| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Cell, Tumor, and Stem Cell Biology |
1 Vascular Biology Program and Departments of 2 Surgery and 3 Pathology, Children's Hospital and Harvard Medical School, Boston, Massachusetts
Requests for reprints: Michael Klagsbrun, Children's Hospital, 1 Blackfan Circle, Karp Family Research Building, Boston, MA 02115. Phone: 617-919-2157; Fax: 617-730-0233; E-mail: michael.klagsbrun{at}childrens.harvard.edu.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
(TGF-
), and amphiregulin bind only to EGFR. Heparin bindingEGF-like growth factor (HB-EGF), betacellulin, and epiregulin bind to both EGFR and ErbB4. Neuregulin (NRG) 1 and NRG2 bind to both ErbB3 and ErbB4, whereas NRG3 and NRG4 bind to ErbB4 alone. Ligand binding induces receptor homodimerization and heterodimerization (3). Dimerization of the EGF receptors increases their intrinsic tyrosine kinase activity resulting in receptor autophosphorylation. The phosphotyrosine sites recruit downstream adaptor and signaling proteins, thus initiating signaling cascades, including mitogen-activated protein kinase (MAPK), phosphatidylinositol 3-kinase, and protein kinase C, in the cytoplasm (3). Signaling initiated by the EGF receptors affects cell proliferation, differentiation, adhesion, apoptosis, and migration (2). EGF receptor family members are important in the etiology of numerous tumors, including those of the breast, ovary, lung, colon, nervous system, head and neck, prostate, and pancreas (2). Amplification of EGFR and ERBB2, and subsequent overexpression of the protein, is observed in 20% to 30% of breast tumors and is associated with poor patient prognosis (4). In contrast, melanomas express low to intermediate levels of EGFR (5). The EGF receptor family members, especially EGFR and ErbB2, are targets of anticancer therapeutics and some are already approved by the Food and Drug Administration and are in the clinic (6, 7). Herceptin (Trastuzumab, Genentech, South San Francisco, CA) is a monoclonal antibody (mAb) against ErbB2 administered to advanced-stage breast cancer patients, whereas Erbitux (Cetuximab, ImClone, New York, NY), a mAb against EGFR, is approved for treatment of colon carcinomas. Iressa (Gefitinib, AstraZeneca, Wilmington, DE) and Tarceva (Erlonitib, Genentech) are small-molecule kinase inhibitors of EGFR that are approved for treating nonsmall cell lung cancer patients.
Despite the success of EGF receptor therapeutics in the clinic, the potential of these drugs as antiangiogenic therapy has not been fully considered because it is assumed that these drugs target the receptors on the tumor cells exclusively. However, anti-EGFR and anti-ErbB2 drug treatments, which result in decreased tumor growth in xenograft models, are characterized by reduced microvascular density and increased endothelial cell apoptosis (8, 9). The antiangiogenic effects of anti-EGF receptor drugs are typically thought to work through the inhibition of vascular endothelial growth factor (VEGF) synthesis by the tumor cells (10). VEGF, a proangiogenic factor, stimulates endothelial cell survival, proliferation, and migration (11). Another possibility is that these drugs target the endothelium directly (12).
Our laboratory has recently described the isolation of tumor-associated endothelial cells from xenografts of human melanomas and liposarcomas in nude mice (13). Normal endothelial cells derived from mouse skin and epidydimal fat pads were also isolated. The tumor endothelial cells differed from normal endothelial cells by displaying cytogenetic abnormalities (13). In addition, tumor endothelial cells showed enhanced responsiveness to growth factors, such as EGF, suggesting possible alterations in receptor expression. Therefore, we evaluated the expression of the EGF receptor family members in tumor endothelial cells and normal endothelial cells.
