Cancer Research Targets  Metabolism
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hockings, J. K.
Right arrow Articles by Romagnolo, D. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hockings, J. K.
Right arrow Articles by Romagnolo, D. F.
[Cancer Research 66, 2224-2232, February 15, 2006]
© 2006 American Association for Cancer Research


Cell, Tumor, and Stem Cell Biology

The Ligand Status of the Aromatic Hydrocarbon Receptor Modulates Transcriptional Activation of BRCA-1 Promoter by Estrogen

Jennifer K. Hockings1,2, Patricia A. Thorne3, Michael Q. Kemp2, Sherif S. Morgan1,2, Ornella Selmin3 and Donato F. Romagnolo1,2,4

1 Cancer Biology Interdisciplinary Graduate Program; 2 Laboratory of Mammary Gland Biology, Department of Nutritional Sciences; 3 Veterinary Sciences and Microbiology; and 4 Southwest Environmental Health Sciences Center, University of Arizona, Tucson, Arizona

Requests for reprints: Donato F. Romagnolo, Laboratory of Mammary Gland Biology, Department of Nutritional Sciences, 1177 East 4th Street, 303 Shantz Building, The University of Arizona, Tucson, AZ 85721-0038. Phone: 520-626-9108; Fax: 520-621-9446; E-mail: donato{at}u.arizona.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In sporadic breast cancers, BRCA-1 expression is down-regulated in the absence of mutations in the BRCA-1 gene. This suggests that disruption of BRCA-1 expression may contribute to the onset of mammary tumors. Environmental contaminants found in industrial pollution, tobacco smoke, and cooked foods include benzo(a)pyrene [B(a)P] and 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), which have been shown to act as endocrine disruptors and tumor promoters. In previous studies, we documented that estrogen (E2) induced BRCA-1 transcription through the recruitment of an activator protein-1/estrogen receptor-{alpha} (ER{alpha}) complex to the proximal BRCA-1 promoter. Here, we report that activation of BRCA-1 transcription by E2 requires occupancy of the BRCA-1 promoter by the unliganded aromatic hydrocarbon receptor (AhR). The stimulatory effects of E2 on BRCA-1 transcription are counteracted by (a) cotreatment with the AhR antagonist 3'-methoxy-4'-nitroflavone; (b) transient expression in ER{alpha}-negative HeLa cells of ER{alpha} lacking the protein-binding domain for the AhR; and (c) mutation of two consensus xenobiotic-responsive elements (XRE, 5'-GCGTG-3') located upstream of the ER{alpha}-binding region. These results suggest that the physical interaction between the unliganded AhR and the liganded ER{alpha} plays a positive role in E2-dependent activation of BRCA-1 transcription. Conversely, we show that the AhR ligands B(a)P and TCDD abrogate E2-induced BRCA-1 promoter activity. The repressive effects of TCDD are paralleled by increased recruitment of the liganded AhR and HDAC1, reduced occupancy by p300, SRC-1, and diminished acetylation of H4 at the BRCA-1 promoter region flanking the XREs. We propose that the ligand status of the AhR modulates activation of the BRCA-1 promoter by estrogen. (Cancer Res 2006; 66(4): 2224-32)


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The tumor suppressor gene BRCA-1 encodes for a transcription factor that participates in regulation of cell proliferation (1) and maintenance of genome integrity (2, 3). Although mutations in BRCA-1 confer a high risk of developing breast cancer, genetic susceptibility accounts for only ~10% of breast cancer cases. However, in sporadic breast tumors, which represent 90% to 95% of breast cancers, BRCA-1 expression is down-regulated in the absence of mutations in the BRCA-1 gene, suggesting that disruption of BRCA-1 regulation may contribute to the etiology of breast cancer (4).

Several factors may contribute to the etiology of sporadic breast cancer, including reproductive history, diet, and environmental toxins (5, 6). Prototypical environmental pollutants found in industrial pollution, tobacco smoke, and cooked foods include the polycyclic polyhalogenated 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), which has been shown to alter mammary gland development (7, 8), disrupt endocrine functions (9, 10), and promote tumor growth (11, 12). Population studies detected the accumulation of TCDD in breast milk (13, 14), suggesting that this agent may reach breast tissue and be a risk factor in mammary neoplasia. Another class of environmental pollutants is polycyclic aromatic hydrocarbons (PAH), including the prototypical carcinogen benzo(a)pyrene [B(a)P], which is found in cigarette smoke and cooked meat (15). Diet contributes average values of 600 ng/d of B(a)P (16).

The biological effects of dioxins and PAHs are mediated through binding to the aromatic hydrocarbon receptor (AhR), a member of the basic helix-loop-helix family of transcription factors (17, 18). The liganded AhR recruits the aromatic receptor nuclear translocator (ARNT) and related adaptor molecules, including CBP/p300, to form a heterocomplex that activates transcription of target genes, such as the P450s CYP1A1 and CYP1A2, at cis-acting dioxin or xenobiotic-responsive elements (XRE, 5'-GCGTG-3').

In animal and cell culture models, the recruitment of the activated AhR/ARNT heterocomplex to XREs has been shown to disrupt transcription of E2-responsive genes, including cathepsin D (19, 20), pS2 (21), and c-Fos (22). Proposed mechanisms for these inhibitory effects include DNA-binding interference between the AhR/ARNT- and ER{alpha}-containing complexes for adjacent or overlapping target sites (21, 23, 24), and competition for common transcription factors (25). Conversely, the agonist-activated AhR/ARNT heterodimer has been shown to activate E2-responsive promoters through the recruitment of the unliganded ER{alpha} and the coactivator p300 to estrogen-responsive gene promoters (26). The estrogenic/antiestrogenic effects of AhR ligands are influenced by several factors, including concentration and binding affinity of AhR ligands, E2 levels, ER status, cell type, availability of nuclear cofactors, and target promoter (25, 2729).

Previously, we reported that estrogen-induced BRCA-1 transcription by stimulating the recruitment of an estrogen receptor-{alpha} (ER{alpha})/p300 complex to a region of the proximal BRCA-1 promoter containing an activator protein-1 (AP-1) site (30). Based on earlier observations by our group that the AhR-ligand B(a)P repressed expression of BRCA-1 in ER{alpha}-positive breast and ovarian cancer cells (31, 32), we investigated whether AhR modulated ER{alpha} signaling at the BRCA-1 promoter. Here, we document that in ER{alpha}-positive breast cancer cells, E2 stimulates the recruitment of the unliganded AhR to the proximal BRCA-1 promoter region flanking the AP-1 site and potentiates the effects of the liganded ER{alpha} in activation of BRCA-1 transcription. Conversely, we report that the AhR ligands B(a)P and TCDD repress E2-induced BRCA-1 promoter activity. This repression is accompanied by increased occupancy by the liganded AhR and HDAC1 on a BRCA-1 promoter segment comprising two consensus XRE sites located upstream from the AP-1 element, reduced recruitment of p300, SRC-1, and decreased acetylation of histone H4. We conclude that the ligand status of the AhR modulates E2-dependent activation of the BRCA-1 promoter.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell culture and chemicals. MCF-7 and HeLa cells were obtained from American Type Culture Collection (Manassas, VA) and maintained in DMEM/F12 (Sigma-Aldrich Chemical Co., St. Louis, MO) supplemented with 10% fetal bovine serum (FBS; Hyclone Laboratories, Logan, UT) as described previously (33). Estrogen (E2), {alpha}-naphthoflavone, B(a)P, penicillin/streptomycin solution, and DMEM/F12 were purchased from Sigma-Aldrich Chemical Co. TCDD was purchased from Midwest Research Institute (Kansas City, MO). Antibodies against ER{alpha} were purchased from Lab Vision Co. (Fremont, CA), whereas antibodies against AhR and HDAC1 were purchased from Santa Cruz Biotechnologies, Inc. (Santa Cruz, CA). Antibodies for p300, SRC-1, and Ac-H4 were purchased from Upstate Biotechnology (Lake Placid, NY).

Transient transfections. MCF-7 and HeLa cells were cultured for 3 days in phenol red–free DMEM/F12 and supplemented with 5% charcoal-stripped FBS. Cells were seeded in six-well plates 24 hours before transfection. The reporter plasmids were transfected using the LipofectAMINE Plus (Invitrogen, Carlsbad, CA) procedure as described previously (32). Plasmids encoding for renilla were also cotransfected to account for variations in transfection efficiency. Luciferase reporter activity was monitored with a Luminometer 20/20 and expressed as relative luciferase units corrected for renilla.

Site-directed mutagenesis. Details concerning the cloning of a 1.7 kb BRCA-1 promoter fragment into pGL3 Basic are described elsewhere (32). Mutation of XRE core sequences (GCGTG to Gccaa) was carried out by site-directed mutagenesis (Stratagene, La Jolla, CA) using the following primers synthesized by Sigma-Genosys (The Woodlands, TX): XRE1-F-Mut, 5'-GGATTTCCCAAAGAATTGTGCC-3'; XRE1-R-Mut, 5'-GGCACAATTCTTTGGGAAATCC-3'; XRE2-F-Mut, 5'-GGGTACTGGCCAAGGAGAGTG-3'; and XRE2-R-Mut, 5'-CACTCTCCTTGGCCAGTACCC-3'. Insertion of mutations was confirmed by direct sequencing.

Chromatin immunoprecipitation assay. MCF-7 cells were prepared in phenol red–free DMEM/F12 supplemented with 5% charcoal-stripped FBS for 3 days. Cells were collected after fixation of protein and DNA following the addition of formaldehyde to a final concentration of 1% to cell culture medium and incubation at 25°C for 10 minutes. Cells were harvested and resuspended in lysis buffer (1% SDS, 10 mmol/L EDTA, 50 mmol/L Tris-HCl, and protease inhibitor cocktail). After sonication (10 x 15 seconds), samples were diluted in chromatin immunoprecipitation (ChIP) buffer (1% Triton X-100, 2 mmol/L EDTA, 150 mmol/L NaCl, 20 mmol/L Tris-HCl, and protease inhibitor cocktail). Dilutions of chromatin preparations were reserved as either input (no antibody) material or used for immunoprecipitation with the desired antibody. The sonicated samples were immunocleared with 2 µg sheared salmon sperm DNA (Invitrogen), 5 µg mouse IgG (MP Biomedicals, Irvine, CA), and 45 µL protein G beads (Pierce Biotechnology, Rockford, IL) for 2 hours at 4°C. The supernatant was then incubated with desired antibodies overnight at 4°C. After immunoprecipitation, 2 µg sheared salmon sperm DNA and protein G beads were added to samples and incubation continued for an additional hour. The bead complexes were sequentially washed with TSE I (0.1% SDS, 1% Triton X-100, 2 mmol/L EDTA, 20 mmol/L Tris-HCl, and 150 mmol/L NaCl), TSE II (0.1% SDS, 1% Triton X-100, 2 mmol/L EDTA, 20 mmol/L Tris-HCl, and 500 mmol/L NaCl), buffer III (0.25% LiCl, 1% NP40, 1% deoxycholate, 1 mmol/L EDTA, and 10 mmol/L Tris-HCl), and TE. Then, DNA was extracted thrice with extraction buffer (1% SDS and 1 mol/L NaHCO3). Samples were uncrosslinked in a 65°C water bath overnight and the DNA was purified using the Qiagen Nucleotide Removal kit. PCR primers used to amplify the BRCA-1 promoter region flanking the AP-1 binding site were as follows: forward, ATCGGTACCAAGTGATGCTCTGGGGTACTG; reverse, ACTAGATCTACCTCATGACCAGCCGACGTT (237 bp). The oligonucleotides used to amplify the region flanking the XRE1 and XRE2 binding sites were as follows: forward, CTCCCATCCTCTGATTGTACCTTGAT; reverse, GTCAGCTTCGGAAATCCACTCTC (311 bp).

Real-time PCR. The SYBR Green PCR Reagents kit (Applied Biosystems, Foster City, CA) was used as described by the manufacturer. Briefly, reactions were run at a final volume of 25 µL consisting of the following master mix: 2.5 µL of 10x SybrGreen buffer, 3 µL of 25 mmol/L MgCl2, 2 µL of 12 mmol/L deoxynucleotide triphosphates (dATP, dCTP, dGTP, and dTTP), 2 µL each of forward and reverse primers, 0.25 µL Amperase Uracil-N-glycosylase, 0.125 µL Taq polymerase, 11.125 µL nuclease free double-distilled water, and 2 µL DNA. The ABI 5700 sequence detection system and comparative CT method were used to quantify the relative differences in PCR product as described previously (34). BRCA-1 promoter amplicons were normalized to input.

Statistical analysis. Results of transfection and real-time PCR experiments are presented as means ± SE. Statview, the SAS Institute (Cary, NC) statistical analysis software, was used for ANOVA. Comparison of means following a significant (P < 0.05) ANOVA test were done by Fisher's protected least significant difference test.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The unliganded AhR is required for E2 induction of BRCA-1 transcription. Previous studies documented that the effects of AhR ligands on E2-responsive gene may be due to crosstalk of the AhR with the ER{alpha} recruited at estrogen-responsive elements (ERE; ref. 26). The BRCA-1 promoter does not contain ERE (35, 36) but it harbors an AP-1 site (Fig. 1A), which, upon E2 stimulation, recruits an ER{alpha}/p300 complex (32). Based on the information that the AhR physically interacts with the ER{alpha} (26), we used ChIP assay to test whether E2 influenced the recruitment of the AhR to the BRCA-1 promoter region containing the AP-1 element. We used the breast cancer MCF-7 cell line because it has been used extensively to investigate the crosstalk between the AhR and ER{alpha} pathways in regulation of E2-responsive genes (19, 26, 27, 32). The results of experiments depicted in Fig. 1B indicated that E2 stimulated the recruitment of the unliganded AhR to the BRCA-1 promoter flanking the AP-1 element. Conversely, no recruitment of the AhR was observed on treatment with TCDD alone. The cotreatment with TCDD did not alter the ability of E2 to stimulate the recruitment of the AhR. These results suggested that the AP-1 site was not a target for the liganded AhR. Based on these data, we examined the effects of {alpha}-naphthoflavone and 3'-methoxy-4'-nitroflavone (3M4NF), which are antagonists of the AhR (3739), on BRCA-1 promoter activity and AhR occupancy. The treatment with E2 stimulated an ~2.5-fold induction in BRCA-1 promoter activity. Conversely, the treatment with {alpha}-naphthoflavone or 3M4NF alone had no effects on BRCA-1 transcription (Fig. 1C). However, both AhR antagonists repressed E2-induced BRCA-1 promoter activity in transfected MCF-7 cells, suggesting that the unliganded AhR was required for E2-dependent activation of BRCA-1 transcription. This notion was corroborated by results of the ChIP assay, indicating that the treatment with E2 induced the recruitment of the unliganded AhR to the promoter region flanking the AP-1 site, whereas the cotreatment with 3M4NF abrogated this effect (Fig. 1D).


Figure 1
View larger version (26K):
[in this window]
[in a new window]
 
Figure 1. Occupancy of the BRCA-1 promoter by the unliganded AhR at an AP-1 site is required for E2 stimulation of BRCA-1 transcription. A, positions of the candidate XRE1, XRE2, and AP-1 elements in the BRCA-1 promoter. Numbers, base pairs from the transcription start site on exon1B. Arrows, position of oligonucleotides used to test the recruitment of AhR to the BRCA-1 promoter region flanking the AP-1 element. B, MCF-7 cells were precultured for 3 days in phenol red–free DMEM with 5% charcoal-stripped FBS and then treated with 10 nmol/L E2, 100 nmol/L TCDD, or their combination for 90 minutes. Cells were processed by ChIP assay followed by PCR amplification as described in Materials and Methods with antibodies against the AhR. Inputs are control bands amplified from chromatin before immunoprecipitation. The size of the amplicon is 237 bp. C, MCF-7 cells were precultured for 3 days in DMEM containing 5% charcoal-stripped FBS. Then, a luciferase reporter construct driven by a 1.69 kb fragment of the BRCA-1 5' flanking region (pGL3BRCA-1) was transiently transfected using LipofectAMINE Plus into MCF-7 cells, which were cultured for 24 hours in control medium (DMEM), DMEM plus 10 nmol/L E2, 100 nmol/L 3M4NF, the combination of E2 and 3M4NF, 25 µmol/L {alpha}-naphthoflavone, or the combination of {alpha}-naphthoflavone and E2. Columns, mean relative luciferase units corrected for renilla from two independent experiments done in triplicate (n = 6) and normalized to the DMEM; bars, SE. *, P < 0.05, statistical differences compared with control (DMEM). Statistical analysis done as described in Materials and Methods. D, MCF-7 cells were treated for 90 minutes with E2, 3M4NF, or their combination. Samples were processed by ChIP assay with antibodies against the AhR as described in (B). MW, DNA molecular weight marker.

 
Because the AhR has been shown to inhibit ER{alpha} transcriptional activity (40, 41), we examined the interplay between these receptors on BRCA-1 regulation. For these experiments, we used cervical HeLa cells, which lack endogenous ER{alpha}. The E2 treatment of HeLa cells transfected with pGL3BRCA1 did not influence BRCA-1 transcriptional activity. However, BRCA-1 transcription was induced by E2 in HeLa cells cotransfected with a plasmid containing a cassette for wild-type ER{alpha} (pER{alpha}). The stimulatory effects of E2 on BRCA-1 promoter activity were of the same magnitude as those measured in MCF-7 cells expressing endogenous ER{alpha} (Fig. 1C). Conversely, basal and E2-induced BRCA-1 transcription were reduced in HeLa cells cotransfected with a plasmid encoding for an ER{alpha} lacking the binding domain for the AhR (pER{alpha}{Delta}AhR; Fig. 2A). The efficacy of the E2 treatment was confirmed by activation of a positive control reporter construct (p3XERE) cotransfected along with pER{alpha} into HeLa cells (Fig. 2B). These data offered evidence that the physical interaction between the ER{alpha} and the AhR played an important role in basal and E2-dependent activation of BRCA-1 promoter activity.


Figure 2
View larger version (16K):
[in this window]
[in a new window]
 
Figure 2. The ER{alpha}/AhR protein interaction region is required for E2-induced BRCA-1 promoter activity. A, HeLa (ER{alpha}-negative) cells were precultured for 3 days in phenol red–free DMEM plus 5% charcoal-stripped FBS. Then, cells were transiently transfected with pGL3BRCA-1 or pGL3BRCA-1 cotransfected with either an expression vector encoding for the human ER{alpha} (pER{alpha}) or ER{alpha} lacking the AhR-interacting region (pER{alpha}{Delta}AhR). B, the positive control plasmid p3XERE, containing three EREs, plus pER{alpha} were contransfected into HeLa cells to confirm efficacy of E2 treatment and transfection conditions. Columns, mean relative luciferase units corrected for renilla from two independent experiments done in triplicate (n = 6) and normalized to the DMEM; bars, SE. *, P < 0.05, statistical differences compared with control (DMEM).

 
The liganded AhR represses E2-induced BRCA-1 transcription. In previous studies, we reported that the AhR ligand B(a)P repressed E2-induced accumulation of BRCA-1 mRNA (31). Therefore, we investigated whether activation of the AhR pathway interfered with E2 induction of the BRCA-1 promoter in transfected MCF-7 cells. We observed that the treatment with E2 induced a 2.5-fold increase in BRCA-1 promoter activity, which was abrogated upon cotreatment with B(a)P (Fig. 3A). These repressive effects of B(a)P were paralleled by activation of a positive control promoter element (p1A1-4X) transfected into MCF-7 cells (Fig. 3B). Because metabolism of B(a)P has been shown to generate reactive intermediates with antiestrogenic properties (32), we tested the effects of TCDD, which is not metabolized, on BRCA-1 promoter activity. These experiments indicated that TCDD reduced basal promoter activity by ~25% (Fig. 3A) and abrogated entirely the stimulation by E2. The efficacy of the treatments with TCDD and E2 were confirmed by activation of transcription from the control p1A1-4X and p3XERE expression vectors (Fig. 3B), respectively.


Figure 3
View larger version (19K):
[in this window]
[in a new window]
 
Figure 3. Agonists of the AhR abrogate E2-induced BRCA-1 transcription. A, MCF-7 cells were precultured for 3 days in DMEM containing 5% charcoal-stripped FBS. Then, pGL3BRCA-1 was transiently transfected using LipofectAMINE Plus into MCF-7 cells, which were cultured in control medium DMEM, 10 nmol/L E2, 5 µmol/L B(a)P, 100 nmol/L TCDD, B(a)P plus E2, or TCDD plus E2. B, in transfected MCF-7 cells, the treatment with B(a)P and TCDD induced the positive control reporter luciferase construct p1A1-4X containing four XREs; E2 treatments induced transcription from p3XERE. Columns, mean relative luciferase units corrected for renilla from two independent experiments done in triplicate (n = 6) and normalized to the DMEM; bars, SE. *, P < 0.05, statistical differences compared with control (DMEM). {square}, DMEM; Figure 3, B[a]P: Figure 3, TCDD; {blacksquare}, E2.

 
Previous studies documented that the repressive effects of AhR ligands on E2-responsive genes were mediated through the recruitment of the liganded AhR to XREs. Therefore, we examined whether the BRCA-1 promoter harbored potential XRE sites. Inspection of the BRCA-1 promoter led to the identification of two elements located upstream of the AP-1 site at positions –260/–256 (XRE1) and –102/–98 (XRE2) with sequence homology to the consensus XRE (5'-GCGTG-3'). Using ChIP assays, we detected basal occupancy by the unliganded AhR at the BRCA-1 promoter region flanking the XRE sites. However, the treatment with TCDD stimulated the time-dependent recruitment of the AhR to this promoter segment (Fig. 4A). The intensity of the BRCA-1 amplicon increased linearly from 30 to 90 minutes posttreatment as measured by real-time PCR (Fig. 4B). Based on these results, we examined the combinatorial effects of TCDD and E2 on recruitment of the AhR to the BRCA-1 promoter region containing XRE1 and XRE2. Compared with control DMEM, the treatment with E2 did not influence basal occupancy by the AhR, whose recruitment, however, was stimulated by treatment with TCDD alone (Fig. 4C). In cells cotreated with TCDD plus E2, the occupancy by the liganded AhR was higher than control (DMEM) and E2-treated samples, but was lower compared with TCDD alone, suggesting that E2 antagonized the recruitment of the AhR to this region of the BRCA-1 promoter.


Figure 4
View larger version (34K):
[in this window]
[in a new window]
 
Figure 4. TCDD stimulates the recruitment of the AhR and represses E2-dependent transcription of BRCA-1. A, MCF-7 cells were precultured for 3 days in DMEM containing 5% charcoal-stripped FBS. Then, cells were cultured in control medium (DMEM) or DMEM plus 100 nmol/L TCDD for the indicated times. At the end of the incubation period, cells were processed by ChIP assay using antibodies against the AhR. Inputs are control bands. B, recruitment of AhR to the BRCA-1 region containing XRE1 and XRE2 was examined by real-time PCR as described in Materials and Methods. Columns, mean amplification product corrected for input and normalized to time 0; bars, SE. *, P < 0.05, statistical differences compared with control (time 0). C to D, MCF-7 cells were precultured for 3 days in DMEM containing 5% charcoal-stripped FBS and then cultured in for 90 minutes in control medium DMEM, DMEM supplemented with 10 nmol/L E2, 100 nmol/L TCDD, or their combination. At the end of the incubation period, cells were processed by ChIP assay using antibodies against the AhR (C) or ER{alpha} (D). Bands, amplified products from immunoprecipitated complexes containing the AhR, ER{alpha}, or control input. The cartoons depict the positions of the oligonucleotides used to amplify the BRCA-1 promoter region flanking the XREs (311 bp) or the AP-1 (237 bp).

 
To clarify the mechanisms underlying the repressive effects of TCDD on E2-induced BRCA-1 transcription, we examined the effects of E2, TCDD, and their combination on occupancy by the ER{alpha} at the AP-1 site. Results of ChIP assays (Fig. 4D) indicated that the treatment with TCDD did not interfere with the ability of E2 to stimulate the recruitment of the ER{alpha}. Therefore, we examined whether TCDD stimulated changes in the recruitment of p300, which has been shown to act as a coactivator for both the AhR and ER{alpha} (26). Results of ChIP assays followed by quantitation by real-time PCR documented that the treatment with E2 and, to a lesser extent, TCDD, stimulated the recruitment of p300 to the region flanking the XREs (Fig. 5A). The treatment with E2 also induced the recruitment of SRC-1, a member of the p160 family of transcription factors (Fig. 5B). In contrast, the cotreatment with TCDD plus E2 reduced the E2-induced occupancy by p300 and SRC-1, indicating that reduced recruitment of these coactivators may contribute to the repressive effects of TCDD on E2 stimulation.


Figure 5
View larger version (22K):
[in this window]
[in a new window]
 
Figure 5. TCDD represses BRCA-1 transcription by altering the recruitment of cofactors and histone status. MCF-7 cells were precultured for 3 days in DMEM containing 5% charcoal-stripped FBS and then cultured for 90 minutes in control medium DMEM, DMEM plus 10 nmol/L E2, 100 nmol/L TCDD, or their combination. At the end of the incubation period, cells were processed by ChIP assay using antibodies against p300 (A), SRC-1 (B), Ac-H4 (C), or HDAC1 (D). Recruitment of p300, SRC-1, HDAC1, and Ac-H4 to the BRCA-1 region containing XRE1 and XRE2 was examined by real-time PCR as described in Materials and Methods. Columns, mean amplification product corrected for input and normalized to control (DMEM); bars, SE. *, P < 0.05, statistical differences compared with control. The cartoon depicts the position of oligonucleotides used to amplify the BRCA-1 promoter region flanking the XREs (311 bp). E, MCF-7 cells were precultured for 3 days in phenol red–free DMEM plus 5% charcoal-stripped FBS. Then, cells were transiently transfected with pGL3BRCA-1 or pGL3BRCA-1 cotransfected with an expression vector encoding for the human HDAC1 (myc-HDAC1), which were then cultured for 24 hours in DMEM or DMEM plus 10 nmol/L E2. F, the positive control plasmid p3XERE was transfected into MCF-7 cells to confirm efficacy of E2 treatment and transfection conditions. Columns, mean relative luciferase units corrected for renilla and normalized to the DMEM; bars, SE. *, P < 0.05, statistical differences compared with control (DMEM). {square}, DMEM; {blacksquare}, E2.

 
Because p300 and SRC-1 possess histone acetylase activity, removal of these cofactors from transcription complexes has been correlated to increased histone deacetylation. Therefore, we examined if down-regulation of E2-stimulated BRCA-1 transcription by TCDD was accompanied by changes in the acetylation status of histones and the recruitment of histone deacetylases. Results of ChIP assays and real-time PCR showed E2-induced acetylation of the core histone H4 (~3.28-fold) was reduced (~32%) upon cotreatment with TCDD (Fig. 5C). Conversely, treatment with TCDD or TCDD plus E2 stimulated (~2.8-fold and 1.9-fold, respectively) the recruitment of HDAC1 to the BRCA-1 promoter region flanking the XRE1 and XRE2 (Fig. 5D). Moreover, cotransfection with a plasmid encoding for HDAC1 (myc-HDAC1) confirmed the ability of HDAC1 to repress BRCA-1 promoter activity (Fig. 5E). These cumulative data supported a role for histone deacetylation in the transcriptional repression of BRCA-1 by TCDD.

Based on information that XREs located on E2-inducible promoters acted as negative regulatory elements (1922, 42), we formulated the hypothesis that mutation (GCGTG to GCcaa) of either XRE1 (pXRE1mut) or XRE2 (pXRE2mut) would reverse the repressive effects of TCCD. The data depicted in Fig. 6A indicated that compared with MCF-7 cells transfected with wild-type pGL3BRCA-1, mutation of XRE1 and XRE2 reduced, respectively, by ~20% to 30% and ~65% basal (DMEM) and E2-induced activity. The activation by TCDD and E2 of the positive reporter constructs p1A1-4X or p3XERE, respectively (Fig. 6B), confirmed the efficacy of the experimental treatments and transfection conditions. These results suggested that the XRE1 and XRE2 sequences were required for maximal E2-activation of BRCA-1 transcription.


Figure 6
View larger version (22K):
[in this window]
[in a new window]
 
Figure 6. Mutation of XRE1 and XRE2 represses estrogen-induced BRCA-1 transcription. MCF-7 cells were precultured for 3 days in DMEM containing 5% charcoal-stripped FBS. A, luciferase reporter constructs driven by a 1.69 kb fragment of the BRCA-1 5' flanking region containing mutations in the XRE1 or XRE2 elements (XRE1mut or XRE2mut) were transiently transfected using LipofectAMINE Plus into MCF-7 cells, which were cultured for 24 hours in control medium (DMEM), DMEM supplemented with 10 nmol/L E2, 100 nmol/L TCDD, or their combination. B, TCDD and E2, respectively, induced transcription from p1A1-4X or p3XERE in transfected MCF-7 cells. Columns, mean relative luciferase units corrected for renilla from three independent experiments done in triplicate (n = 9) and normalized to the DMEM; bars, SE. *, P < 0.05, statistical differences compared with control (DMEM). {square}, DMEM; {blacksquare}, E2; Figure 6, TCDD; Figure 6, TCDD+E2.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The repressive effects of AhR ligands on E2-responsive genes have been intensively investigated and include proteasome-dependent degradation of ER{alpha} (23, 43) and enhanced oxidative metabolism (28). However, the negative effects of TCDD on E2-responsive genes have been shown to precede the activation of metabolic enzymes, such as CYP1A1 (20), and do not alter circulating levels of E2 in vivo (44). Therefore, alternative mechanisms may contribute to the inhibitory AhR-ER{alpha} crosstalk on E2-inducible genes. Transcriptional effects of AhR ligands include competition between the AhR heterocomplex and several transcription factors, including ER{alpha}, Sp1, and AP-1, for binding to promoter regions of E2-responsive promoters (1921). This type of interaction has been shown for the c-fos (22), cathepsin-D (19, 20), pS2 (21), and heat shock protein 27 (42) promoters.

In previous studies (30), we documented that E2 induced BRCA-1 promoter activity by stimulating the recruitment of a p300/ER{alpha} complex to an AP-1 motif located in close proximity to the start site on exon 1B. Based on earlier evidence obtained by our laboratory (31) that the AhR-ligand B(a)P repressed E2-induced expression of BRCA-1, we investigated the role of the AhR in E2-dependent activation of BRCA-1 transcription. The current findings indicated that the unliganded AhR potentiated the transactivation functions of the liganded ER{alpha} at the BRCA-1 promoter. This conclusion was supported by several lines of evidence. First, results of ChIP assays clearly documented that the treatment with E2 stimulated the recruitment of the unliganded AhR and liganded ER{alpha} to the BRCA-1 promoter region flanking the AP-1 site. Second, cotreatment with the AhR antagonists {alpha}-naphthoflavone and 3M4NF repressed E2-dependent BRCA-1 transcription. ChIP experiments indicated that 3M4NF prevented the recruitment of the unliganded AhR to the BRCA-1 promoter flanking the AP-1 region. These results were consistent with those of previous studies documenting the ability of flavone antagonists to block nuclear translocation of the AhR to target promoters harboring XREs (37, 45, 46). Third, overexpression of exogenous ER{alpha} lacking the binding domain for the AhR abolished E2-induced BRCA-1 promoter activity. The physical interaction between the unliganded AhR and liganded ER{alpha} may stimulate the recruitment of common nuclear factors, such as p300 and SCR-1 (26, 47). The intrinsic histone acetyl transferase activity of p300 and SRC-1 may in turn induce acetylation of core histones, such as H4, and changes in chromatin structure leading to transcriptional activation. Fourth, the stimulatory effects of E2 on BRCA-1 promoter activity were dependent on the functionality of two consensus XREs located upstream of the AP-1 site. In fact, mutation of either XRE1 or XRE2 repressed E2-induced BRCA-1 promoter activity. Interestingly, the combined mutation of XRE1 and XRE2 led to complete repression of BRCA-1 transcription in transfected MCF-7 cells (data not shown). To our knowledge, these cumulative results are the first demonstration that the unliganded AhR bound to XREs may be a necessary cofactor for ER{alpha}-dependent activation of BRCA-1 transcription.

In contrast, we found that the AhR ligands B(a)P and TCDD antagonized the stimulatory effects of E2 on BRCA-1 transcription. Unlike B(a)P, TCDD is not genotoxic. Therefore, we used TCDD to detail the role of the AhR on regulation of BRCA-1 promoter activity. The treatment with TCDD stimulated the recruitment of the liganded AhR and HDAC1 to the BRCA-1 promoter region flanking the XRE sites. Conversely, cotreatment with TCDD reduced occupancy by the cofactors p300 and SRC-1 while preventing acetylation of the core histone H4. The repressive effects of TCDD on BRCA-1 transcription were in agreement with findings of previous studies documenting inhibitory AhR-ER{alpha} crosstalk on E2-responsive genes. For example, Marlowe et al. (29) reported that following treatment with TCDD, the AhR displaced p300 leading to repression of S phase–specific genes. Thus, AhR ligand activation may lead to silencing of BRCA-1 promoter activity by displacing the coactivators p300 and SRC-1, thus increasing the recruitment of HDAC1 and possibly other corepressors. This notion is supported by our results showing that overexpression of HDAC1 abrogated BRCA-1 promoter activity and TCDD decreased the accumulation of E2-stimulted H4 histone acetylation.

Although the transactivating functions of the AhR at XREs are enhanced by the association with the adaptor molecule ARNT (18, 48, 49), we did not examine the recruitment of ARNT to the BRCA-1 promoter. Although it is possible that ARNT may contribute to transcriptional repression of BRCA-1, studies by Brunnberg et al. (50) reported that ARNT was found to potently enhance transcriptional activity of ERß and, to a lesser degree, ER{alpha}. In this study, we focused our attention of the role of AhR based on the information the AhR, but not ARNT, physically interacts with the unliganded ER{alpha} and ERß (26). The fact the BRCA-1 promoter harbors more than one XRE suggests that the multiplicity of AhR binding sites may assist in increasing the stability of transcription complexes containing the ER{alpha} and augment accessibility to cofactors. This interpretation finds support in results of previous investigations with the CYP1A1 gene documenting that the presence of multiple binding sites for the AhR contributed to stabilization of chromatin in an accessible configuration (51, 52).

Figure 7A depicts a schematic representation of the crosstalk between the unliganded AhR and ER{alpha} at the BRCA-1 promoter. A possible implication of this proposed model is that antagonists that block the translocation of the AhR to the nucleus may interfere with estrogen-regulated BRCA-1 expression. Figure 7B illustrates a model in which the recruitment of the liganded AhR to XREs displaces cofactors and prevents the interaction of the AhR with the liganded ER{alpha}. Because BRCA-1 expression peaks in S phase (53, 54) and BRCA-1 protein is involved in cell cycle control and DNA repair functions (3, 55), the positive interaction between the AhR and the ER{alpha} may play a critical role in regulation of cell cycle progression by modulating the expression of BRCA-1. On the other hand, the physiologic function of the activated AhR may be to sense exposure to environmental and dietary AhR-ligands and repress BRCA-1 expression and cell cycle progression. The continuation of these studies in vivo may assist in the validation of the proposed model of BRCA-1 regulation by the AhR and ER{alpha}.


Figure 7
View larger version (20K):
[in this window]
[in a new window]
 
Figure 7. Proposed model that integrates the crosstalk between the ER{alpha} and AhR in transcriptional regulation of BRCA-1 by E2. A, in the presence of E2, the unliganded AhR bound to the XREs contacts the liganded ER{alpha} recruited at an AP-1 site (37) and assists in the stabilization of a transcription complex that is composed of p300 and SRC-1. The recruitment of the AhR to this complex is prevented by antagonists of the AhR leading to loss of E2-induction of BRCA-1 transcription. B, in contrast, binding of agonists to the AhR stimulates the recruitment of the ligand-activated AhR to XREs interfering with promoter occupancy by the cofactors p300 and SRC-1 while recruiting HDAC1. The possible role of multiple XREs in regulation of BRCA-1 promoter is discussed in the text.

 

    Acknowledgments
 
Grant support: NIH grant ES009966 (D.F. Romagnolo), the Arizona Disease Research Commission grant 8015 (D.F. Romagnolo), the Southwest Environmental Health Sciences Center grant ES006694, and NIH Predoctoral Training grant ES007091 (J.K. Hockings).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank S. Kato (University of Tokyo, Tokyo, Japan) for pER{alpha}{Delta}AhR; C.L. Smith (Baylor College of Medicine, Houston, TX) for pER{alpha}; I. Talianidis (Institute of Molecular and Biotechnology, Crete, Greece) for the myc-HDAC1 plasmid; and E.A. Mash (Southwest Environmental Health Sciences Core Facility, University of Arizona, Tucson, AZ) for synthesis of 3M4NF.

Received 5/10/05. Revised 11/ 7/05. Accepted 12/ 2/05.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. MacLachlan TK, Takimoto R, El-Deiry WS. BRCA1 directs a selective p53-dependent transcriptional response towards growth arrest and DNA repair targets. Mol Cell Biol 2002;22:4280–92.[Abstract/Free Full Text]
  2. Wang Y, Cortez D, Yazdi P, Neff N, Elledge SJ, Qin J. BASC, a super complex of BRCA1-associated proteins involved in the recognition and repair of aberrant DNA structures. Genes Dev 2000;14:927–39.[Abstract/Free Full Text]
  3. Xu B, Kim St, Kastan MB. Involvement of Brca1 in S-phase and G(2)-phase checkpoints after ionizing irradiation. Mol Cell Biol 2001;21:3445–50.[Abstract/Free Full Text]
  4. Wilson CA, Ramos L, Villasenor MR, et al. Localization of human BRCA1 and its loss in high-grade, non-inherited breast carcinomas. Nat Genet 1999;21:236–40.[CrossRef][Medline]
  5. American Cancer Society. Cancer facts and figures; 2005.
  6. Hilakivi-Clarke L, Cabanes A, Olivo S, Kerr L, Bouker KB, Clarke R. Do estrogens always increase breast cancer risk. J Steroid Biochem Mol Biol 2000;80:163–74.
  7. Huska LJ, Williams JS, Greenlee WF. Characterization of 2,3,7,8-tetrachlorodibenzofuran-dependent suppression and AH receptor pathway gene expression in the developing mouse mammary gland. Toxicol Appl Pharmacol 1998;152:200–10.[CrossRef][Medline]
  8. Vorderstrasse BA, Fenton SE, Bohn AA, Cundiff JA, Lawrence BP. A novel effect of dioxin: exposure during pregnancy severely impairs mammary gland differentiation. Toxicol Sci 2004;78:248–57.[Abstract/Free Full Text]
  9. Gierthy JF, Lincoln DW, Gillespie MB, et al. Suppression of estrogen-regulated extracellular tissue plasminogen activator activity of MCF-7 cells by 2,3,7,8-tetrachlorodibenzo-p-dioxin. Cancer Res 1987;47:6198–203.[Abstract/Free Full Text]
  10. Holcomb M, Safe S. Inhibition of 7,12-dimethylbenzanthracene-induced rat mammary tumor growth by 2,3,7,8-tetrachlorodibenzo-p-dioxin. Cancer Lett 1994;15:43–7.
  11. Nebert DW, Petersen DD, Fornace AJ, Jr. Cellular responses to oxidative stress: the [Ah] gene battery as a paradigm. Environ Health Perspect 1990;88:13–25.[Medline]
  12. Dragan YP, Schrenk D. Animal studies addressing the carcinogenicity of TCDD (or related compounds) with an emphasis on tumour promotion. Food Addit Contam 2000;17:289–302.[CrossRef][Medline]
  13. Hooper K, Petreas MX, Chuvakova T, et al. Analysis of breast milk to assess exposure to chlorinated contaminants in Kazakhstan: high levels of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in agricultural villages of southern Kazakhstan. Environ Health Perspect 1998;106:797–806.[Medline]
  14. Weiss J, Papke O, Bignert A, et al. Concentrations of dioxin and other organochlorines (PCBs, DDTs, HCHs) in human milk from Seveso, Milan and a Lombardian rural area in Italy: a study performed 25 years after the heavy dioxin exposure in Seveso. Acta Paediatr 2003;92:467–72.[Medline]
  15. Hattemer-Frey HA, Travis CC. Benzo-a-pyrene: environmental partitioning and human exposure. Toxicol Ind Health 1991;3:141–57.
  16. Scherer G, Frank S, Riedel K, Meger-Kossien I, Renner T. Biomonitoring of exposure to polycyclic aromatic hydrocarbons of nonoccupationally exposed persons. Cancer Epidemiol Biomarkers Prev 2000;9:373–80.[Abstract/Free Full Text]
  17. Burbach KM, Poland A, Bradfield CA. Cloning of the Ah-receptor cDNA reveals a distinctive ligand-activated transcription factor. Proc Natl Acad Sci U S A 1992;89:8185–9.[Abstract/Free Full Text]
  18. Reyes H, Reisz-Porszasz S, Hankinson O. Identification of the Ah receptor nuclear translocator protein (Arnt) as a component of the DNA binding form of the Ah receptor. Science 1992;256:1193–5.[Abstract/Free Full Text]
  19. Wang F, Samudio I, Safe S. Transcriptional activation of cathepsin D gene expression by 17ß-estradiol: mechanism of aryl hydrocarbon receptor-mediated inhibition. Mol Cell Endocrinol 2001;172:91–103.[CrossRef][Medline]
  20. Krishnan V, Porter W, Santostefano M, Wang X, Safe S. Molecular mechanism of inhibition of estrogen-induced cathepsin D gene expression by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in MCF-7 cells. Mol Cell Biol 1995;15:6710–9.[Abstract]
  21. Gillesby B, Santostefano M, Porter W, Zu ZF, Safe S, Zacharewski T. Identification of a motif within the 5'-regulatory region on pS2 which is responsible for Ap1 binding and TCDD-mediated suppression. Biochemistry 1997;36:6080–9.[CrossRef][Medline]
  22. Duan R, Porter W, Samudio I, Vyhlidal C, Kladde M, Safe S. Transcriptional activation of c-fos protooncogene by 17ß-estradiol: mechanism of aryl hydrocarbon receptor-mediated inhibition. Mol Endocrinol 1999;13:1511–21.[Abstract/Free Full Text]
  23. Zacharewski TR, Bondy KL, McDonell P, Wu ZF. Antiestrogenic effect of 2,3,7,8-tetrachlorodibenzo-p-dioxin on 17 ß-estradiol-induced pS2 expression. Cancer Res 1994;54:2707–13.[Abstract/Free Full Text]
  24. Safe S, Wang F, Porter W, Duan R, McDougal A. Ah receptor agonists as endocrine disrupors: antiestrogenic activity and mechanisms. Toxicol Lett 1998;102–3:343–7.
  25. Ricci MS, Toscano DG, Mattingly CJ, Toscano WA, Jr. Estrogen receptor reduces CYP1A1 induction in cultured human endometrial cells. J Biol Chem 1999;274:3430–8.[Abstract/Free Full Text]
  26. Ohtake F, Takeyama KI, Matsumoto T, et al. Modulation of oestrogen receptor signalling by association with the activated dioxin receptor. Nature 2003;423:545–50.[CrossRef][Medline]
  27. Gozgit JM, Nestor KM, Fasco MJ, Pentecost BT, Arcaro KF. Differential action of polycyclic aromatic hydrocarbons on endogenous estrogen-responsive genes and on a transfected estrogen-responsive reporter in MCF-7 cells. Toxicol Appl Pharmacol 2004;196:58–67.[CrossRef][Medline]
  28. Spink DC, Hayes CL, Young NR, et al. The effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin on estrogen metabolism in MCF-7 breast cancer cells: evidence for induction of a novel 17ß-estradiol 4-hydroxylase. J Steroid Biochem Mol Biol 1994;51:251–8.[CrossRef][Medline]
  29. Marlowe JL, Knudsen ES, Schwemberger S, Puga A. The aryl hydrocarbon receptor displaces p300 from E2F-dependent promoters and represses S phase-specific gene expression. J Biol Chem 2004;279:29013–22.[Abstract/Free Full Text]
  30. Jeffy BD, Hockings JK, Kemp MQ, et al. An estrogen receptor-{alpha}p300 complex activates the BRCA-1 promoter at an AP-1 site that binds Jun/Fos transcription factors: repressive effects of p53 on BRCA-1 transcription. Neoplasia 2005;7:873–82.[CrossRef][Medline]
  31. Jeffy BD, Schultz EU, Selmin O, Gudas JM, Bowden GT, Romagnolo DF. Inhibition of BRCA-1 expression by benzo(a)pyrene and its diol epoxide. Mol Carcinog 1999;26:100–18.[CrossRef][Medline]
  32. Jeffy BD, Chirnomas RB, Chen EJ, Gudas JM, Romagnolo DF. Activation of the aromatic hydrocarbon receptor pathway is not sufficient for transcriptional repression of BRCA-1: requirements for metabolism of benzo(a)pyrene to 7r,8t-dihydroxy-9t,10-epoxy-7,8,9,10-tetrahydrobenzo(a)pyrene. Cancer Res 2002;62:113–21.[Abstract/Free Full Text]
  33. Romagnolo D, Annab LA, Thompson TE, et al. Estrogen upregulation of BRCA1 expression with no effect on localization. Mol Carcinog 1998;22:102–9.[CrossRef][Medline]
  34. Selmin O, Thorne PA, Blachere FM, Johnson PD, Romagnolo DF. Transcriptional activation of the membrane-bound progesterone receptor (mPR) by dioxin, in endocrine-responsive tissues. Mol Reprod Dev 2005;70:166–74.[CrossRef][Medline]
  35. Xu CF, Chambers JA, Solomon E. Complex regulation of the BRCA1 gene. J Biol Chem 1997;272:20994–7.[Abstract/Free Full Text]
  36. Marks JR, Huper G, Vaughn JP, et al. BRCA1 expression is not directly responsive to estrogen. Oncogene 1997;14:115–21.[CrossRef][Medline]
  37. Henry EC, Kende AS, Rucci G, et al. Flavone antagonists bind competitively with 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) to the aryl hydrocarbon receptor but inhibit nuclear uptake and transformation. Mol Pharmacol 1999;55:716–25.[Abstract/Free Full Text]
  38. Lu YF, Santostefano M, Cunningham BD, Threadgill MD, Safe S. Identification of 3'-methoxy-4'-nitroflavone as a pure aryl hydrocarbon (Ah) receptor antagonist and evidence for more than one form of the nuclear Ah receptor in MCF-7 human breast cancer cells. Arch Biochem Biophys 1995;316:470–7.[CrossRef][Medline]
  39. Merchant M, Arellano L, Safe S. The mechanism of action of {alpha}-naphthoflavone as an inhibitor of 2,3,7,8-tetrachlorodibenzo-p-dioxin-induced CYP1A1 gene expression. Arch Biochem Biophys 1990;281:84–9.[CrossRef][Medline]
  40. Reen RK, Cadwallader A, Perdew GH. The subdomains of the transctivation domain of the aryl hydrocarbon receptor (AhR) inhibit AhR and estrogen receptor transcriptional activity. Arch Biochem Biophys 2002;408:93–102.[CrossRef][Medline]
  41. Klinge CM, Bowers JL, Kulakosky PC, Kamboj KK, Swanson HI. The aryl hydrocarbon receptor (AHR)/AHR nuclear translocator (ARNT) heterodimer interacts with naturally occurring estrogen response elements. Mol Cell Endocrinol 1999;157:105–19.[CrossRef][Medline]
  42. Porter W, Wang F, Duan R, et al. Transcriptional activation of heat shock protein 27 gene expression by 17ß-estradiol and modulation by antiestrogens and aryl hydrocarbon receptor agonists. J Mol Endocrinol 2001;26:31–42.[Abstract]
  43. Wormke M, Stoner M, Saville B, et al. The aryl hydrocarbon receptor mediates degradation of estrogen receptor {alpha} through activation of proteasomes. Mol Cell Biol 2003;23:1843–55.[Abstract/Free Full Text]
  44. Shiverick KT, Muther TF. Effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin on serum concentrations and the uterotrophic action of exogenous estrone in rats. Toxicol Appl Pharmacol 1982;65:170–6.[CrossRef][Medline]
  45. Dertinger SD, Lantum HB, Silverstone AE, Gasiewicz TA. Effect of 3'-methoxy-4'-nitroflavone on benzo(a)pyrene toxicity. Aryl hydrocarbon receptor-dependent and -independent mechanisms. Biochem Pharmacol 2000;60:189–96.[CrossRef][Medline]
  46. Merchant M, Krishnan V, Safe S. Mechanism of action of {alpha}-naphthoflavone as an Ah receptor antagonist in MCF-7 human breast cancer cells. Toxicol Appl Pharmacol 1993;120:179–85.[CrossRef][Medline]
  47. Hestermann EV, Brown M. Agonist and chemopreventative ligands induce differential transcriptional cofactor recruitment by aryl hydrocarbon receptor. Mol Cell Biol 2003;23:7920–5.[Abstract/Free Full Text]
  48. Sogawa K, Nakano R, Kobayashi A, et al. Possible function of Ah receptor nuclear translocator (Arnt) homodimer in transcriptional regulation. Proc Natl Acad Sci U S A 1995;92:1936–40.[Abstract/Free Full Text]
  49. Whitelaw M, Pongratz I, Wilhelmsson A, Gustafsson JA, Poellinger L. Ligand-dependent recruitment of the Arnt coregulator determines DNA recognition by the dioxin receptor. Mol Cell Biol 1993;13:2504–14.[Abstract/Free Full Text]
  50. Brunnberg S, Pettersson K, Rydin E, Matthews J, Hanberg A, Pongratz I. The basic helix-loop-helix-PAS protein ARNT functions as a potent coactivator of estrogen receptor-dependent transcription. Proc Natl Acad Sci U S A 2003;100:6517–22.[Abstract/Free Full Text]
  51. Ko HP, Okino ST, Ma Q, Whitlock JP, Jr. Dioxin-induced CYP1A1 transcription in vivo: the aromatic hydrocarbon receptor mediates transactivation, enhancer-promoter communication, and changes in chromatin structure. Mol Cell Biol 1996;16:430–6.[Abstract]
  52. Okino ST, Whitlock JP, Jr. Dioxin induces localized, graded changes in chromatin structure: implications for Cyp1A1 gene transcription. Mol Cell Biol 1995;15:3714–21.[Abstract]
  53. Chen Y, Farmer AA, Chen CF, Jones DC, Chen PL, Lee WH. BRCA1 is a 220-kDa nuclear phosphoprotein that is expressed and phosphorylated in a cell cycle-dependent manner. Cancer Res 1996;56:3168–72.[Abstract/Free Full Text]
  54. Gudas JM, Li T, Nguyen H, Jensen D, Rauscher FJ III, Cowan KH. Cell cycle regulation of BRCA1 messenger RNA in human breast epithelial cells. Cell Growth Differ 1996;7:717–23.[Abstract]
  55. Scully R, Chen J, Ochs RL, et al. Dynamic changes of BRCA1 subnuclear location and phosphorylation state are initiated by DNA damage. Cell 1997;90:425–35.[CrossRef][Medline]



This article has been cited by other articles:


Home page
J Mol EndocrinolHome page
E. Swedenborg, J. Ruegg, S. Makela, and I. Pongratz
Endocrine disruptive chemicals: mechanisms of action and involvement in metabolic disorders
J. Mol. Endocrinol., July 1, 2009; 43(1): 1 - 10.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. I. Karchner, M. J. Jenny, A. M. Tarrant, B. R. Evans, H. J. Kang, I. Bae, D. H. Sherr, and M. E. Hahn
The Active Form of Human Aryl Hydrocarbon Receptor (AHR) Repressor Lacks Exon 8, and Its Pro185 and Ala185 Variants Repress both AHR and Hypoxia-Inducible Factor
Mol. Cell. Biol., July 1, 2009; 29(13): 3465 - 3477.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
J. J. Gorski, R. D. Kennedy, A. M. Hosey, and D. P. Harkin
The Complex Relationship between BRCA1 and ER{alpha} in Hereditary Breast Cancer
Clin. Cancer Res., March 1, 2009; 15(5): 1514 - 1518.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
S. C. Degner, A. J. Papoutsis, O. Selmin, and D. F. Romagnolo
Targeting of Aryl Hydrocarbon Receptor-Mediated Activation of Cyclooxygenase-2 Expression by the Indole-3-Carbinol Metabolite 3,3'-Diindolylmethane in Breast Cancer Cells
J. Nutr., January 1, 2009; 139(1): 26 - 32.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
R. Singhal, K. Shankar, T. M. Badger, and M. J. Ronis
Estrogenic status modulates aryl hydrocarbon receptor--mediated hepatic gene expression and carcinogenicity
Carcinogenesis, February 1, 2008; 29(2): 227 - 236.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
S.M. Coutts, N. Fulton, and R.A. Anderson
Environmental toxicant-induced germ cell apoptosis in the human fetal testis
Hum. Reprod., November 1, 2007; 22(11): 2912 - 2918.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hockings, J. K.
Right arrow Articles by Romagnolo, D. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hockings, J. K.
Right arrow Articles by Romagnolo, D. F.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online