Cancer Research Annual Meeting 2010  2010 Workshops
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Amin, D. N.
Right arrow Articles by Klagsbrun, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Amin, D. N.
Right arrow Articles by Klagsbrun, M.
[Cancer Research 66, 2173-2180, February 15, 2006]
© 2006 American Association for Cancer Research


Cell, Tumor, and Stem Cell Biology

Tumor Endothelial Cells Express Epidermal Growth Factor Receptor (EGFR) but not ErbB3 and Are Responsive to EGF and to EGFR Kinase Inhibitors

Dhara N. Amin1,2, Kyoko Hida1,2, Diane R. Bielenberg1,2 and Michael Klagsbrun1,2,3

1 Vascular Biology Program and Departments of 2 Surgery and 3 Pathology, Children's Hospital and Harvard Medical School, Boston, Massachusetts

Requests for reprints: Michael Klagsbrun, Children's Hospital, 1 Blackfan Circle, Karp Family Research Building, Boston, MA 02115. Phone: 617-919-2157; Fax: 617-730-0233; E-mail: michael.klagsbrun{at}childrens.harvard.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Epidermal growth factor (EGF) receptor family members are expressed by tumor cells and contribute to tumor progression. The expression and activity of EGF receptors in endothelial cells are less well characterized. Analysis of tumor-derived endothelial cells showed that they express EGFR, ErbB2, and ErbB4, whereas their normal counterparts express ErbB2, ErbB3, and ErbB4. The gain in expression of EGFR and the loss of ErbB3 expression in tumor vasculature was also observed in vivo. As a consequence of their expressing EGFR, tumor endothelial cells responded to EGF and other EGF family members by activating both EGFR and ErbB2, by activating the downstream mitogen-activated protein kinase pathway, and by enhanced proliferation. On the other hand, normal endothelial cells did not respond to EGF but instead were responsive to neuregulin (NRG), a ligand for ErbB3 and ErbB4. NRG activated ErbB3 in normal endothelial cells and inhibited growth of these cells. In contrast, tumor endothelial cells, which do not express ErbB3, were not growth inhibited by NRG. Furthermore, due to their expression of EGFR, tumor endothelial cells, unlike normal endothelial cells, are direct targets for EGFR kinase inhibitors. These low-molecular-weight compounds block EGF-induced EGFR activation and proliferation of tumor endothelial cells. These results suggest that a gain of EGF-induced endothelial cell proliferation, and loss of NRG-induced growth inhibition in tumor endothelial cells constitutes a switch that promotes tumor angiogenesis. In addition, these results suggest that EGFR kinase inhibitors may be effective for antiangiogenesis therapy by specifically targeting the tumor, but not the normal, vasculature. (Cancer Res 2006; 66(4): 2173-80)


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The epidermal growth factor (EGF) family of type I receptor tyrosine kinases consists of four members: EGFR/ErbB1/HER, ErbB2/Neu/HER2, ErbB3/HER3, and ErbB4/HER4 (1, 2). These receptors are activated by ligands belonging to the EGF family of polypeptide growth factors. The ligands can be divided into four groups based on their binding specificity for the four receptors (1, 2). EGF, transforming growth factor-{alpha} (TGF-{alpha}), and amphiregulin bind only to EGFR. Heparin binding–EGF-like growth factor (HB-EGF), betacellulin, and epiregulin bind to both EGFR and ErbB4. Neuregulin (NRG) 1 and NRG2 bind to both ErbB3 and ErbB4, whereas NRG3 and NRG4 bind to ErbB4 alone. Ligand binding induces receptor homodimerization and heterodimerization (3). Dimerization of the EGF receptors increases their intrinsic tyrosine kinase activity resulting in receptor autophosphorylation. The phosphotyrosine sites recruit downstream adaptor and signaling proteins, thus initiating signaling cascades, including mitogen-activated protein kinase (MAPK), phosphatidylinositol 3-kinase, and protein kinase C, in the cytoplasm (3). Signaling initiated by the EGF receptors affects cell proliferation, differentiation, adhesion, apoptosis, and migration (2).

EGF receptor family members are important in the etiology of numerous tumors, including those of the breast, ovary, lung, colon, nervous system, head and neck, prostate, and pancreas (2). Amplification of EGFR and ERBB2, and subsequent overexpression of the protein, is observed in 20% to 30% of breast tumors and is associated with poor patient prognosis (4). In contrast, melanomas express low to intermediate levels of EGFR (5). The EGF receptor family members, especially EGFR and ErbB2, are targets of anticancer therapeutics and some are already approved by the Food and Drug Administration and are in the clinic (6, 7). Herceptin (Trastuzumab, Genentech, South San Francisco, CA) is a monoclonal antibody (mAb) against ErbB2 administered to advanced-stage breast cancer patients, whereas Erbitux (Cetuximab, ImClone, New York, NY), a mAb against EGFR, is approved for treatment of colon carcinomas. Iressa (Gefitinib, AstraZeneca, Wilmington, DE) and Tarceva (Erlonitib, Genentech) are small-molecule kinase inhibitors of EGFR that are approved for treating non–small cell lung cancer patients.

Despite the success of EGF receptor therapeutics in the clinic, the potential of these drugs as antiangiogenic therapy has not been fully considered because it is assumed that these drugs target the receptors on the tumor cells exclusively. However, anti-EGFR and anti-ErbB2 drug treatments, which result in decreased tumor growth in xenograft models, are characterized by reduced microvascular density and increased endothelial cell apoptosis (8, 9). The antiangiogenic effects of anti-EGF receptor drugs are typically thought to work through the inhibition of vascular endothelial growth factor (VEGF) synthesis by the tumor cells (10). VEGF, a proangiogenic factor, stimulates endothelial cell survival, proliferation, and migration (11). Another possibility is that these drugs target the endothelium directly (12).

Our laboratory has recently described the isolation of tumor-associated endothelial cells from xenografts of human melanomas and liposarcomas in nude mice (13). Normal endothelial cells derived from mouse skin and epidydimal fat pads were also isolated. The tumor endothelial cells differed from normal endothelial cells by displaying cytogenetic abnormalities (13). In addition, tumor endothelial cells showed enhanced responsiveness to growth factors, such as EGF, suggesting possible alterations in receptor expression. Therefore, we evaluated the expression of the EGF receptor family members in tumor endothelial cells and normal endothelial cells.

Tumor cell expression of EGF receptors, such as EGFR and ErbB2, has been extensively analyzed (2). However, EGF receptor expression by endothelial cells is less well studied. In fact, it has been established that endothelial cells typically do not express EGFR and are not responsive to EGF (14). In this report, we examined the EGF receptor profile in tumor endothelial cells and compared it with normal endothelial cells both in vitro and in vivo. Tumor endothelial cells express EGFR but not ErbB3, the opposite of normal endothelial cells. ErbB2 and ErbB4 levels were not affected. Furthermore, these altered expression profiles could be shown in vivo as well. The alterations in EGF receptor expression profiles had at least two major consequences. First of all, EGF stimulated proliferation of tumor endothelial cells, which express EGFR, but not of normal endothelial cells, which do not. On the other hand, neuregulin inhibited normal endothelial cells but not tumor endothelial cell proliferation. Second, tumor, but not normal, endothelial cells incubated with EGF family ligands were now sensitive to the growth inhibitory effects of EGFR kinase inhibitors. These results suggest that anti-EGFR drugs might specifically target the tumor vasculature.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell lines and reagents used. Isolation and characterization of melanoma, liposarcoma, skin, and adipose endothelial cells and their culture conditions have been described previously (13). Human umbilical vein endothelial cells (HUVEC) and human microvascular endothelial cells (HMVEC) were purchased from Cambrex BioScience (Walkersville MD) and grown in EGM2 medium (Cambrex BioScience) at 5% CO2. SV40 T antigen immortalized MS1 murine endothelial cell line (generous gift from Dr. Jack Arbiser, Emory University, Atlanta, GA) and MDA-MB-231 human breast carcinoma cells (purchased from American Type Culture Collection, Manassas, VA) were cultured in DMEM (Life Technologies, Rockville, MD) supplemented with 10% fetal bovine serum (FBS, Life Technologies) at 5% CO2. The melanoma cell line A375SM (generous gift from Dr. Isaiah Fidler, M.D. Anderson Cancer Center, Houston, TX) was cultured at 10% CO2 in MEM (Life Technologies) containing 10% FBS.

Isolation of breast carcinoma–derived endothelial cells. A375SM melanoma xenografts in nude mice were obtained as described previously (13). MDA-MB-231 xenografts in female nude mice (8-10 weeks old, Charles River, Wilmington, MA) were obtained by injecting MDA-MB-231 tumor cells (2 x 106 per mouse) with 1:1 volume of Matrigel (BD Biosciences, Bedford, MA) s.c. into the dorsal lateral flank. All of the animal procedures were done in compliance with Children's Hospital Boston guidelines and approved by the Institutional Animal Care and Use Committee. When tumors reached ~1 cm in diameter, they were excised. Isolation of endothelial cells was done as previously described using FITC-antimouse CD31 antibody (PharMingen, Boston MA) and magnetic cell sorting system (13). After subculture in the presence of diphtheria toxin to kill any remaining human tumor cells (15), the isolated cells were subjected to a second round of purification using FITC-BS1-B4 lectin magnetic cell sorting (Miltenyi Biotec, Auburn, CA). The cells were cultured in EGM2-MV medium (Cambrex BioScience) and purity was determined as described previously (13).

Immunoprecipitation and Western blotting. Before growth factor stimulations, cells were cultured in serum-free medium for 24 hours and incubated for 10 minutes at room temperature with EGF, HB-EGF, TGF{alpha}, Betacellulin (100 ng/mL; R&D Systems, Minneapolis, MN) or NRG1-ß1 extracellular domain (50 ng/mL; R&D Systems). Cells were also treated with the EGFR kinase inhibitor, AG1478 (Calbiochem, San Diego, CA), 15 minutes before growth factor stimulation. Immunoprecipitation and Western blotting were done as previously described (16). The antibodies used for immunoprecipitation and Western blotting of ErbB1-4 were SC-03, SC-284, SC-285, and SC-283, respectively (Santa Cruz Biotechnology, Santa Cruz, CA). Receptor phosphorylation was detected using antiphosphotyrosine antibody (mAb 4G10; Upstate, Lake Placid, NY). Analysis of phosphorylated EGFR (p-EGFR) on lysates was done using phosphorylated 1068 (p-1068) EGFR (Cell Signaling Technologies, Beverly MA). In addition, antibodies to glyceraldehyde-3-phosphate dehydrogenase (GAPDH; Chemicon, Temecula, CA), ß-actin (Sigma-Aldrich, St. Louis, MO), p-Erk1/2 (New England Biolabs, Beverly MA), and Erk1 (Santa Cruz Biotechnology) were purchased.

Fluorescence-activated cell sorting. Indirect immunofluorescense to detect EGFR and ErbB3 expression was carried out in 1% paraformaldehyde-fixed cells that were permeabilized with methanol. Permeabilization was required because the antibodies recognized cytoplasmic regions of the receptors. Cells were incubated at 4°C for 1 hour with anti-EGFR (SC-03) and anti-ErbB3 (SC-285) antibodies (Santa Cruz Biotechnology) followed by incubation with anti-rabbit Alexa 488 secondary antibody (Molecular Probes, Eugene, OR) for 1 hour at 4°C. At least 10,000 cells per sample were analyzed on a fluorescence-activated cell sorting (FACS) VantageSE flow cytometer using the Cell Quest software (Becton Dickinson, San Jose, CA).

3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay. Cells (4 x 103) were plated in triplicates into 96-well plates and were allowed to adhere overnight. The cells were then switched to serum-free medium containing growth factors and/or AG1478 at indicated concentrations. Cells were cultured for 72 hours and cell viability was determined by addition of 0.42 mg/mL of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) reagent (Sigma-Aldrich) for 4 hours before harvesting. Medium was removed and cells were solubilized in DMSO and absorbance was measured at 570 nm. The averages of the triplicates were calculated and cell proliferation was determined as the percentage of absorbance of treated cells to the untreated cells. All the experiments were done at least twice.

Reverse transcription-PCR. Total cellular RNA was isolated using the RNeasy miniprep kit with on-column DNase treatment as per the protocol of the manufacturer (Qiagen, Valencia, CA). Reverse transcription and amplification were done as previously described using 31 amplification cycles (13). The primers used were ACCACAGTCCATGCCATCAC and TCCACCACCCTGTTGCTGTA (GAPDH), AAAATGGTCCCCTCGGCT and TCTGGGCTCTTCAGACCA (TGF-{alpha}), TGCGGGACCATGAAGCT and TCTCAGTGGGAATTAGTCA (HB-EGF), TGTCCCCTGTCCCACGAT and AGCCTTGCTCTGTGCCCA (EGF).

Immunofluorescent staining. Cryosections (8-10 µm), embedded in OCT compound (Tissue-Tek, Torrance CA), were obtained from A375SM and MDA-MB-231 tumor xenografts and skin of nude mice (13), which were then fixed in acetone followed by acetone/chloroform (1:1, v/v). The sections were further treated with methanol for 5 minutes followed by incubation with 5% normal donkey serum (Jackson Immunoresearch, Westgrove, PA) for 30 minutes before staining. CD31 was detected using antimouse CD31 (PharMingen) and antirat phycoerythrin antibodies (Jackson Immunoresearch). EGFRs were detected using anti-EGFR (Cell Signaling Technology), anti-p-1068 EGFR (Cell Signaling Technology), and anti-ErbB3 (SC-285, Santa Cruz) with antirabbit FITC antibodies (Jackson Immunoresearch). Nuclei were stained with Hoechst 33258 (Sigma-Aldrich).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The EGF receptor family is differentially expressed in tumor versus normal endothelial cells. The distribution of the four EGF receptors in normal endothelial cells compared with tumor endothelial cells (purified from A375SM melanoma xenografts and devoid of human tumor cells) was investigated by Western blotting (Fig. 1A). The tumor endothelial cells showed high expression of EGFR but undetectable levels of ErbB3, whereas their normal counterpart, skin endothelial cells, showed the opposite expression pattern (Fig. 1A). On the other hand, the other two EGF receptor family members, ErbB2 and ErbB4, did not show significant differences in expression between tumor and skin endothelial cells (Fig. 1A).


Figure 1
View larger version (41K):
[in this window]
[in a new window]
 
Figure 1. Comparative expression of the EGF receptor family in melanoma and skin endothelial cells. A, A375SM melanoma (Tumor) endothelial cells and mouse skin endothelial cells were analyzed by Western blotting for the expression of the four EGF receptor family members. B, Western blotting for EGFR expression in A375SM tumor endothelial cells (lane 3) and nontumor-derived normal endothelial cells, including skin, adipose, MS1 (transformed mouse endothelial cells), HUV, and HMV endothelial cells (lanes 4-8). EGFR expression was also analyzed in A375SM melanoma (lane 1) and MDA-MB-231 breast carcinoma (lane 2) tumor cells. ß-Actin blotting was done as a loading control. C, FACS analysis of EGFR (black) in tumor endothelial cells is shown compared with rabbit IgG control (gray). D, FACS analysis of ErbB3 (black) in skin endothelial cells was carried out with rabbit IgG (gray) used as a control.

 
Expression of EGFR seemed to be specific for tumor endothelial cells because a number of endothelial cell lines derived from normal mouse and human tissue did not express EGFR (Fig. 1B, compare lanes 4-8 with lane 3). EGFR expression in the tumor cells themselves was variable. MDA-MB-231 breast tumor cells expressed EGFR (Fig. 1B, lane 2), whereas A375SM melanoma tumor cells did not express detectable EGFR (Fig. 1B, lane 1). Thus, in A375SM tumors, the tumor endothelial cells might be the major source of EGFR in the tumor. FACS analysis showed that 53% of tumor endothelial cells were positive for EGFR staining compared with IgG antibody control (Fig. 1C), whereas ErbB3 was expressed in 79% of skin endothelial cells (Fig. 1D).

EGF activates EGFR and ErbB2 in tumor but not normal endothelial cells. The EGFR expression profile suggests that tumor, but not normal, endothelial cells would be activated in response to EGF or any EGFR ligand. EGF stimulation of tumor endothelial cells after serum starvation induced a robust increase in EGFR phosphorylation (Fig. 2A compare lane 1 with lane 2). As expected, skin endothelial cells, which did not express EGFR, did not show any inducible EGFR phosphorylation (Fig. 2A, compare lane 3 with lane 4). EGF receptors form heterodimers, with ErbB2 being the preferred dimerization partner (17). ErbB2, which does not bind directly to any known ligands, can be activated by heterodimerizing with ligand-bound EGFR. As might be expected from these considerations, addition of EGF increased ErbB2 phosphorylation (p-ErbB2) in tumor endothelial cells (Fig. 2A, lane 2) but not skin endothelial cells (Fig. 2A, lane 4). Activation of the EGFR:ErbB2 complex in the presence of EGF was accompanied by an increase in phosphorylated Erk1/2 (p-Erk1/2) levels, indicating that receptor activation was able to couple to the MAPK signaling cascade (Fig. 2A).


Figure 2
View larger version (65K):
[in this window]
[in a new window]
 
Figure 2. Activation of EGFR and ErbB2 in tumor endothelial cells. A, serum-starved melanoma and skin endothelial cells were stimulated with (+) or without (–) EGF. EGFR and ErbB2 phosphorylation (p-EGFR and p-ErbB2) was detected by immunoprecipitation of the receptors followed Western blotting with antiphosphotyrosine antibody and total ErbB2 was immunoblotted with the same antibody used for the immunoprecipitation. The same lysates were analyzed by Western blotting for p-Erk1/2 and blots were stripped and reprobed for Erk1/2 as a loading control. B, liposarcoma endothelial cells (Liposarc) and MDA-MB-231 breast carcinoma endothelial cells (Breast Ca) were treated with or without EGF. EGFR, ErbB2, and Erk1/2 phosphorylation was detected as in (A). C, serum-starved A375SM tumor endothelial cells (Tumor-EC, lanes 1-6) and skin endothelial cells (Skin-EC, lanes 7-12) were stimulated for 10 minutes at room temperature with EGF, TGF-{alpha}, HB-EGF, betacellulin, NRG1ß (100 ng/mL of each growth factor), or vehicle (Mock) as indicated. EGFR activation was determined by immunoprecipitation with EGFR antibody followed by Western blotting with phosphotyrosine antibody. The same lysates were analyzed by Western blotting for EGFR and Erk1/2 as loading controls. Note that endocytosis of EGFR occurs on ligand activation (lanes 2-5). D, reverse transcription-PCR was done to detect EGF, TGF-{alpha}, and HB-EGF transcripts in A375SM (Melanoma) and MDA-MB-231 (Breast cancer) tumor cells. GAPDH was amplified as a control.

 
Besides A375SM melanoma endothelial cells, EGF induced EGFR tyrosine phosphorylation and subsequent MAPK activation in liposarcoma endothelial cells and in MDA-MB-231 breast carcinoma endothelial cells (Fig. 2B, compare lane 1 with lane 2 and lane 3 with lane 4). ErbB2 was also activated in response to EGF in breast carcinoma and liposarcoma endothelial cells (Fig. 2B, compare lane 1 with lane 2 and lane 3 with lane 4).

EGF was not the only activator of EGFR in tumor endothelial cells. The EGFR ligands TGF-{alpha}, HB-EGF, and betacellulin at 100 ng/mL each also promoted EGFR activation in tumor endothelial cells (Fig. 2C, compare lanes 2-5 with lane 1). As expected, none of these EGF family ligands activated EGFR in normal skin endothelial cells (Fig. 2C, compare lanes 8-12 with lane 7). In contrast, NRG1ß, a ligand for ErbB3 and ErbB4, but not EGFR, was not able to activate EGFR in tumor endothelial cells (Fig. 2C, compare lane 6 with lane 1). EGFR ligands, including TGF-{alpha}, EGF, and HB-EGF, were expressed in A375SM and MDA-MB-231 tumor cells (Fig. 2D), suggesting that paracrine interactions between the tumor cells and the tumor vasculature could occur.

EGF stimulates tumor endothelial cell proliferation, which is inhibited by an EGFR kinase inhibitor. EGF induced a dose-dependent increase in cell proliferation in tumor endothelial cells as measured by MTT assay (Fig. 3A). EGF also increased thymidine incorporation into DNA in tumor endothelial cells, a measure of cell proliferation (data not shown). A 2.5-fold increase in cell proliferation was observed at a dose of 20 ng/mL of EGF. Hence, EGFR activation is sufficient for stimulating proliferation of tumor endothelial cells. In contrast, skin endothelial cells did not respond to EGF (Fig. 3A).


Figure 3
View larger version (25K):
[in this window]
[in a new window]
 
Figure 3. Proliferation of tumor endothelial cells in response to EGF and inhibition by the AG1478 EGFR kinase inhibitor. A, MTT assay to detect proliferating viable cells in response to EGF in tumor ({blacklozenge}) and skin endothelial cells (Figure 3) was done. Points, absorbance by EGF-treated to non-EGF-treated cells shown as percentage proliferation; bars, SE. B, serum-starved cells were pretreated with the indicated concentrations of AG1478 followed by EGF (100 ng/mL) treatment. EGFR phosphorylation was analyzed by Western blotting with p-1068 EGFR antibody. Blots were stripped and reprobed with EGFR to show equal loading. C, MTT assay was done to detect proliferating cells in response to increasing concentration of EGF in absence or presence of 1 µmol/L AG1478. Cell proliferation was analyzed by MTT as in (A). {blacklozenge}, tumor endothelial cells; {blacktriangleup}, tumor endothelial cells with AG1478; Figure 3, skin endothelial cells.

 
AG1478 is a small-molecule kinase inhibitor with a high specificity for EGFR (18). AG1478 inhibited EGF-induced phosphorylation of EGFR in tumor endothelial cells in a dose-dependent manner (Fig. 3B, compare lanes 3-6 with lane 2) but had no effect on skin endothelial cells (Fig. 3B, lanes 7-12). AG1478 at 1 µmol/L was sufficient to completely inhibit the dose-dependent increase in tumor endothelial cell proliferation in response to EGF (Fig. 3C). Iressa (Gefitinib, ZD1839), another EGFR kinase inhibitor, was also able to inhibit EGFR tyrosine phosphorylation and inhibit EGF-induced tumor endothelial cell proliferation (data not shown).

Expression of EGFR, but not ErbB3, in tumor endothelial cells in vivo. Immunofluorescent staining of EGFR expression in tumor tissue sections was done to eliminate the possibility that the EGFR expression in tumor endothelial cells was an artifact of cell culture conditions. Tumors were obtained from s.c. injections of A375SM melanoma cells (Fig. 4A, B, and E) and MDA-MB-231 breast carcinoma cells (Fig. 4C) in athymic mice. These parental tumors were the same ones used to isolate the tumor endothelial cells described in Figs. 1 and 2. Mouse skin sections were also analyzed (Fig. 4D and F). Frozen sections (8-10 µm) were double immunolabeled for CD31, a marker for endothelial cells (red fluorescence), and for EGFR/p-EGFR/ErbB3 (green fluorescence). Colocalization was observed in the merged images (yellow). In melanoma, EGFR (Fig. 4A, left) and CD31-positive blood vessels (Fig. 4A, center) colocalized (Fig. 4A, right). Furthermore, the CD31-positive blood vessels colocalized with phosphorylated EGFR (Fig. 4B), indicating that the tumor endothelial cells express activated EGFR in vivo. Rabbit IgG controls showed no colocalization with CD31 staining (data not shown). Interestingly, the melanoma tumor cells, as opposed to the melanoma endothelial cells, stained poorly with the EGFR antibody, suggesting that, in these tumors, EGFR expression was mostly restricted to the endothelial compartment. These results are consistent with the Western blot analysis shown in Fig. 1B. Colocalization of EGFR staining with CD31-positive endothelial cells was also observed in xenografts of MDA-MB-231 breast carcinomas (Fig. 4C). Unlike the melanoma, both breast carcinoma tumor cells and endothelial cells were EGFR positive. In contrast, very little colocalization of EGFR and CD31 was evident in sections of mouse skin (Fig. 4D, right). The hair follicle cells in the mouse skin serve as a positive control for EGFR staining (Fig. 4D, arrow; ref. 19).


Figure 4
View larger version (48K):
[in this window]
[in a new window]
 
Figure 4. In vivo expression of EGFR and ErbB3 in tumor and normal vessels. Immunofluorescent staining was done on fresh frozen tissue to colocalize EGFR, p-EGFR, and ErbB3 (green) with CD31 (red). Colocalization is observed as a merge of green and red to appear as yellow. A, A375SM melanoma stained with anti-EGFR. B, A375SM melanoma stained with p-1068 EGFR antibody. C, MDA-MB-231 breast tumor stained for EGFR. D, mouse skin tissue stained for EGFR. E, A375SM melanoma stained with anti-ErbB3 antibody. F, mouse skin tissue stained for ErbB3. Arrow, hair follicle. Bar, 100 µm.

 
Western blot analysis had shown that A375SM melanoma endothelial cells did not express detectable ErbB3 compared with skin endothelial cells (Fig. 1A). This was confirmed by immunofluorescent analysis of A375SM melanoma tissues, which showed a lack of ErbB3 colocalization with CD31-positive blood vessels (Fig. 4E). In contrast, CD31 and ErbB3 signal colocalized in mouse skin tissue sections (Fig. 4F).

NRG activates ErbB3 signaling in normal endothelial cells and inhibits their growth. In Fig. 1A, it was shown that normal skin endothelial cells expressed ErbB3 but not EGFR. As expected, NRG1ß did not activate ErbB3 in tumor endothelial cells (Fig. 5A, lane 2). On the other hand, NRG1ß did stimulate increased ErbB3 phosphorylation in skin endothelial cells (Fig. 5A, lane 4). NRG1ß did not increase phosphorylation of Erk1/2 in tumor and skin endothelial cells. NRG activation in several cell types is associated with growth inhibition and differentiation (20). NRG1ß induced dose-dependent inhibition of cell growth in skin endothelial cells but not in tumor endothelial cells (Fig. 5B). A maximum of 25% growth inhibition was observed at a dose of 5 ng/mL (0.2 nmol/L) NRG1ß.


Figure 5
View larger version (23K):
[in this window]
[in a new window]
 
Figure 5. Neuregulin activates skin endothelial cells. A, A375SM tumor endothelial cells and skin endothelial cells were serum-starved and stimulated with or without NRG1ß. Activated ErbB3 (p-ErbB3) was detected by immunoprecipitation with anti-ErbB3 antibody followed by phosphotyrosine Western blotting. The blots were stripped and reprobed for ErbB3. The same lysates were analyzed by blotting for p-Erk1/2 and blots were stripped and reprobed for Erk1/2 as a loading control. B, cell proliferation was measured using the MTT assay. Serum-starved cells were treated with increasing doses of NRG1ß. Points, absorbance of NRG-treated compared with vehicle-treated cells shown as percentage proliferation; bars, SE from triplicate wells. {blacklozenge}, tumor endothelial cells; Figure 5, skin endothelial cells.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Evidence is presented that tumor endothelial cells are markedly different from normal endothelial cells in expression of EGF receptors and in their response to EGF family members and to EGFR kinase inhibitors. Comparative analysis of the expression profiles of the four ErbB/EGF receptor family members shows that tumor endothelial cells express EGFR, ErbB2, and ErbB4, whereas normal endothelial cells express ErbB2, ErbB3, and ErbB4. Thus, there seems to be a switch in which tumor endothelial cells express EGFR rather than ErbB3; the opposite occurs in normal endothelial cells. EGFR expression was evident in several tumor-derived endothelial cells lines tested, including melanoma, breast carcinoma, and liposarcoma endothelial cells, but not in several normal endothelial cell lines tested, including skin, adipose, HUV, HMV, and MS1 endothelial cells. Several previous studies have reported an absence of EGFR expression in HUVECs consistent with our observation (14, 21). However, EGFR expression in HUVECs has been recently reported (22). Analysis of tumor xenograft sections confirmed the Western blot profiles. EGFR was colocalized by immunofluorescent staining with the endothelial cell marker, CD31, in melanoma and breast carcinoma tumor sections. Furthermore, EGFR was activated in vivo in melanoma xenografts as detected by anti-p-EGFR antibodies. On the other hand, ErbB3 did not colocalize with CD31 in the tumor sections but colocalized in skin sections.

The expression of EGFR in tumor, but not normal, endothelial cells has a number of consequences. One is that the tumor endothelial cells are targets for EGF, TGF-{alpha}, betacellulin, and HB-EGF, but not for NRG. EGF induces tumor endothelial cell EGFR tyrosine phosphorylation, activates downstream MAPK signaling pathway, and stimulates their proliferation. EGF also activates its heterodimerizing partner ErbB2, an oncogene. Thus, in tumor endothelial cells, two EGF receptor types are activated by EGF. In contrast, EGFR ligands are unable to elicit any of these responses in normal skin endothelial cells, as expected, because normal endothelial cells do not express EGFR. Furthermore, in tumor endothelial cells NRG does not induce MAPK activation, indicating that NRG, unlike EGF, is not a mitogen for tumor endothelial cells.

Interestingly, skin endothelial cells but not tumor endothelial cells express ErbB3, suggesting that endothelial cells switch from being NRG responsive to EGF responsive as they encounter the tumor microenvironment. NRG, the ligand for ErbB3, activates the receptor in normal endothelial cells but not tumor endothelial cells. In the case of skin endothelial cells, NRG inhibits proliferation. There is no such inhibition in tumor endothelial cells because they do not express ErbB3. Thus, tumor endothelial cells may promote angiogenesis in two ways, by enhancing EGFR expression thereby increasing their ability to proliferate, and by losing ErbB3 expression, which would be growth inhibitory. In support, it has been shown that in a nontransformed breast epithelial cell line MCF10A, NRG signaling mediated via ErbB2 and ErbB3 was associated with a strong antiproliferative response (23). Furthermore, a tumorigenic variant of MCF10A, MCF10CA, has reduced levels of ErbB3 and responds to NRG by cellular proliferation (23).

Another important consequence is that tumor endothelial cells, but not normal endothelial cells, are targets for anti-EGFR drugs, for example, EGFR kinase inhibitors. Tumors produce EGF family ligands, such as TGF-{alpha} and HB-EGF, and these growth factors have been suggested to stimulate autocrine and paracrine proliferation of tumor cells expressing EGFR (24). EGFR kinase inhibitors block tumor cell proliferation and tumor growth (6). We have found that EGFR kinase inhibitors affect tumor endothelial cells as well. They completely inhibit EGF-induced tumor endothelial cell proliferation but have no effect on skin endothelial cells, which do not express EGFR. Gefitinib (Iressa), which is marketed for treating non–small cell lung cancer patients, was also able to inhibit EGF-induced cell proliferation of tumor endothelial cells. These results are significant because they suggest that, in vivo, EGFR kinase inhibitors will target the tumor vasculature but not the normal vasculature, a specificity important for antiangiogenesis drug design. These results also suggest that tumor endothelial cells might be a more appropriate preclinical model than HUVECs for studying antiangiogenesis therapies, such as EGFR kinase inhibitors. This may be one of the first demonstrations that anti-EGFR therapeutics directly target tumor-derived endothelial cells. A375SM melanoma cells are of interest because they express very little tumor cell–associated EGFR but abundant endothelial cell–associated EGFR. In this tumor, the relative lack of EGFR on tumor cells makes the identification of EGFR on endothelial cells relatively unambiguous.

Another consequence of EGFR expression in tumor endothelial cells is that ErbB2/HER2 is also activated in response to EGF stimulation. Because ErbB2 activation requires dimerization with a ligand-binding receptor, and because EGF binds only to EGFR, a heterodimer of EGFR:ErbB2 must be activated in tumor endothelial cells. Signaling through the EGFR:ErbB2 heterodimer is more potent due to delayed endocytosis of the activated receptor (25). Transformation of tumor cells requires both EGFR as well as ErbB2 expression (26). In addition, coexpression of EGFR with ErbB2 in breast tumors is associated with a worse patient prognosis than single receptor expression (27). EGFR-positive patients with high levels of ErbB2 respond better to EGFR kinase inhibitors (28). Hence, the activation of EGFR:ErbB2 heterodimer signaling in tumor endothelial cells may provide more effective targets for EGFR kinase inhibitors as well as suggests that anti-ErbB2 therapeutics (e.g., Herceptin) may also be efficacious in inhibiting tumor angiogenesis.

A novel finding is that normal endothelial cells express ErbB3, but tumor endothelial cells do not. As expected, NRG stimulates phosphorylation of ErbB3 in skin endothelial cells but not tumor endothelial cells. NRG has several biological functions, including stimulating proliferation, differentiation, growth arrest, apoptosis, and endothelial to mesenchymal transitions (29, 30). In normal endothelial cells, we find that activation by NRG1ß at 1 to 20 ng/mL results in their growth inhibition. In support, it has been reported that addition of NRG2 to HUVECs and HMVECs results in growth inhibition in a dose range of 1 to 10 ng/mL (31). Both studies use the NRG form containing EGF and the immunoglobulin domain. The immunoglobulin domain is critical for growth inhibition (31). Another study showed cell proliferation of HUVECs in response to NRG1ß (14). However, these results could be due to their use of the NRG1ß form lacking the immunoglobulin domain. NRG is a ligand for both ErbB3 and ErbB4. It is plausible that the growth inhibition observed in response to NRG in normal endothelial cells is acting not via ErbB3 but via ErbB4, which is also expressed in these cells. However, tumor endothelial cells, which express ErbB4 but do not express ErbB3, are not growth inhibited by NRG activation. These results suggest that the NRG-induced growth inhibition acts via the ErbB3 receptor.

EGFR expression in endothelial cells has been reported previously by immunohistochemical analysis of tumor xenografts of pancreatic and renal tumors (9, 12, 22). In these studies, EGFR kinase inhibitor treatment of mice bearing these tumors showed decreased p-EGFR expression and a concomitant increase of apoptosis in tumor-associated endothelial cells as determined by immunohistochemical analysis. However, whether these EGFR kinase inhibitors block angiogenesis directly via endothelial cell–EGFR or indirectly by suppressing VEGF (10) is not clear. Our results suggest that EGFR kinase inhibitors have a direct inhibitory effect on tumor endothelial cell proliferation. Using a molecular approach, we have shown, for the first time, enhanced ErbB2 and MAPK activity in tumor endothelial cells in response to EGF and resistance to inhibitory activity of NRG due to loss of ErbB3.

Our tumor endothelial cell EGF receptor studies might have clinical significance. One, is that anti-EGFR therapeutics might target the tumor vasculature specifically based on our findings that tumor endothelial cells but not normal endothelial cells express EGFR. Patients eligible to receive anti-EGFR drugs are screened by positive immunoreactivity to EGFR (32). However, a study in colon cancer patients showed that patients who had scores of 0 out of a 3+ scoring system for EGFR immunoreactivity in their tumors responded to Cetuximab (a mAb against EGFR; ref. 33). We propose that determining EGFR immunoreactivity in tumor endothelium in addition to the tumor cells will help identify patients that have previously been determined as being ineligible for EGFR therapeutics.


    Acknowledgments
 
Grant support: NIH grants CA37392 and CA45548, Harvard Skin Disease Research Center, and Elsa U. Pardee Foundation (M. Klagsbrun); Japan Society for the Promotion of Science Fellowship (K. Hida); Elizabeth and George Sanborn Foundation Fellowship from the American Cancer Society and NIH Specialized Programs of Research Excellence in skin cancer Development Project Award (D. Bielenberg).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Kristin Gullage for graphics; Ricky Sanchez and Melissa Mang for technical support; Dr. Corazon Bucana for suggestions in immunohistochemical stainings; Dr. Isaiah Fidler for the A375SM cell line; Dr. Jack Arbiser for the MS1 cells; and Drs. Rosalyn Adams, Michael Freeman, Katsutoshi Goishi, and Andrew Dudley for critical readings of the manuscript.

Received 9/21/05. Revised 12/ 6/05. Accepted 12/16/05.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Riese DJ II, Stern DF. Specificity within the EGF family/ErbB receptor family signaling network. Bioessays 1998;20:41–8.[CrossRef][Medline]
  2. Yarden Y, Sliwkowski MX. Untangling the ErbB signalling network. Nat Rev Mol Cell Biol 2001;2:127–37.[CrossRef][Medline]
  3. Olayioye MA, Neve RM, Lane HA, Hynes NE. The ErbB signaling network: receptor heterodimerization in development and cancer. EMBO J 2000;19:3159–67.[CrossRef][Medline]
  4. Stern DF. Tyrosine kinase signalling in breast cancer: ErbB family receptor tyrosine kinases. Breast Cancer Res 2000;2:176–83.[CrossRef][Medline]
  5. Ivanov VN, Hei TK. Combined treatment with EGFR inhibitors and arsenite upregulated apoptosis in human EGFR-positive melanomas: a role of suppression of the PI3K-AKT pathway. Oncogene 2005;24:616–26.[CrossRef][Medline]
  6. Hynes NE, Lane HA. ERBB receptors and cancer: the complexity of targeted inhibitors. Nat Rev Cancer 2005;5:341–54.[CrossRef][Medline]
  7. Baselga J, Arteaga CL. Critical update and emerging trends in epidermal growth factor receptor targeting in cancer. J Clin Oncol 2005;23:2445–59.[Abstract/Free Full Text]
  8. Izumi Y, Xu L, di Tomaso E, Fukumura D, Jain RK. Tumour biology: herceptin acts as an anti-angiogenic cocktail. Nature 2002;416:279–80.[Medline]
  9. Kedar D, Baker CH, Killion JJ, Dinney CP, Fidler IJ. Blockade of the epidermal growth factor receptor signaling inhibits angiogenesis leading to regression of human renal cell carcinoma growing orthotopically in nude mice. Clin Cancer Res 2002;8:3592–600.[Abstract/Free Full Text]
  10. Kumar R, Yarmand-Bagheri R. The role of HER2 in angiogenesis. Semin Oncol 2001;28:27–32.[Medline]
  11. Ferrara N, Gerber HP, LeCouter J. The biology of VEGF and its receptors. Nat Med 2003;9:669–76.[CrossRef][Medline]
  12. Baker CH, Kedar D, McCarty MF, et al. Blockade of epidermal growth factor receptor signaling on tumor cells and tumor-associated endothelial cells for therapy of human carcinomas. Am J Pathol 2002;161:929–38.[Abstract/Free Full Text]
  13. Hida K, Hida Y, Amin DN, et al. Tumor-associated endothelial cells with cytogenetic abnormalities. Cancer Res 2004;64:8249–55.[Abstract/Free Full Text]
  14. Russell KS, Stern DF, Polverini PJ, Bender JR. Neuregulin activation of ErbB receptors in vascular endothelium leads to angiogenesis. Am J Physiol 1999;277:H2205–11.[Medline]
  15. Arbiser JL, Raab G, Rohan RM, et al. Isolation of mouse stromal cells associated with a human tumor using differential diphtheria toxin sensitivity. Am J Pathol 1999;155:723–9.[Abstract/Free Full Text]
  16. Amin DN, Tuck D, Stern DF. Neuregulin-regulated gene expression in mammary carcinoma cells. Exp Cell Res 2005;309:12–23.[CrossRef][Medline]
  17. Graus-Porta D, Beerli RR, Daly JM, Hynes NE. ErbB-2, the preferred heterodimerization partner of all ErbB receptors, is a mediator of lateral signaling. EMBO J 1997;16:1647–55.[CrossRef][Medline]
  18. Yaish P, Gazit A, Gilon C, Levitzki A. Blocking of EGF-dependent cell proliferation by EGF receptor kinase inhibitors. Science 1988;242:933–5.[Abstract/Free Full Text]
  19. Nanney LB, Stoscheck CM, King LE, Jr., Underwood RA, Holbrook KA. Immunolocalization of epidermal growth factor receptors in normal developing human skin. J Invest Dermatol 1990;94:742–8.[CrossRef][Medline]
  20. Burden S, Yarden Y. Neuregulins and their receptors: a versatile signaling module in organogenesis and oncogenesis. Neuron 1997;18:847–55.[CrossRef][Medline]
  21. Kim HS, Shin HS, Kwak HJ, Cho CH, Lee CO, Koh GY. Betacellulin induces angiogenesis through activation of mitogen-activated protein kinase and phosphatidylinositol 3'-kinase in endothelial cell. FASEB J 2003;17:318–20.[Abstract/Free Full Text]
  22. Sini P, Wyder L, Schnell C, et al. The antitumor and antiangiogenic activity of vascular endothelial growth factor receptor inhibition is potentiated by ErbB1 blockade. Clin Cancer Res 2005;11:4521–32.[Abstract/Free Full Text]
  23. Li Q, Ahmed S, Loeb JA. Development of an autocrine neuregulin signaling loop with malignant transformation of human breast epithelial cells. Cancer Res 2004;64:7078–85.[Abstract/Free Full Text]
  24. Salomon DS, Brandt R, Ciardiello F, Normanno N. Epidermal growth factor-related peptides and their receptors in human malignancies. Crit Rev Oncol Hematol 1995;19:183–232.[Medline]
  25. Huang G, Chantry A, Epstein RJ. Overexpression of ErbB2 impairs ligand-dependent downregulation of epidermal growth factor receptors via a post-transcriptional mechanism. J Cell Biochem 1999;74:23–30.[CrossRef][Medline]
  26. Kokai Y, Meyers JN, Wada T, et al. Synergistic interaction of p185 c-neu and the EGF receptor leads to transformation of rodent fibroblasts. Cell 1989;58:287–92.[CrossRef][Medline]
  27. Suo Z, Risberg B, Kalsson MG, et al. EGFR family expression in breast carcinomas. c-erbB-2 and c-erbB-4 receptors have different effects on survival. J Pathol 2002;196:17–25.[CrossRef][Medline]
  28. Cappuzzo F, Varella-Garcia M, Shigematsu H, et al. Increased HER2 gene copy number is associated with response to gefitinib therapy in epidermal growth factor receptor-positive non-small-cell lung cancer patients. J Clin Oncol 2005;23:5007–18.[Abstract/Free Full Text]
  29. Falls DL. Neuregulins: functions, forms, and signaling strategies. Exp Cell Res 2003;284:14–30.[CrossRef][Medline]
  30. Camenisch TD, Schroeder JA, Bradley J, Klewer SE, McDonald JA. Heart-valve mesenchyme formation is dependent on hyaluronan-augmented activation of ErbB2-ErbB3 receptors. Nat Med 2002;8:850–5.[Medline]
  31. Nakano N, Higashiyama S, Ohmoto H, Ishiguro H, Taniguchi N, Wada Y. The N-terminal region of NTAK/neuregulin-2 isoforms has an inhibitory activity on angiogenesis. J Biol Chem 2004;279:11465–70.[Abstract/Free Full Text]
  32. Dei Tos AP, Ellis I. Assessing epidermal growth factor receptor expression in tumours: what is the value of current test methods? Eur J Cancer 2005;41:1383–92.[CrossRef][Medline]
  33. Chung KY, Shia J, Kemeny NE, et al. Cetuximab shows activity in colorectal cancer patients with tumors that do not express the epidermal growth factor receptor by immunohistochemistry. J Clin Oncol 2005;23:1803–10.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Sci Transl MedHome page
D. N. Amin, N. Sergina, D. Ahuja, M. McMahon, J. A. Blair, D. Wang, B. Hann, K. M. Koch, K. M. Shokat, and M. M. Moasser
Resiliency and Vulnerability in the HER2-HER3 Tumorigenic Driver
Science Translational Medicine, January 27, 2010; 2(16): 16ra7 - 16ra7.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
T. Akino, K. Hida, Y. Hida, K. Tsuchiya, D. Freedman, C. Muraki, N. Ohga, K. Matsuda, K. Akiyama, T. Harabayashi, et al.
Cytogenetic Abnormalities of Tumor-Associated Endothelial Cells in Human Malignant Tumors
Am. J. Pathol., December 1, 2009; 175(6): 2657 - 2667.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
A. J. Chien, J. A. Illi, A. H. Ko, W. M. Korn, L. Fong, L.-m. Chen, M. Kashani-Sabet, C. J. Ryan, J. E. Rosenberg, S. Dubey, et al.
A Phase I Study of a 2-Day Lapatinib Chemosensitization Pulse Preceding Nanoparticle Albumin-Bound Paclitaxel for Advanced Solid Malignancies
Clin. Cancer Res., September 1, 2009; 15(17): 5569 - 5575.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
G. Xu, T. Watanabe, Y. Iso, S. Koba, T. Sakai, M. Nagashima, S. Arita, S. Hongo, H. Ota, Y. Kobayashi, et al.
Preventive Effects of Heregulin-{beta}1 on Macrophage Foam Cell Formation and Atherosclerosis
Circ. Res., August 28, 2009; 105(5): 500 - 510.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
Y.-Q. Xiong, H.-C. Sun, W. Zhang, X.-D. Zhu, P.-Y. Zhuang, J.-B. Zhang, L. Wang, W.-z. Wu, L.-X. Qin, and Z.-Y. Tang
Human Hepatocellular Carcinoma Tumor-derived Endothelial Cells Manifest Increased Angiogenesis Capability and Drug Resistance Compared with Normal Endothelial Cells
Clin. Cancer Res., August 1, 2009; 15(15): 4838 - 4846.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
N. Schicher, V. Paulitschke, A. Swoboda, R. Kunstfeld, R. Loewe, P. Pilarski, H. Pehamberger, and C. Hoeller
Erlotinib and Bevacizumab Have Synergistic Activity against Melanoma
Clin. Cancer Res., May 15, 2009; 15(10): 3495 - 3502.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
G. N. Naumov, M. B. Nilsson, T. Cascone, A. Briggs, O. Straume, L. A. Akslen, E. Lifshits, L. A. Byers, L. Xu, H.-k. Wu, et al.
Combined Vascular Endothelial Growth Factor Receptor and Epidermal Growth Factor Receptor (EGFR) Blockade Inhibits Tumor Growth in Xenograft Models of EGFR Inhibitor Resistance
Clin. Cancer Res., May 15, 2009; 15(10): 3484 - 3494.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. Al-Nedawi, B. Meehan, R. S. Kerbel, A. C. Allison, and J. Rak
Endothelial expression of autocrine VEGF upon the uptake of tumor-derived microvesicles containing oncogenic EGFR
PNAS, March 10, 2009; 106(10): 3794 - 3799.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
J. Ma and D. J. Waxman
Combination of antiangiogenesis with chemotherapy for more effective cancer treatment
Mol. Cancer Ther., December 1, 2008; 7(12): 3670 - 3684.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. Ghosh, C. K. Thodeti, A. C. Dudley, A. Mammoto, M. Klagsbrun, and D. E. Ingber
Tumor-derived endothelial cells exhibit aberrant Rho-mediated mechanosensing and abnormal angiogenesis in vitro
PNAS, August 12, 2008; 105(32): 11305 - 11310.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
T. Sasaki, T. Nakamura, R. B. Rebhun, H. Cheng, K. S. Hale, R. Z. Tsan, I. J. Fidler, and R. R. Langley
Modification of the Primary Tumor Microenvironment by Transforming Growth Factor {alpha}-Epidermal Growth Factor Receptor Signaling Promotes Metastasis in an Orthotopic Colon Cancer Model
Am. J. Pathol., July 1, 2008; 173(1): 205 - 216.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
M. R. Schneider, S. Werner, R. Paus, and E. Wolf
Beyond Wavy Hairs: The Epidermal Growth Factor Receptor and Its Ligands in Skin Biology and Pathology
Am. J. Pathol., July 1, 2008; 173(1): 14 - 24.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
C. Sarkar, D. Chakroborty, U. R. Chowdhury, P. S. Dasgupta, and S. Basu
Dopamine Increases the Efficacy of Anticancer Drugs in Breast and Colon Cancer Preclinical Models
Clin. Cancer Res., April 15, 2008; 14(8): 2502 - 2510.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
I. P. Witz
Yin-Yang Activities and Vicious Cycles in the Tumor Microenvironment
Cancer Res., January 1, 2008; 68(1): 9 - 13.
[Full Text] [PDF]


Home page
Mol Cancer ResHome page
S. Langlois, C. Nyalendo, G. Di Tomasso, L. Labrecque, C. Roghi, G. Murphy, D. Gingras, and R. Beliveau
Membrane-Type 1 Matrix Metalloproteinase Stimulates Cell Migration through Epidermal Growth Factor Receptor Transactivation
Mol. Cancer Res., June 1, 2007; 5(6): 569 - 583.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
R. R. Langley and I. J. Fidler
Tumor Cell-Organ Microenvironment Interactions in the Pathogenesis of Cancer Metastasis
Endocr. Rev., May 1, 2007; 28(3): 297 - 321.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Amin, D. N.
Right arrow Articles by Klagsbrun, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Amin, D. N.
Right arrow Articles by Klagsbrun, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online