Tumor cell expression of EGF receptors, such as EGFR and ErbB2, has been extensively analyzed (2). However, EGF receptor expression by endothelial cells is less well studied. In fact, it has been established that endothelial cells typically do not express EGFR and are not responsive to EGF (14). In this report, we examined the EGF receptor profile in tumor endothelial cells and compared it with normal endothelial cells both in vitro and in vivo. Tumor endothelial cells express EGFR but not ErbB3, the opposite of normal endothelial cells. ErbB2 and ErbB4 levels were not affected. Furthermore, these altered expression profiles could be shown in vivo as well. The alterations in EGF receptor expression profiles had at least two major consequences. First of all, EGF stimulated proliferation of tumor endothelial cells, which express EGFR, but not of normal endothelial cells, which do not. On the other hand, neuregulin inhibited normal endothelial cells but not tumor endothelial cell proliferation. Second, tumor, but not normal, endothelial cells incubated with EGF family ligands were now sensitive to the growth inhibitory effects of EGFR kinase inhibitors. These results suggest that anti-EGFR drugs might specifically target the tumor vasculature.
| Materials and Methods |
|---|
|
|
|---|
Isolation of breast carcinomaderived endothelial cells. A375SM melanoma xenografts in nude mice were obtained as described previously (13). MDA-MB-231 xenografts in female nude mice (8-10 weeks old, Charles River, Wilmington, MA) were obtained by injecting MDA-MB-231 tumor cells (2 x 106 per mouse) with 1:1 volume of Matrigel (BD Biosciences, Bedford, MA) s.c. into the dorsal lateral flank. All of the animal procedures were done in compliance with Children's Hospital Boston guidelines and approved by the Institutional Animal Care and Use Committee. When tumors reached
1 cm in diameter, they were excised. Isolation of endothelial cells was done as previously described using FITC-antimouse CD31 antibody (PharMingen, Boston MA) and magnetic cell sorting system (13). After subculture in the presence of diphtheria toxin to kill any remaining human tumor cells (15), the isolated cells were subjected to a second round of purification using FITC-BS1-B4 lectin magnetic cell sorting (Miltenyi Biotec, Auburn, CA). The cells were cultured in EGM2-MV medium (Cambrex BioScience) and purity was determined as described previously (13).
Immunoprecipitation and Western blotting. Before growth factor stimulations, cells were cultured in serum-free medium for 24 hours and incubated for 10 minutes at room temperature with EGF, HB-EGF, TGF
, Betacellulin (100 ng/mL; R&D Systems, Minneapolis, MN) or NRG1-ß1 extracellular domain (50 ng/mL; R&D Systems). Cells were also treated with the EGFR kinase inhibitor, AG1478 (Calbiochem, San Diego, CA), 15 minutes before growth factor stimulation. Immunoprecipitation and Western blotting were done as previously described (16). The antibodies used for immunoprecipitation and Western blotting of ErbB1-4 were SC-03, SC-284, SC-285, and SC-283, respectively (Santa Cruz Biotechnology, Santa Cruz, CA). Receptor phosphorylation was detected using antiphosphotyrosine antibody (mAb 4G10; Upstate, Lake Placid, NY). Analysis of phosphorylated EGFR (p-EGFR) on lysates was done using phosphorylated 1068 (p-1068) EGFR (Cell Signaling Technologies, Beverly MA). In addition, antibodies to glyceraldehyde-3-phosphate dehydrogenase (GAPDH; Chemicon, Temecula, CA), ß-actin (Sigma-Aldrich, St. Louis, MO), p-Erk1/2 (New England Biolabs, Beverly MA), and Erk1 (Santa Cruz Biotechnology) were purchased.
Fluorescence-activated cell sorting. Indirect immunofluorescense to detect EGFR and ErbB3 expression was carried out in 1% paraformaldehyde-fixed cells that were permeabilized with methanol. Permeabilization was required because the antibodies recognized cytoplasmic regions of the receptors. Cells were incubated at 4°C for 1 hour with anti-EGFR (SC-03) and anti-ErbB3 (SC-285) antibodies (Santa Cruz Biotechnology) followed by incubation with anti-rabbit Alexa 488 secondary antibody (Molecular Probes, Eugene, OR) for 1 hour at 4°C. At least 10,000 cells per sample were analyzed on a fluorescence-activated cell sorting (FACS) VantageSE flow cytometer using the Cell Quest software (Becton Dickinson, San Jose, CA).
3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay. Cells (4 x 103) were plated in triplicates into 96-well plates and were allowed to adhere overnight. The cells were then switched to serum-free medium containing growth factors and/or AG1478 at indicated concentrations. Cells were cultured for 72 hours and cell viability was determined by addition of 0.42 mg/mL of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) reagent (Sigma-Aldrich) for 4 hours before harvesting. Medium was removed and cells were solubilized in DMSO and absorbance was measured at 570 nm. The averages of the triplicates were calculated and cell proliferation was determined as the percentage of absorbance of treated cells to the untreated cells. All the experiments were done at least twice.
Reverse transcription-PCR. Total cellular RNA was isolated using the RNeasy miniprep kit with on-column DNase treatment as per the protocol of the manufacturer (Qiagen, Valencia, CA). Reverse transcription and amplification were done as previously described using 31 amplification cycles (13). The primers used were ACCACAGTCCATGCCATCAC and TCCACCACCCTGTTGCTGTA (GAPDH), AAAATGGTCCCCTCGGCT and TCTGGGCTCTTCAGACCA (TGF-
), TGCGGGACCATGAAGCT and TCTCAGTGGGAATTAGTCA (HB-EGF), TGTCCCCTGTCCCACGAT and AGCCTTGCTCTGTGCCCA (EGF).
Immunofluorescent staining. Cryosections (8-10 µm), embedded in OCT compound (Tissue-Tek, Torrance CA), were obtained from A375SM and MDA-MB-231 tumor xenografts and skin of nude mice (13), which were then fixed in acetone followed by acetone/chloroform (1:1, v/v). The sections were further treated with methanol for 5 minutes followed by incubation with 5% normal donkey serum (Jackson Immunoresearch, Westgrove, PA) for 30 minutes before staining. CD31 was detected using antimouse CD31 (PharMingen) and antirat phycoerythrin antibodies (Jackson Immunoresearch). EGFRs were detected using anti-EGFR (Cell Signaling Technology), anti-p-1068 EGFR (Cell Signaling Technology), and anti-ErbB3 (SC-285, Santa Cruz) with antirabbit FITC antibodies (Jackson Immunoresearch). Nuclei were stained with Hoechst 33258 (Sigma-Aldrich).
| Results |
|---|
|
|
|---|
|
EGF activates EGFR and ErbB2 in tumor but not normal endothelial cells. The EGFR expression profile suggests that tumor, but not normal, endothelial cells would be activated in response to EGF or any EGFR ligand. EGF stimulation of tumor endothelial cells after serum starvation induced a robust increase in EGFR phosphorylation (Fig. 2A compare lane 1 with lane 2). As expected, skin endothelial cells, which did not express EGFR, did not show any inducible EGFR phosphorylation (Fig. 2A, compare lane 3 with lane 4). EGF receptors form heterodimers, with ErbB2 being the preferred dimerization partner (17). ErbB2, which does not bind directly to any known ligands, can be activated by heterodimerizing with ligand-bound EGFR. As might be expected from these considerations, addition of EGF increased ErbB2 phosphorylation (p-ErbB2) in tumor endothelial cells (Fig. 2A, lane 2) but not skin endothelial cells (Fig. 2A, lane 4). Activation of the EGFR:ErbB2 complex in the presence of EGF was accompanied by an increase in phosphorylated Erk1/2 (p-Erk1/2) levels, indicating that receptor activation was able to couple to the MAPK signaling cascade (Fig. 2A).
|
EGF was not the only activator of EGFR in tumor endothelial cells. The EGFR ligands TGF-
, HB-EGF, and betacellulin at 100 ng/mL each also promoted EGFR activation in tumor endothelial cells (Fig. 2C, compare lanes 2-5 with lane 1). As expected, none of these EGF family ligands activated EGFR in normal skin endothelial cells (Fig. 2C, compare lanes 8-12 with lane 7). In contrast, NRG1ß, a ligand for ErbB3 and ErbB4, but not EGFR, was not able to activate EGFR in tumor endothelial cells (Fig. 2C, compare lane 6 with lane 1). EGFR ligands, including TGF-
, EGF, and HB-EGF, were expressed in A375SM and MDA-MB-231 tumor cells (Fig. 2D), suggesting that paracrine interactions between the tumor cells and the tumor vasculature could occur.
EGF stimulates tumor endothelial cell proliferation, which is inhibited by an EGFR kinase inhibitor. EGF induced a dose-dependent increase in cell proliferation in tumor endothelial cells as measured by MTT assay (Fig. 3A). EGF also increased thymidine incorporation into DNA in tumor endothelial cells, a measure of cell proliferation (data not shown). A 2.5-fold increase in cell proliferation was observed at a dose of 20 ng/mL of EGF. Hence, EGFR activation is sufficient for stimulating proliferation of tumor endothelial cells. In contrast, skin endothelial cells did not respond to EGF (Fig. 3A).
|
Expression of EGFR, but not ErbB3, in tumor endothelial cells in vivo. Immunofluorescent staining of EGFR expression in tumor tissue sections was done to eliminate the possibility that the EGFR expression in tumor endothelial cells was an artifact of cell culture conditions. Tumors were obtained from s.c. injections of A375SM melanoma cells (Fig. 4A, B, and E) and MDA-MB-231 breast carcinoma cells (Fig. 4C) in athymic mice. These parental tumors were the same ones used to isolate the tumor endothelial cells described in Figs. 1 and 2. Mouse skin sections were also analyzed (Fig. 4D and F). Frozen sections (8-10 µm) were double immunolabeled for CD31, a marker for endothelial cells (red fluorescence), and for EGFR/p-EGFR/ErbB3 (green fluorescence). Colocalization was observed in the merged images (yellow). In melanoma, EGFR (Fig. 4A, left) and CD31-positive blood vessels (Fig. 4A, center) colocalized (Fig. 4A, right). Furthermore, the CD31-positive blood vessels colocalized with phosphorylated EGFR (Fig. 4B), indicating that the tumor endothelial cells express activated EGFR in vivo. Rabbit IgG controls showed no colocalization with CD31 staining (data not shown). Interestingly, the melanoma tumor cells, as opposed to the melanoma endothelial cells, stained poorly with the EGFR antibody, suggesting that, in these tumors, EGFR expression was mostly restricted to the endothelial compartment. These results are consistent with the Western blot analysis shown in Fig. 1B. Colocalization of EGFR staining with CD31-positive endothelial cells was also observed in xenografts of MDA-MB-231 breast carcinomas (Fig. 4C). Unlike the melanoma, both breast carcinoma tumor cells and endothelial cells were EGFR positive. In contrast, very little colocalization of EGFR and CD31 was evident in sections of mouse skin (Fig. 4D, right). The hair follicle cells in the mouse skin serve as a positive control for EGFR staining (Fig. 4D, arrow; ref. 19).
|
NRG activates ErbB3 signaling in normal endothelial cells and inhibits their growth. In Fig. 1A, it was shown that normal skin endothelial cells expressed ErbB3 but not EGFR. As expected, NRG1ß did not activate ErbB3 in tumor endothelial cells (Fig. 5A, lane 2). On the other hand, NRG1ß did stimulate increased ErbB3 phosphorylation in skin endothelial cells (Fig. 5A, lane 4). NRG1ß did not increase phosphorylation of Erk1/2 in tumor and skin endothelial cells. NRG activation in several cell types is associated with growth inhibition and differentiation (20). NRG1ß induced dose-dependent inhibition of cell growth in skin endothelial cells but not in tumor endothelial cells (Fig. 5B). A maximum of 25% growth inhibition was observed at a dose of 5 ng/mL (0.2 nmol/L) NRG1ß.
|
| Discussion |
|---|
|
|
|---|
The expression of EGFR in tumor, but not normal, endothelial cells has a number of consequences. One is that the tumor endothelial cells are targets for EGF, TGF-
, betacellulin, and HB-EGF, but not for NRG. EGF induces tumor endothelial cell EGFR tyrosine phosphorylation, activates downstream MAPK signaling pathway, and stimulates their proliferation. EGF also activates its heterodimerizing partner ErbB2, an oncogene. Thus, in tumor endothelial cells, two EGF receptor types are activated by EGF. In contrast, EGFR ligands are unable to elicit any of these responses in normal skin endothelial cells, as expected, because normal endothelial cells do not express EGFR. Furthermore, in tumor endothelial cells NRG does not induce MAPK activation, indicating that NRG, unlike EGF, is not a mitogen for tumor endothelial cells.
Interestingly, skin endothelial cells but not tumor endothelial cells express ErbB3, suggesting that endothelial cells switch from being NRG responsive to EGF responsive as they encounter the tumor microenvironment. NRG, the ligand for ErbB3, activates the receptor in normal endothelial cells but not tumor endothelial cells. In the case of skin endothelial cells, NRG inhibits proliferation. There is no such inhibition in tumor endothelial cells because they do not express ErbB3. Thus, tumor endothelial cells may promote angiogenesis in two ways, by enhancing EGFR expression thereby increasing their ability to proliferate, and by losing ErbB3 expression, which would be growth inhibitory. In support, it has been shown that in a nontransformed breast epithelial cell line MCF10A, NRG signaling mediated via ErbB2 and ErbB3 was associated with a strong antiproliferative response (23). Furthermore, a tumorigenic variant of MCF10A, MCF10CA, has reduced levels of ErbB3 and responds to NRG by cellular proliferation (23).
Another important consequence is that tumor endothelial cells, but not normal endothelial cells, are targets for anti-EGFR drugs, for example, EGFR kinase inhibitors. Tumors produce EGF family ligands, such as TGF-
and HB-EGF, and these growth factors have been suggested to stimulate autocrine and paracrine proliferation of tumor cells expressing EGFR (24). EGFR kinase inhibitors block tumor cell proliferation and tumor growth (6). We have found that EGFR kinase inhibitors affect tumor endothelial cells as well. They completely inhibit EGF-induced tumor endothelial cell proliferation but have no effect on skin endothelial cells, which do not express EGFR. Gefitinib (Iressa), which is marketed for treating nonsmall cell lung cancer patients, was also able to inhibit EGF-induced cell proliferation of tumor endothelial cells. These results are significant because they suggest that, in vivo, EGFR kinase inhibitors will target the tumor vasculature but not the normal vasculature, a specificity important for antiangiogenesis drug design. These results also suggest that tumor endothelial cells might be a more appropriate preclinical model than HUVECs for studying antiangiogenesis therapies, such as EGFR kinase inhibitors. This may be one of the first demonstrations that anti-EGFR therapeutics directly target tumor-derived endothelial cells. A375SM melanoma cells are of interest because they express very little tumor cellassociated EGFR but abundant endothelial cellassociated EGFR. In this tumor, the relative lack of EGFR on tumor cells makes the identification of EGFR on endothelial cells relatively unambiguous.
Another consequence of EGFR expression in tumor endothelial cells is that ErbB2/HER2 is also activated in response to EGF stimulation. Because ErbB2 activation requires dimerization with a ligand-binding receptor, and because EGF binds only to EGFR, a heterodimer of EGFR:ErbB2 must be activated in tumor endothelial cells. Signaling through the EGFR:ErbB2 heterodimer is more potent due to delayed endocytosis of the activated receptor (25). Transformation of tumor cells requires both EGFR as well as ErbB2 expression (26). In addition, coexpression of EGFR with ErbB2 in breast tumors is associated with a worse patient prognosis than single receptor expression (27). EGFR-positive patients with high levels of ErbB2 respond better to EGFR kinase inhibitors (28). Hence, the activation of EGFR:ErbB2 heterodimer signaling in tumor endothelial cells may provide more effective targets for EGFR kinase inhibitors as well as suggests that anti-ErbB2 therapeutics (e.g., Herceptin) may also be efficacious in inhibiting tumor angiogenesis.
A novel finding is that normal endothelial cells express ErbB3, but tumor endothelial cells do not. As expected, NRG stimulates phosphorylation of ErbB3 in skin endothelial cells but not tumor endothelial cells. NRG has several biological functions, including stimulating proliferation, differentiation, growth arrest, apoptosis, and endothelial to mesenchymal transitions (29, 30). In normal endothelial cells, we find that activation by NRG1ß at 1 to 20 ng/mL results in their growth inhibition. In support, it has been reported that addition of NRG2 to HUVECs and HMVECs results in growth inhibition in a dose range of 1 to 10 ng/mL (31). Both studies use the NRG form containing EGF and the immunoglobulin domain. The immunoglobulin domain is critical for growth inhibition (31). Another study showed cell proliferation of HUVECs in response to NRG1ß (14). However, these results could be due to their use of the NRG1ß form lacking the immunoglobulin domain. NRG is a ligand for both ErbB3 and ErbB4. It is plausible that the growth inhibition observed in response to NRG in normal endothelial cells is acting not via ErbB3 but via ErbB4, which is also expressed in these cells. However, tumor endothelial cells, which express ErbB4 but do not express ErbB3, are not growth inhibited by NRG activation. These results suggest that the NRG-induced growth inhibition acts via the ErbB3 receptor.
EGFR expression in endothelial cells has been reported previously by immunohistochemical analysis of tumor xenografts of pancreatic and renal tumors (9, 12, 22). In these studies, EGFR kinase inhibitor treatment of mice bearing these tumors showed decreased p-EGFR expression and a concomitant increase of apoptosis in tumor-associated endothelial cells as determined by immunohistochemical analysis. However, whether these EGFR kinase inhibitors block angiogenesis directly via endothelial cellEGFR or indirectly by suppressing VEGF (10) is not clear. Our results suggest that EGFR kinase inhibitors have a direct inhibitory effect on tumor endothelial cell proliferation. Using a molecular approach, we have shown, for the first time, enhanced ErbB2 and MAPK activity in tumor endothelial cells in response to EGF and resistance to inhibitory activity of NRG due to loss of ErbB3.
Our tumor endothelial cell EGF receptor studies might have clinical significance. One, is that anti-EGFR therapeutics might target the tumor vasculature specifically based on our findings that tumor endothelial cells but not normal endothelial cells express EGFR. Patients eligible to receive anti-EGFR drugs are screened by positive immunoreactivity to EGFR (32). However, a study in colon cancer patients showed that patients who had scores of 0 out of a 3+ scoring system for EGFR immunoreactivity in their tumors responded to Cetuximab (a mAb against EGFR; ref. 33). We propose that determining EGFR immunoreactivity in tumor endothelium in addition to the tumor cells will help identify patients that have previously been determined as being ineligible for EGFR therapeutics.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Kristin Gullage for graphics; Ricky Sanchez and Melissa Mang for technical support; Dr. Corazon Bucana for suggestions in immunohistochemical stainings; Dr. Isaiah Fidler for the A375SM cell line; Dr. Jack Arbiser for the MS1 cells; and Drs. Rosalyn Adams, Michael Freeman, Katsutoshi Goishi, and Andrew Dudley for critical readings of the manuscript.
Received 9/21/05. Revised 12/ 6/05. Accepted 12/16/05.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
K. Ghosh, C. K. Thodeti, A. C. Dudley, A. Mammoto, M. Klagsbrun, and D. E. Ingber Tumor-derived endothelial cells exhibit aberrant Rho-mediated mechanosensing and abnormal angiogenesis in vitro PNAS, August 12, 2008; 105(32): 11305 - 11310. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Sasaki, T. Nakamura, R. B. Rebhun, H. Cheng, K. S. Hale, R. Z. Tsan, I. J. Fidler, and R. R. Langley Modification of the Primary Tumor Microenvironment by Transforming Growth Factor {alpha}-Epidermal Growth Factor Receptor Signaling Promotes Metastasis in an Orthotopic Colon Cancer Model Am. J. Pathol., July 1, 2008; 173(1): 205 - 216. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Schneider, S. Werner, R. Paus, and E. Wolf Beyond Wavy Hairs: The Epidermal Growth Factor Receptor and Its Ligands in Skin Biology and Pathology Am. J. Pathol., July 1, 2008; 173(1): 14 - 24. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Sarkar, D. Chakroborty, U. R. Chowdhury, P. S. Dasgupta, and S. Basu Dopamine Increases the Efficacy of Anticancer Drugs in Breast and Colon Cancer Preclinical Models Clin. Cancer Res., April 15, 2008; 14(8): 2502 - 2510. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. P. Witz Yin-Yang Activities and Vicious Cycles in the Tumor Microenvironment Cancer Res., January 1, 2008; 68(1): 9 - 13. [Full Text] [PDF] |
||||
![]() |
S. Langlois, C. Nyalendo, G. Di Tomasso, L. Labrecque, C. Roghi, G. Murphy, D. Gingras, and R. Beliveau Membrane-Type 1 Matrix Metalloproteinase Stimulates Cell Migration through Epidermal Growth Factor Receptor Transactivation Mol. Cancer Res., June 1, 2007; 5(6): 569 - 583. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. R. Langley and I. J. Fidler Tumor Cell-Organ Microenvironment Interactions in the Pathogenesis of Cancer Metastasis Endocr. Rev., May 1, 2007; 28(3): 297 - 321. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |