4 assembly, would further abrogate any selective pressure to eliminate p27 completely. Data presented herein with PTEN-mutant U87 glioma cells support an oncogenic role for cytoplasmic p27 in that its elimination by RNA interference resulted in reduced tumorigenicity, cancer cell viability, and invasiveness in vivo. Stable expression of h27 shRNAs, which should also interfere with nuclear p27 in these cells and hence increase growth, did not accelerate U87 cell proliferation. This results suggests that U87 cell proliferation might be under maximal stimulation by alternative signaling pathways that do not require p27-mediated inhibition of Cdk2. U87 cells in which p27 had been down-regulated exhibited lower levels of Akt, markedly shorter 35S-labeled Akt turnover, and increased apoptosis in vitro and in vivo. In MCF-7 cells, overexpression of p27{Delta}NLS increased Akt levels. Finally, expression of cytosolic p27 in primary breast carcinomas was highly correlated tightly with Akt content, further suggesting that the oncogenic effect of cytoplasmic p27 is mediated at least in part by stabilization of the prosurvival Akt kinase.

There are few other examples of a prosurvival role of p27. p27–/– mammary glands exhibit increased postlactational involution and apoptosis (13). Mouse mesangial cells and rat fibroblasts that are deficient in p27 undergo apoptosis upon serum starvation. In these cells, inhibition of Cdk2 protected these cells from apoptosis (41). In leukemic cells, proteolytic fragments of overexpressed p27 prevent apoptosis, possibly through inhibition of cytochrome c release (42). In experimental glomerulonephritis and in small-cell lung cancer cells, there is clear evidence that p27 protects against inflammatory injury and/or conditions of nutrient and oxygen deprivation (43, 44). Finally, in T98G glioma cells, down-regulation of both p27 and its ubiquitin ligase Skp2 using siRNA induces apoptosis (45). In patients with breast cancer, high levels of p27 are associated with axillary lymph node metastases and shorter survival (46, 47). High p27 expression has been reported in virtually all cases of small-cell lung cancer (43). Although these associations would seem to be paradoxical, it seems, from data shown in these reports, that the expression of p27 was not limited to tumor cell nuclei, thus raising the likely possibility of cytoplasmic p27 is present in the more metastatic tumors.

In COS7 cells with p27 predominantly in the nucleus, where its tumor suppressive and Cdk-inhibitory effects predominate, knockdown of p27 derepressed cell cycle progression without detectable induction of apoptosis. Thus, cytoplasmic p27 can be construed as a therapeutic target and/or a biomarker of aberrant PI3K/Akt signaling in human cancer cells. However, as suggested by the results with COS7 cells, therapeutic inhibition of nuclear p27 in cells with mostly nuclear expression of the Cdk inhibitor might accelerate tumor growth. Viral vector-mediated overexpression of p27 has been shown to induce cell cycle arrest and/or induce apoptosis of tumor cells in culture (4854). The purpose of this approach has been at least in part to restore Cdk inhibition in tumors with low p27 expression. Recent data as well as results presented herein suggest reexamination of reconstitution of p27 as a therapeutic strategy in cancer. First, it is unlikely that with current viral vector approaches, the transduction efficiency and levels of p27 observed in tumor cells in culture will be achieved in vivo. Second, Cdk2 has been found to be dispensable for tumor cell growth (55). Third, in cancer cells with aberrant oncogene signals that retain p27 in the cytosol, this strategy may amplify oncogenic functions of the "tumor suppressor" and be clinically counterproductive.


    Acknowledgments
 
Grant support: National Cancer Institute grant R01 CA80195 (C.L. Arteaga), Breast Cancer Specialized Program of Research Excellence grant P50 CA98131, and Vanderbilt-Ingram Cancer Center support grant P30 CA68485.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Jeremy Rotty, Jae Youn Yi, Shimian Qu, and Marta Guix for helpful discussions, and Teresa Dugger for administrative and technical support.


    Footnotes
 
Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/).

F.Y. Wu and S.E. Wang contributed equally to this work.

Received 9/14/05. Revised 11/21/05. Accepted 12/28/05.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Sherr CJ, Roberts JM. CDK inhibitors: positive and negative regulators of G1-phase progression. Genes Dev 1999;13:1501–12.[Free Full Text]
  2. Massague J. G1 cell-cycle control and cancer. Nature 2004;432:298–306.[CrossRef][Medline]
  3. Philipp-Staheli J, Payne SR, Kemp CJ. p27(Kip1): regulation and function of a haploinsufficient tumor suppressor and its misregulation in cancer. Exp Cell Res 2001;264:148–68.[CrossRef][Medline]
  4. Fero ML, Randel E, Gurley KE, Roberts JM, Kemp CJ. The murine gene p27Kip1 is haplo-insufficient for tumour suppression. Nature 1998;396:177–80.[CrossRef][Medline]
  5. Alkarain A, Jordan R, Slingerland J. p27 deregulation in breast cancer: prognostic significance and implications for therapy. J Mammary Gland Biol Neoplasia 2004;9:67–80.[CrossRef][Medline]
  6. Viglietto G, Motti ML, Fusco A. Understanding p27(kip1) deregulation in cancer: down-regulation or mislocalization. Cell Cycle 2002;1:394–400.[Medline]
  7. Bloom J, Pagano M. Deregulated degradation of the cdk inhibitor p27 and malignant transformation. Semin Cancer Biol 2003;13:41–7.[CrossRef][Medline]
  8. Boehm M, Yoshimoto T, Crook MF, et al. A growth factor-dependent nuclear kinase phosphorylates p27(Kip1) and regulates cell cycle progression. EMBO J 2002;21:3390–401.[CrossRef][Medline]
  9. Liang J, Zubovitz J, Petrocelli T, et al. PKB/Akt phosphorylates p27, impairs nuclear import of p27 and opposes p27-mediated G1 arrest. Nat Med 2002;8:1153–60.[CrossRef][Medline]
  10. Viglietto G, Motti ML, Bruni P, et al. Cytoplasmic relocalization and inhibition of the cyclin-dependent kinase inhibitor p27(Kip1) by PKB/Akt-mediated phosphorylation in breast cancer. Nat Med 2002;8:1136–44.[CrossRef][Medline]
  11. Shin I, Yakes FM, Rojo F, et al. PKB/Akt mediates cell-cycle progression by phosphorylation of p27(Kip1) at threonine 157 and modulation of its cellular localization. Nat Med 2002;8:1145–52.[CrossRef][Medline]
  12. Cheng M, Olivier P, Diehl JA, et al. The p21(Cip1) and p27(Kip1) CDK "inhibitors" are essential activators of cyclin D-dependent kinases in murine fibroblasts. EMBO J 1999;18:1571–83.[CrossRef][Medline]
  13. Muraoka RS, Lenferink AE, Simpson J, et al. Cyclin-dependent kinase inhibitor p27(Kip1) is required for mouse mammary gland morphogenesis and function. J Cell Biol 2001;153:917–32.[Abstract/Free Full Text]
  14. Nagahara H, Vocero-Akbani AM, Snyder EL, et al. Transduction of full-length TAT fusion proteins into mammalian cells: TAT-p27Kip1 induces cell migration. Nat Med 1998;4:1449–52.[CrossRef][Medline]
  15. McAllister SS, Becker-Hapak M, Pintucci G, Pagano M, Dowdy SF. Novel p27(kip1) C-terminal scatter domain mediates Rac-dependent cell migration independent of cell cycle arrest functions. Mol Cell Biol 2003;23:216–28.[Abstract/Free Full Text]
  16. Besson A, Gurian-West M, Schmidt A, Hall A, Roberts JM. p27Kip1 modulates cell migration through the regulation of RhoA activation. Genes Dev 2004;18:862–76.[Abstract/Free Full Text]
  17. Muraoka RS, Lenferink AE, Law B, et al. ErbB2/Neu-induced, cyclin D1-dependent transformation is accelerated in p27-haploinsufficient mammary epithelial cells but impaired in p27-null cells. Mol Cell Biol 2002;22:2204–19.[Abstract/Free Full Text]
  18. Grignani F, Kinsella T, Mencarelli A, et al. High-efficiency gene transfer and selection of human hematopoietic progenitor cells with a hybrid EBV/retroviral vector expressing the green fluorescence protein. Cancer Res 1998;58:14–9.[Abstract/Free Full Text]
  19. Oliff A, McKinney MD, Agranovsky O. Contribution of the gag and pol sequences to the leukemogenicity of Friend murine leukemia virus. J Virol 1985;54:864–8.[Abstract/Free Full Text]
  20. Brummelkamp TR, Bernards R, Agami R. A system for stable expression of short interfering RNAs in mammalian cells. Science 2002;296:550–3.[Abstract/Free Full Text]
  21. Wang SE, Wu FY, Shin I, Qu S, Arteaga CL. Transforming growth factor {ß} (TGF-{ß})-Smad target gene protein tyrosine phosphatase receptor type {kappa} is required for TGF-{ß} function. Mol Cell Biol 2005;25:4703–15.[Abstract/Free Full Text]
  22. Ueda Y, Wang S, Dumont N, Yi JY, Koh Y, Arteaga CL. Overexpression of HER2 (erbB2) in human breast epithelial cells unmasks transforming growth factor ß-induced cell motility. J Biol Chem 2004;279:24505–13.[Abstract/Free Full Text]
  23. Bakin AV, Rinehart C, Tomlinson AK, Arteaga CL. p38 mitogen-activated protein kinase is required for TGFß-mediated fibroblastic transdifferentiation and cell migration. J Cell Sci 2002;115:3193–206.[Abstract/Free Full Text]
  24. Dumont N, Bakin AV, Arteaga CL. Autocrine transforming growth factor-ß signaling mediates Smad-independent motility in human cancer cells. J Biol Chem 2003;278:3275–85.[Abstract/Free Full Text]
  25. Shin I, Bakin AV, Rodeck U, Brunet A, Arteaga CL. Transforming growth factor ß enhances epithelial cell survival via Akt-dependent regulation of FKHRL1. Mol Biol Cell 2001;12:3328–39.[Abstract/Free Full Text]
  26. Connor MK, Kotchetkov R, Cariou S, et al. CRM1/Ran-mediated nuclear export of p27(Kip1) involves a nuclear export signal and links p27 export and proteolysis. Mol Biol Cell 2003;14:201–13.[Abstract/Free Full Text]
  27. Ishida N, Kitagawa M, Hatakeyama S, Nakayama K. Phosphorylation at serine 10, a major phosphorylation site of p27(Kip1), increases its protein stability. J Biol Chem 2000;275:25146–54.[Abstract/Free Full Text]
  28. Shin I, Rotty J, Wu FY, Arteaga CL. Phosphorylation of p27Kip1 at Thr-157 interferes with its association with importin {alpha} during G1 and prevents nuclear re-entry. J Biol Chem 2005;280:6055–63.[Abstract/Free Full Text]
  29. Pore N, Liu S, Haas-Kogan DA, O'Rourke DM, Maity A. PTEN mutation and epidermal growth factor receptor activation regulate vascular endothelial growth factor (VEGF) mRNA expression in human glioblastoma cells by transactivating the proximal VEGF promoter. Cancer Res 2003;63:236–41.[Abstract/Free Full Text]
  30. Sekimoto T, Fukumoto M, Yoneda Y. 14-3-3 suppresses the nuclear localization of threonine 157-phosphorylated p27(Kip1). EMBO J 2004;23:1934–42.[CrossRef][Medline]
  31. Fujita N, Sato S, Katayama K, Tsuruo T. Akt-dependent phosphorylation of p27Kip1 promotes binding to 14-3-3 and cytoplasmic localization. J Biol Chem 2002;277:28706–13.[Abstract/Free Full Text]
  32. Motti ML, De Marco C, Califano D, Fusco A, Viglietto G. Akt-dependent T198 phosphorylation of cyclin-dependent kinase inhibitor p27kip1 in breast cancer. Cell Cycle 2004;3:1074–80.[Medline]
  33. Gao H, Ouyang X, Banach-Petrosky W, et al. A critical role for p27kip1 gene dosage in a mouse model of prostate carcinogenesis. Proc Natl Acad Sci U S A 2004;101:17204–9.[Abstract/Free Full Text]
  34. Cheng M, Sexl V, Sherr CJ, Roussel MF. Assembly of cyclin D-dependent kinase and titration of p27Kip1 regulated by mitogen-activated protein kinase kinase (MEK1). Proc Natl Acad Sci U S A 1998;95:1091–6.[Abstract/Free Full Text]
  35. Davison EA, Lee CS, Naylor MJ, et al. The cyclin-dependent kinase inhibitor p27 (Kip1) regulates both DNA synthesis and apoptosis in mammary epithelium but is not required for its functional development during pregnancy. Mol Endocrinol 2003;17:2436–47.[Abstract/Free Full Text]
  36. Orend G, Hunter T, Ruoslahti E. Cytoplasmic displacement of cyclin E-cdk2 inhibitors p21Cip1 and p27Kip1 in anchorage-independent cells. Oncogene 1998;16:2575–83.[CrossRef][Medline]
  37. Singh SP, Lipman J, Goldman H, et al. Loss or altered subcellular localization of p27 in Barrett's associated adenocarcinoma. Cancer Res 1998;58:1730–5.[Abstract/Free Full Text]
  38. Ciaparrone M, Yamamoto H, Yao Y, et al. Localization and expression of p27KIP1 in multistage colorectal carcinogenesis. Cancer Res 1998;58:114–22.[Abstract/Free Full Text]
  39. Soucek T, Yeung RS, Hengstschlager M. Inactivation of the cyclin-dependent kinase inhibitor p27 upon loss of the tuberous sclerosis complex gene-2. Proc Natl Acad Sci U S A 1998;95:15653–8.[Abstract/Free Full Text]
  40. Baldassarre G, Belletti B, Bruni P, et al. Overexpressed cyclin D3 contributes to retaining the growth inhibitor p27 in the cytoplasm of thyroid tumor cells. J Clin Invest 1999;104:865–74.[Medline]
  41. Hiromura K, Pippin JW, Fero ML, Roberts JM, Shankland SJ. Modulation of apoptosis by the cyclin-dependent kinase inhibitor p27(Kip1). J Clin Invest 1999;103:597–604.[Medline]
  42. Eymin B, Haugg M, Droin N, Sordet O, Dimanche-Boitrel MT, Solary E. p27Kip1 induces drug resistance by preventing apoptosis upstream of cytochrome c release and procaspase-3 activation in leukemic cells. Oncogene 1999;18:1411–8.[CrossRef][Medline]
  43. Masuda A, Osada H, Yatabe Y, et al. Protective function of p27(KIP1) against apoptosis in small cell lung cancer cells in unfavorable microenvironments. Am J Pathol 2001;158:87–96.[Abstract/Free Full Text]
  44. Ophascharoensuk V, Fero ML, Hughes J, Roberts JM, Shankland SJ. The cyclin-dependent kinase inhibitor p27Kip1 safeguards against inflammatory injury. Nat Med 1998;4:575–80.[CrossRef][Medline]
  45. Lee SH, McCormick F. Downregulation of Skp2 and p27/Kip1 synergistically induces apoptosis in T98G glioblastoma cells. J Mol Med 2005;83:296–307.[CrossRef][Medline]
  46. Kouvaraki M, Gorgoulis VG, Rassidakis GZ, et al. High expression levels of p27 correlate with lymph node status in a subset of advanced invasive breast carcinomas: relation to E-cadherin alterations, proliferative activity, and ploidy of the tumors. Cancer 2002;94:2454–65.[CrossRef][Medline]
  47. Barbareschi M, van Tinteren H, Mauri FA, et al. p27(kip1) expression in breast carcinomas: an immunohistochemical study on 512 patients with long-term follow-up. Int J Cancer 2000;89:236–41.[CrossRef][Medline]
  48. Katayose Y, Kim M, Rakkar AN, Li Z, Cowan KH, Seth P. Promoting apoptosis: a novel activity associated with the cyclin- dependent kinase inhibitor p27. Cancer Res 1997;57:5441–5.[Abstract/Free Full Text]
  49. Craig C, Wersto R, Kim M, et al. A recombinant adenovirus expressing p27Kip1 induces cell cycle arrest and loss of cyclin-Cdk activity in human breast cancer cells. Oncogene 1997;14:2283–9.[CrossRef][Medline]
  50. Zhang Q, Tian L, Mansouri A, Korapati AL, Johnson TJ, Claret FX. Inducible expression of a degradation-resistant form of p27Kip1 causes growth arrest and apoptosis in breast cancer cells. FEBS Lett 2005;579:3932–40.[CrossRef][Medline]
  51. Turturro F, Arnold MD, Frist AY, Seth P. Effects of adenovirus-mediated expression of p27Kip1, p21Waf1 and p16INK4A in cell lines derived from t(2;5) anaplastic large cell lymphoma and Hodgkin's disease. Leuk Lymphoma 2002;43:1323–8.[CrossRef][Medline]
  52. Katner AL, Gootam P, Hoang QB, Gnarra JR, Rayford W. A recombinant adenovirus expressing p7(Kip1) induces cell cycle arrest and apoptosis in human 786-0 renal carcinoma cells. J Urol 2002;168:766–73.[CrossRef][Medline]
  53. Katner AL, Hoang QB, Gootam P, et al. Induction of cell cycle arrest and apoptosis in human prostate carcinoma cells by a recombinant adenovirus expressing p27(Kip1). Prostate 2002;53:77–87.[CrossRef][Medline]
  54. Naruse I, Hoshino H, Dobashi K, Minato K, Saito R, Mori M. Over-expression of p27kip1 induces growth arrest and apoptosis mediated by changes of pRb expression in lung cancer cell lines. Int J Cancer 2000;88:377–83.[CrossRef][Medline]
  55. Tetsu O, McCormick F. Proliferation of cancer cells despite CDK2 inhibition. Cancer Cell 2003;3:233–45.[CrossRef][Medline]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
D. Hoshino, T. Tomari, M. Nagano, N. Koshikawa, and M. Seiki
A Novel Protein Associated with Membrane-type 1 Matrix Metalloproteinase Binds p27kip1 and Regulates RhoA Activation, Actin Remodeling, and Matrigel Invasion
J. Biol. Chem., October 2, 2009; 284(40): 27315 - 27326.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. D. Larrea, F. Hong, S. A. Wander, T. G. da Silva, D. Helfman, D. Lannigan, J. A. Smith, and J. M. Slingerland
RSK1 drives p27Kip1 phosphorylation at T198 to promote RhoA inhibition and increase cell motility
PNAS, June 9, 2009; 106(23): 9268 - 9273.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. Kazi, A. Carie, M. A. Blaskovich, C. Bucher, V. Thai, S. Moulder, H. Peng, D. Carrico, E. Pusateri, W. J. Pledger, et al.
Blockade of Protein Geranylgeranylation Inhibits Cdk2-Dependent p27Kip1 Phosphorylation on Thr187 and Accumulates p27Kip1 in the Nucleus: Implications for Breast Cancer Therapy
Mol. Cell. Biol., April 15, 2009; 29(8): 2254 - 2263.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
X. Li, X. Tang, B. Jablonska, A. Aguirre, V. Gallo, and M. B. Luskin
p27KIP1 Regulates Neurogenesis in the Rostral Migratory Stream and Olfactory Bulb of the Postnatal Mouse
J. Neurosci., March 4, 2009; 29(9): 2902 - 2914.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. E. Wang, B. Xiang, R. Zent, V. Quaranta, A. Pozzi, and C. L. Arteaga
Transforming Growth Factor {beta} Induces Clustering of HER2 and Integrins by Activating Src-Focal Adhesion Kinase and Receptor Association to the Cytoskeleton
Cancer Res., January 15, 2009; 69(2): 475 - 482.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
J. Kim, E. Jonasch, A. Alexander, J. D. Short, S. Cai, S. Wen, D. Tsavachidou, P. Tamboli, B. A. Czerniak, K. A. Do, et al.
Cytoplasmic Sequestration of p27 via AKT Phosphorylation in Renal Cell Carcinoma
Clin. Cancer Res., January 1, 2009; 15(1): 81 - 90.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. D. Larrea, J. Liang, T. Da Silva, F. Hong, S. H. Shao, K. Han, D. Dumont, and J. M. Slingerland
Phosphorylation of p27Kip1 Regulates Assembly and Activation of Cyclin D1-Cdk4
Mol. Cell. Biol., October 15, 2008; 28(20): 6462 - 6472.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. E. Wang, B. Xiang, M. Guix, M. G. Olivares, J. Parker, C. H. Chung, A. Pandiella, and C. L. Arteaga
Transforming Growth Factor {beta} Engages TACE and ErbB3 To Activate Phosphatidylinositol-3 Kinase/Akt in ErbB2-Overexpressing Breast Cancer and Desensitizes Cells to Trastuzumab
Mol. Cell. Biol., September 15, 2008; 28(18): 5605 - 5620.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. D. Short, K. D. Houston, R. Dere, S.-L. Cai, J. Kim, C. L. Johnson, R. R. Broaddus, J. Shen, S. Miyamoto, F. Tamanoi, et al.
AMP-Activated Protein Kinase Signaling Results in Cytoplasmic Sequestration of p27
Cancer Res., August 15, 2008; 68(16): 6496 - 6506.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J.-Y. Lee, K.-S. Jang, D.-H. Shin, M.-Y. Oh, H.-J. Kim, Y. Kim, and G. Kong
Mel-18 Negatively Regulates INK4a/ARF-Independent Cell Cycle Progression via Akt Inactivation in Breast Cancer
Cancer Res., June 1, 2008; 68(11): 4201 - 4209.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
M. Schiappacassi, F. Lovat, V. Canzonieri, B. Belletti, S. Berton, D. Di Stefano, A. Vecchione, A. Colombatti, and G. Baldassarre
p27Kip1 expression inhibits glioblastoma growth, invasion, and tumor-induced neoangiogenesis
Mol. Cancer Ther., May 1, 2008; 7(5): 1164 - 1175.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Y. Yuan, L. Qin, D. Liu, R.-C. Wu, P. Mussi, S. Zhou, Z. Songyang, and J. Xu
Genetic Screening Reveals an Essential Role of p27kip1 in Restriction of Breast Cancer Progression
Cancer Res., September 1, 2007; 67(17): 8032 - 8042.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
P. Sicinski, S. Zacharek, and C. Kim
Duality of p27Kip1 function in tumorigenesis
Genes & Dev., July 15, 2007; 21(14): 1703 - 1706.
[Full Text] [PDF]


Home page
Genes Dev.Home page
A. Besson, H. C. Hwang, S. Cicero, S. L. Donovan, M. Gurian-West, D. Johnson, B. E. Clurman, M. A. Dyer, and J. M. Roberts
Discovery of an oncogenic activity in p27Kip1 that causes stem cell expansion and a multiple tumor phenotype
Genes & Dev., July 15, 2007; 21(14): 1731 - 1746.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. Shinohara, Y. J. Chung, M. Saji, and M. D. Ringel
AKT in Thyroid Tumorigenesis and Progression
Endocrinology, March 1, 2007; 148(3): 942 - 947.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Z. Li, X. Jiao, C. Wang, X. Ju, Y. Lu, L. Yuan, M. P. Lisanti, S. Katiyar, and R. G. Pestell
Cyclin D1 Induction of Cellular Migration Requires p27KIP1.
Cancer Res., October 15, 2006; 66(20): 9986 - 9994.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wu, F. Y.
Right arrow Articles by Arteaga, C. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wu, F. Y.
Right arrow Articles by Arteaga, C. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online