| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Cell, Tumor, and Stem Cell Biology |
1 Cancer Biology Interdisciplinary Graduate Program; 2 Laboratory of Mammary Gland Biology, Department of Nutritional Sciences; 3 Veterinary Sciences and Microbiology; and 4 Southwest Environmental Health Sciences Center, University of Arizona, Tucson, Arizona
Requests for reprints: Donato F. Romagnolo, Laboratory of Mammary Gland Biology, Department of Nutritional Sciences, 1177 East 4th Street, 303 Shantz Building, The University of Arizona, Tucson, AZ 85721-0038. Phone: 520-626-9108; Fax: 520-621-9446; E-mail: donato{at}u.arizona.edu.
| Abstract |
|---|
|
|
|---|
(ER
) complex to the proximal BRCA-1 promoter. Here, we report that activation of BRCA-1 transcription by E2 requires occupancy of the BRCA-1 promoter by the unliganded aromatic hydrocarbon receptor (AhR). The stimulatory effects of E2 on BRCA-1 transcription are counteracted by (a) cotreatment with the AhR antagonist 3'-methoxy-4'-nitroflavone; (b) transient expression in ER
-negative HeLa cells of ER
lacking the protein-binding domain for the AhR; and (c) mutation of two consensus xenobiotic-responsive elements (XRE, 5'-GCGTG-3') located upstream of the ER
-binding region. These results suggest that the physical interaction between the unliganded AhR and the liganded ER
plays a positive role in E2-dependent activation of BRCA-1 transcription. Conversely, we show that the AhR ligands B(a)P and TCDD abrogate E2-induced BRCA-1 promoter activity. The repressive effects of TCDD are paralleled by increased recruitment of the liganded AhR and HDAC1, reduced occupancy by p300, SRC-1, and diminished acetylation of H4 at the BRCA-1 promoter region flanking the XREs. We propose that the ligand status of the AhR modulates activation of the BRCA-1 promoter by estrogen. (Cancer Res 2006; 66(4): 2224-32) | Introduction |
|---|
|
|
|---|
10% of breast cancer cases. However, in sporadic breast tumors, which represent 90% to 95% of breast cancers, BRCA-1 expression is down-regulated in the absence of mutations in the BRCA-1 gene, suggesting that disruption of BRCA-1 regulation may contribute to the etiology of breast cancer (4). Several factors may contribute to the etiology of sporadic breast cancer, including reproductive history, diet, and environmental toxins (5, 6). Prototypical environmental pollutants found in industrial pollution, tobacco smoke, and cooked foods include the polycyclic polyhalogenated 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), which has been shown to alter mammary gland development (7, 8), disrupt endocrine functions (9, 10), and promote tumor growth (11, 12). Population studies detected the accumulation of TCDD in breast milk (13, 14), suggesting that this agent may reach breast tissue and be a risk factor in mammary neoplasia. Another class of environmental pollutants is polycyclic aromatic hydrocarbons (PAH), including the prototypical carcinogen benzo(a)pyrene [B(a)P], which is found in cigarette smoke and cooked meat (15). Diet contributes average values of 600 ng/d of B(a)P (16).
The biological effects of dioxins and PAHs are mediated through binding to the aromatic hydrocarbon receptor (AhR), a member of the basic helix-loop-helix family of transcription factors (17, 18). The liganded AhR recruits the aromatic receptor nuclear translocator (ARNT) and related adaptor molecules, including CBP/p300, to form a heterocomplex that activates transcription of target genes, such as the P450s CYP1A1 and CYP1A2, at cis-acting dioxin or xenobiotic-responsive elements (XRE, 5'-GCGTG-3').
In animal and cell culture models, the recruitment of the activated AhR/ARNT heterocomplex to XREs has been shown to disrupt transcription of E2-responsive genes, including cathepsin D (19, 20), pS2 (21), and c-Fos (22). Proposed mechanisms for these inhibitory effects include DNA-binding interference between the AhR/ARNT- and ER
-containing complexes for adjacent or overlapping target sites (21, 23, 24), and competition for common transcription factors (25). Conversely, the agonist-activated AhR/ARNT heterodimer has been shown to activate E2-responsive promoters through the recruitment of the unliganded ER
and the coactivator p300 to estrogen-responsive gene promoters (26). The estrogenic/antiestrogenic effects of AhR ligands are influenced by several factors, including concentration and binding affinity of AhR ligands, E2 levels, ER status, cell type, availability of nuclear cofactors, and target promoter (25, 2729).
Previously, we reported that estrogen-induced BRCA-1 transcription by stimulating the recruitment of an estrogen receptor-
(ER
)/p300 complex to a region of the proximal BRCA-1 promoter containing an activator protein-1 (AP-1) site (30). Based on earlier observations by our group that the AhR-ligand B(a)P repressed expression of BRCA-1 in ER
-positive breast and ovarian cancer cells (31, 32), we investigated whether AhR modulated ER
signaling at the BRCA-1 promoter. Here, we document that in ER
-positive breast cancer cells, E2 stimulates the recruitment of the unliganded AhR to the proximal BRCA-1 promoter region flanking the AP-1 site and potentiates the effects of the liganded ER
in activation of BRCA-1 transcription. Conversely, we report that the AhR ligands B(a)P and TCDD repress E2-induced BRCA-1 promoter activity. This repression is accompanied by increased occupancy by the liganded AhR and HDAC1 on a BRCA-1 promoter segment comprising two consensus XRE sites located upstream from the AP-1 element, reduced recruitment of p300, SRC-1, and decreased acetylation of histone H4. We conclude that the ligand status of the AhR modulates E2-dependent activation of the BRCA-1 promoter.
| Materials and Methods |
|---|
|
|
|---|
-naphthoflavone, B(a)P, penicillin/streptomycin solution, and DMEM/F12 were purchased from Sigma-Aldrich Chemical Co. TCDD was purchased from Midwest Research Institute (Kansas City, MO). Antibodies against ER
were purchased from Lab Vision Co. (Fremont, CA), whereas antibodies against AhR and HDAC1 were purchased from Santa Cruz Biotechnologies, Inc. (Santa Cruz, CA). Antibodies for p300, SRC-1, and Ac-H4 were purchased from Upstate Biotechnology (Lake Placid, NY). Transient transfections. MCF-7 and HeLa cells were cultured for 3 days in phenol redfree DMEM/F12 and supplemented with 5% charcoal-stripped FBS. Cells were seeded in six-well plates 24 hours before transfection. The reporter plasmids were transfected using the LipofectAMINE Plus (Invitrogen, Carlsbad, CA) procedure as described previously (32). Plasmids encoding for renilla were also cotransfected to account for variations in transfection efficiency. Luciferase reporter activity was monitored with a Luminometer 20/20 and expressed as relative luciferase units corrected for renilla.
Site-directed mutagenesis. Details concerning the cloning of a 1.7 kb BRCA-1 promoter fragment into pGL3 Basic are described elsewhere (32). Mutation of XRE core sequences (GCGTG to Gccaa) was carried out by site-directed mutagenesis (Stratagene, La Jolla, CA) using the following primers synthesized by Sigma-Genosys (The Woodlands, TX): XRE1-F-Mut, 5'-GGATTTCCCAAAGAATTGTGCC-3'; XRE1-R-Mut, 5'-GGCACAATTCTTTGGGAAATCC-3'; XRE2-F-Mut, 5'-GGGTACTGGCCAAGGAGAGTG-3'; and XRE2-R-Mut, 5'-CACTCTCCTTGGCCAGTACCC-3'. Insertion of mutations was confirmed by direct sequencing.
Chromatin immunoprecipitation assay. MCF-7 cells were prepared in phenol redfree DMEM/F12 supplemented with 5% charcoal-stripped FBS for 3 days. Cells were collected after fixation of protein and DNA following the addition of formaldehyde to a final concentration of 1% to cell culture medium and incubation at 25°C for 10 minutes. Cells were harvested and resuspended in lysis buffer (1% SDS, 10 mmol/L EDTA, 50 mmol/L Tris-HCl, and protease inhibitor cocktail). After sonication (10 x 15 seconds), samples were diluted in chromatin immunoprecipitation (ChIP) buffer (1% Triton X-100, 2 mmol/L EDTA, 150 mmol/L NaCl, 20 mmol/L Tris-HCl, and protease inhibitor cocktail). Dilutions of chromatin preparations were reserved as either input (no antibody) material or used for immunoprecipitation with the desired antibody. The sonicated samples were immunocleared with 2 µg sheared salmon sperm DNA (Invitrogen), 5 µg mouse IgG (MP Biomedicals, Irvine, CA), and 45 µL protein G beads (Pierce Biotechnology, Rockford, IL) for 2 hours at 4°C. The supernatant was then incubated with desired antibodies overnight at 4°C. After immunoprecipitation, 2 µg sheared salmon sperm DNA and protein G beads were added to samples and incubation continued for an additional hour. The bead complexes were sequentially washed with TSE I (0.1% SDS, 1% Triton X-100, 2 mmol/L EDTA, 20 mmol/L Tris-HCl, and 150 mmol/L NaCl), TSE II (0.1% SDS, 1% Triton X-100, 2 mmol/L EDTA, 20 mmol/L Tris-HCl, and 500 mmol/L NaCl), buffer III (0.25% LiCl, 1% NP40, 1% deoxycholate, 1 mmol/L EDTA, and 10 mmol/L Tris-HCl), and TE. Then, DNA was extracted thrice with extraction buffer (1% SDS and 1 mol/L NaHCO3). Samples were uncrosslinked in a 65°C water bath overnight and the DNA was purified using the Qiagen Nucleotide Removal kit. PCR primers used to amplify the BRCA-1 promoter region flanking the AP-1 binding site were as follows: forward, ATCGGTACCAAGTGATGCTCTGGGGTACTG; reverse, ACTAGATCTACCTCATGACCAGCCGACGTT (237 bp). The oligonucleotides used to amplify the region flanking the XRE1 and XRE2 binding sites were as follows: forward, CTCCCATCCTCTGATTGTACCTTGAT; reverse, GTCAGCTTCGGAAATCCACTCTC (311 bp).
Real-time PCR. The SYBR Green PCR Reagents kit (Applied Biosystems, Foster City, CA) was used as described by the manufacturer. Briefly, reactions were run at a final volume of 25 µL consisting of the following master mix: 2.5 µL of 10x SybrGreen buffer, 3 µL of 25 mmol/L MgCl2, 2 µL of 12 mmol/L deoxynucleotide triphosphates (dATP, dCTP, dGTP, and dTTP), 2 µL each of forward and reverse primers, 0.25 µL Amperase Uracil-N-glycosylase, 0.125 µL Taq polymerase, 11.125 µL nuclease free double-distilled water, and 2 µL DNA. The ABI 5700 sequence detection system and comparative CT method were used to quantify the relative differences in PCR product as described previously (34). BRCA-1 promoter amplicons were normalized to input.
Statistical analysis. Results of transfection and real-time PCR experiments are presented as means ± SE. Statview, the SAS Institute (Cary, NC) statistical analysis software, was used for ANOVA. Comparison of means following a significant (P < 0.05) ANOVA test were done by Fisher's protected least significant difference test.
| Results |
|---|
|
|
|---|
recruited at estrogen-responsive elements (ERE; ref. 26). The BRCA-1 promoter does not contain ERE (35, 36) but it harbors an AP-1 site (Fig. 1A), which, upon E2 stimulation, recruits an ER
/p300 complex (32). Based on the information that the AhR physically interacts with the ER
(26), we used ChIP assay to test whether E2 influenced the recruitment of the AhR to the BRCA-1 promoter region containing the AP-1 element. We used the breast cancer MCF-7 cell line because it has been used extensively to investigate the crosstalk between the AhR and ER
pathways in regulation of E2-responsive genes (19, 26, 27, 32). The results of experiments depicted in Fig. 1B indicated that E2 stimulated the recruitment of the unliganded AhR to the BRCA-1 promoter flanking the AP-1 element. Conversely, no recruitment of the AhR was observed on treatment with TCDD alone. The cotreatment with TCDD did not alter the ability of E2 to stimulate the recruitment of the AhR. These results suggested that the AP-1 site was not a target for the liganded AhR. Based on these data, we examined the effects of
-naphthoflavone and 3'-methoxy-4'-nitroflavone (3M4NF), which are antagonists of the AhR (3739), on BRCA-1 promoter activity and AhR occupancy. The treatment with E2 stimulated an
2.5-fold induction in BRCA-1 promoter activity. Conversely, the treatment with
-naphthoflavone or 3M4NF alone had no effects on BRCA-1 transcription (Fig. 1C). However, both AhR antagonists repressed E2-induced BRCA-1 promoter activity in transfected MCF-7 cells, suggesting that the unliganded AhR was required for E2-dependent activation of BRCA-1 transcription. This notion was corroborated by results of the ChIP assay, indicating that the treatment with E2 induced the recruitment of the unliganded AhR to the promoter region flanking the AP-1 site, whereas the cotreatment with 3M4NF abrogated this effect (Fig. 1D).
|
transcriptional activity (40, 41), we examined the interplay between these receptors on BRCA-1 regulation. For these experiments, we used cervical HeLa cells, which lack endogenous ER
. The E2 treatment of HeLa cells transfected with pGL3BRCA1 did not influence BRCA-1 transcriptional activity. However, BRCA-1 transcription was induced by E2 in HeLa cells cotransfected with a plasmid containing a cassette for wild-type ER
(pER
). The stimulatory effects of E2 on BRCA-1 promoter activity were of the same magnitude as those measured in MCF-7 cells expressing endogenous ER
(Fig. 1C). Conversely, basal and E2-induced BRCA-1 transcription were reduced in HeLa cells cotransfected with a plasmid encoding for an ER
lacking the binding domain for the AhR (pER
AhR; Fig. 2A). The efficacy of the E2 treatment was confirmed by activation of a positive control reporter construct (p3XERE) cotransfected along with pER
into HeLa cells (Fig. 2B). These data offered evidence that the physical interaction between the ER
and the AhR played an important role in basal and E2-dependent activation of BRCA-1 promoter activity.
|
25% (Fig. 3A) and abrogated entirely the stimulation by E2. The efficacy of the treatments with TCDD and E2 were confirmed by activation of transcription from the control p1A1-4X and p3XERE expression vectors (Fig. 3B), respectively.
|
|
at the AP-1 site. Results of ChIP assays (Fig. 4D) indicated that the treatment with TCDD did not interfere with the ability of E2 to stimulate the recruitment of the ER
. Therefore, we examined whether TCDD stimulated changes in the recruitment of p300, which has been shown to act as a coactivator for both the AhR and ER
(26). Results of ChIP assays followed by quantitation by real-time PCR documented that the treatment with E2 and, to a lesser extent, TCDD, stimulated the recruitment of p300 to the region flanking the XREs (Fig. 5A). The treatment with E2 also induced the recruitment of SRC-1, a member of the p160 family of transcription factors (Fig. 5B). In contrast, the cotreatment with TCDD plus E2 reduced the E2-induced occupancy by p300 and SRC-1, indicating that reduced recruitment of these coactivators may contribute to the repressive effects of TCDD on E2 stimulation.
|
3.28-fold) was reduced (
32%) upon cotreatment with TCDD (Fig. 5C). Conversely, treatment with TCDD or TCDD plus E2 stimulated (
2.8-fold and 1.9-fold, respectively) the recruitment of HDAC1 to the BRCA-1 promoter region flanking the XRE1 and XRE2 (Fig. 5D). Moreover, cotransfection with a plasmid encoding for HDAC1 (myc-HDAC1) confirmed the ability of HDAC1 to repress BRCA-1 promoter activity (Fig. 5E). These cumulative data supported a role for histone deacetylation in the transcriptional repression of BRCA-1 by TCDD.
Based on information that XREs located on E2-inducible promoters acted as negative regulatory elements (1922, 42), we formulated the hypothesis that mutation (GCGTG to GCcaa) of either XRE1 (pXRE1mut) or XRE2 (pXRE2mut) would reverse the repressive effects of TCCD. The data depicted in Fig. 6A indicated that compared with MCF-7 cells transfected with wild-type pGL3BRCA-1, mutation of XRE1 and XRE2 reduced, respectively, by
20% to 30% and
65% basal (DMEM) and E2-induced activity. The activation by TCDD and E2 of the positive reporter constructs p1A1-4X or p3XERE, respectively (Fig. 6B), confirmed the efficacy of the experimental treatments and transfection conditions. These results suggested that the XRE1 and XRE2 sequences were required for maximal E2-activation of BRCA-1 transcription.
|
| Discussion |
|---|
|
|
|---|
(23, 43) and enhanced oxidative metabolism (28). However, the negative effects of TCDD on E2-responsive genes have been shown to precede the activation of metabolic enzymes, such as CYP1A1 (20), and do not alter circulating levels of E2 in vivo (44). Therefore, alternative mechanisms may contribute to the inhibitory AhR-ER
crosstalk on E2-inducible genes. Transcriptional effects of AhR ligands include competition between the AhR heterocomplex and several transcription factors, including ER
, Sp1, and AP-1, for binding to promoter regions of E2-responsive promoters (1921). This type of interaction has been shown for the c-fos (22), cathepsin-D (19, 20), pS2 (21), and heat shock protein 27 (42) promoters.
In previous studies (30), we documented that E2 induced BRCA-1 promoter activity by stimulating the recruitment of a p300/ER
complex to an AP-1 motif located in close proximity to the start site on exon 1B. Based on earlier evidence obtained by our laboratory (31) that the AhR-ligand B(a)P repressed E2-induced expression of BRCA-1, we investigated the role of the AhR in E2-dependent activation of BRCA-1 transcription. The current findings indicated that the unliganded AhR potentiated the transactivation functions of the liganded ER
at the BRCA-1 promoter. This conclusion was supported by several lines of evidence. First, results of ChIP assays clearly documented that the treatment with E2 stimulated the recruitment of the unliganded AhR and liganded ER
to the BRCA-1 promoter region flanking the AP-1 site. Second, cotreatment with the AhR antagonists
-naphthoflavone and 3M4NF repressed E2-dependent BRCA-1 transcription. ChIP experiments indicated that 3M4NF prevented the recruitment of the unliganded AhR to the BRCA-1 promoter flanking the AP-1 region. These results were consistent with those of previous studies documenting the ability of flavone antagonists to block nuclear translocation of the AhR to target promoters harboring XREs (37, 45, 46). Third, overexpression of exogenous ER
lacking the binding domain for the AhR abolished E2-induced BRCA-1 promoter activity. The physical interaction between the unliganded AhR and liganded ER
may stimulate the recruitment of common nuclear factors, such as p300 and SCR-1 (26, 47). The intrinsic histone acetyl transferase activity of p300 and SRC-1 may in turn induce acetylation of core histones, such as H4, and changes in chromatin structure leading to transcriptional activation. Fourth, the stimulatory effects of E2 on BRCA-1 promoter activity were dependent on the functionality of two consensus XREs located upstream of the AP-1 site. In fact, mutation of either XRE1 or XRE2 repressed E2-induced BRCA-1 promoter activity. Interestingly, the combined mutation of XRE1 and XRE2 led to complete repression of BRCA-1 transcription in transfected MCF-7 cells (data not shown). To our knowledge, these cumulative results are the first demonstration that the unliganded AhR bound to XREs may be a necessary cofactor for ER
-dependent activation of BRCA-1 transcription.
In contrast, we found that the AhR ligands B(a)P and TCDD antagonized the stimulatory effects of E2 on BRCA-1 transcription. Unlike B(a)P, TCDD is not genotoxic. Therefore, we used TCDD to detail the role of the AhR on regulation of BRCA-1 promoter activity. The treatment with TCDD stimulated the recruitment of the liganded AhR and HDAC1 to the BRCA-1 promoter region flanking the XRE sites. Conversely, cotreatment with TCDD reduced occupancy by the cofactors p300 and SRC-1 while preventing acetylation of the core histone H4. The repressive effects of TCDD on BRCA-1 transcription were in agreement with findings of previous studies documenting inhibitory AhR-ER
crosstalk on E2-responsive genes. For example, Marlowe et al. (29) reported that following treatment with TCDD, the AhR displaced p300 leading to repression of S phasespecific genes. Thus, AhR ligand activation may lead to silencing of BRCA-1 promoter activity by displacing the coactivators p300 and SRC-1, thus increasing the recruitment of HDAC1 and possibly other corepressors. This notion is supported by our results showing that overexpression of HDAC1 abrogated BRCA-1 promoter activity and TCDD decreased the accumulation of E2-stimulted H4 histone acetylation.
Although the transactivating functions of the AhR at XREs are enhanced by the association with the adaptor molecule ARNT (18, 48, 49), we did not examine the recruitment of ARNT to the BRCA-1 promoter. Although it is possible that ARNT may contribute to transcriptional repression of BRCA-1, studies by Brunnberg et al. (50) reported that ARNT was found to potently enhance transcriptional activity of ERß and, to a lesser degree, ER
. In this study, we focused our attention of the role of AhR based on the information the AhR, but not ARNT, physically interacts with the unliganded ER
and ERß (26). The fact the BRCA-1 promoter harbors more than one XRE suggests that the multiplicity of AhR binding sites may assist in increasing the stability of transcription complexes containing the ER
and augment accessibility to cofactors. This interpretation finds support in results of previous investigations with the CYP1A1 gene documenting that the presence of multiple binding sites for the AhR contributed to stabilization of chromatin in an accessible configuration (51, 52).
Figure 7A depicts a schematic representation of the crosstalk between the unliganded AhR and ER
at the BRCA-1 promoter. A possible implication of this proposed model is that antagonists that block the translocation of the AhR to the nucleus may interfere with estrogen-regulated BRCA-1 expression. Figure 7B illustrates a model in which the recruitment of the liganded AhR to XREs displaces cofactors and prevents the interaction of the AhR with the liganded ER
. Because BRCA-1 expression peaks in S phase (53, 54) and BRCA-1 protein is involved in cell cycle control and DNA repair functions (3, 55), the positive interaction between the AhR and the ER
may play a critical role in regulation of cell cycle progression by modulating the expression of BRCA-1. On the other hand, the physiologic function of the activated AhR may be to sense exposure to environmental and dietary AhR-ligands and repress BRCA-1 expression and cell cycle progression. The continuation of these studies in vivo may assist in the validation of the proposed model of BRCA-1 regulation by the AhR and ER
.
|
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank S. Kato (University of Tokyo, Tokyo, Japan) for pER
AhR; C.L. Smith (Baylor College of Medicine, Houston, TX) for pER
; I. Talianidis (Institute of Molecular and Biotechnology, Crete, Greece) for the myc-HDAC1 plasmid; and E.A. Mash (Southwest Environmental Health Sciences Core Facility, University of Arizona, Tucson, AZ) for synthesis of 3M4NF.
Received 5/10/05. Revised 11/ 7/05. Accepted 12/ 2/05.
| References |
|---|
|
|
|---|
p300 complex activates the BRCA-1 promoter at an AP-1 site that binds Jun/Fos transcription factors: repressive effects of p53 on BRCA-1 transcription. Neoplasia 2005;7:87382.[CrossRef][Medline]
-naphthoflavone as an inhibitor of 2,3,7,8-tetrachlorodibenzo-p-dioxin-induced CYP1A1 gene expression. Arch Biochem Biophys 1990;281:849.[CrossRef][Medline]
through activation of proteasomes. Mol Cell Biol 2003;23:184355.
-naphthoflavone as an Ah receptor antagonist in MCF-7 human breast cancer cells. Toxicol Appl Pharmacol 1993;120:17985.[CrossRef][Medline]This article has been cited by other articles:
![]() |
E. Swedenborg, J. Ruegg, S. Makela, and I. Pongratz Endocrine disruptive chemicals: mechanisms of action and involvement in metabolic disorders J. Mol. Endocrinol., July 1, 2009; 43(1): 1 - 10. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. I. Karchner, M. J. Jenny, A. M. Tarrant, B. R. Evans, H. J. Kang, I. Bae, D. H. Sherr, and M. E. Hahn The Active Form of Human Aryl Hydrocarbon Receptor (AHR) Repressor Lacks Exon 8, and Its Pro185 and Ala185 Variants Repress both AHR and Hypoxia-Inducible Factor Mol. Cell. Biol., July 1, 2009; 29(13): 3465 - 3477. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Gorski, R. D. Kennedy, A. M. Hosey, and D. P. Harkin The Complex Relationship between BRCA1 and ER{alpha} in Hereditary Breast Cancer Clin. Cancer Res., March 1, 2009; 15(5): 1514 - 1518. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. C. Degner, A. J. Papoutsis, O. Selmin, and D. F. Romagnolo Targeting of Aryl Hydrocarbon Receptor-Mediated Activation of Cyclooxygenase-2 Expression by the Indole-3-Carbinol Metabolite 3,3'-Diindolylmethane in Breast Cancer Cells J. Nutr., January 1, 2009; 139(1): 26 - 32. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Singhal, K. Shankar, T. M. Badger, and M. J. Ronis Estrogenic status modulates aryl hydrocarbon receptor--mediated hepatic gene expression and carcinogenicity Carcinogenesis, February 1, 2008; 29(2): 227 - 236. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.M. Coutts, N. Fulton, and R.A. Anderson Environmental toxicant-induced germ cell apoptosis in the human fetal testis Hum. Reprod., November 1, 2007; 22(11): 2912 - 2918. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |