Cancer Research Meeting Calendar  Jordan
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Singhal, S. S.
Right arrow Articles by Awasthi, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Singhal, S. S.
Right arrow Articles by Awasthi, S.
[Cancer Research 66, 2354-2360, February 15, 2006]
© 2006 American Association for Cancer Research


Experimental Therapeutics, Molecular Targets, and Chemical Biology

Regression of Melanoma in a Murine Model by RLIP76 Depletion

Sharad S. Singhal1, Yogesh C. Awasthi2 and Sanjay Awasthi1

1 Department of Chemistry and Biochemistry, University of Texas at Arlington, Arlington and 2 Department of Human Biological Chemistry and Genetics, University of Texas Medical Branch at Galveston, Galveston, Texas

Requests for reprints: Sanjay Awasthi, Department of Chemistry and Biochemistry, 502 Yates Street, Science Hall Room 223, University of Texas at Arlington, Arlington, TX 76019-0065. Phone: 817-272-5444; Fax: 817-272-3808; E-mail: sawasthi{at}uta.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
RLIP76/RALBP1 is a stress-responsive membrane protein implicated in the regulation of multiple cellular signaling pathways. It represents the predominant glutathione-conjugate transporter in cells, and our previous studies have shown that its inhibition by antibodies or depletion by short interfering RNA (siRNA) causes apoptosis in a number of cancer cell types. The present studies were done to explore the potential clinical applicability of our previous observations by comparing the relative expression of RLIP76 in cancer versus normal cell lines and to determine whether depletion of RLIP76 activity can exert cancer-specific apoptosis. RLIP76 expression was found to be significantly greater in malignant cells compared to nonmalignant cells. Inhibition of RLIP76, using antibodies towards a cell surface epitope, or depletion of RLIP76 using either siRNA or antisense phosphorothioate oligonucleotides preferentially caused apoptosis in malignant cells. More importantly, in vivo studies showed that administration of RLIP76 antibodies, siRNA, or antisense oligonucleotides to mice bearing syngeneic B16 mouse melanoma cells caused complete tumor regression within 10 days. These findings strongly suggest that RLIP76 depletion by genetic approaches or inhibition by antibodies may be a clinically viable antineoplastic therapy, particularly for melanoma. (Cancer Res 2006; 66(4): 2354-60)


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Most presently available antineoplastic therapies for human malignancies are limited by the occurrence of significant normal tissue toxicities due to inherent relatively nonspecific genotoxic or signaling effects. Thus, attempts to improve antineoplastic therapies have focused on identifying targets which are preferentially expressed in cancer cells, which when inhibited, cause apoptosis in malignant cells although sparing cells of normal tissues. Delineation of differentially expressed signaling proteins that are responsible for unregulated growth and suppression of normal apoptotic pathways has led to the identification of numerous potential targets, which when inhibited should cause apoptosis preferentially in cancer cells while sparing normal cells. Some degree of success has been achieved in these endeavors, leading to the development of antibody drugs such as Rituxan (anti-CD20 antibody) for lymphoproliferative disorders (13), Herceptin (anti-Her-2/neu antibody) for breast cancer (4, 5), as well as small-molecule drugs including Gleevec (Bcr-Abl kinase inhibitor) for chronic myelogenous leukemia (6), and Tarceva (tyrosine kinase inhibitor) for a variety of solid tumors (7). The overall efficacy of these therapy is still limited because they are either effective only in a small fraction of patients with these malignancies, or due to clonal selection of cancer cells inherently refractory to these therapies. Thus, the development of new targeting molecules and the discovery of new targets remains a major objective in the development of oncological therapeutics.

RLIP76 (RALBP1) represents a novel potential target for cancer therapy not only because it represents a rate-controlling step in glutathione (GSH)-mediated metabolism of electrophilic or oxidant chemicals often used as antineoplastic agents, but also because of its apparent linkages to key signaling pathways known to be crucial for the survival, proliferation, and motility of malignant cells (816). In recent studies, we have shown that lack of RLIP76 in knockout mice leads to loss of nearly 4/5 of total GSH-conjugate (GS-E) as well as anthracycline-transport activity, and widespread changes in GSH-linked antioxidant enzymes (17). In addition, endocytosis-mediated signal termination of varied signaling ligands including insulin, epidermal growth factor (EGF), and transforming growth factor (TGF) is affected by loss of RLIP76 (12, 1821). RLIP76–/– mice develop a characteristic sensitivity to stress, particularly to ionizing radiation (17). These animal studies, as well as several studies by us and others in cell culture systems, have implicated RLIP76 as a part of stress defenses (22, 23), as well as a modulator of signaling through Ras, Ral (11), cdc-2 (19), cdc-42 (11), heat-shock proteins (24), EGF, TGF, and insulin (12, 1821). Most remarkably, inhibition of RLIP76 transport function using antibodies to a cell surface epitope or depletion of RLIP76 using short interfering RNA (siRNA) uniformly causes apoptosis in a wide variety of histologic types of cancers in cell culture (2531). The potential clinical applicability of RLIP76 inhibition or depletion depends on the demonstration of some degree of specificity of apoptosis directed at cancer cells, either due to greater expression of RLIP76 in cancer cells, greater dependence of cancer cell on RLIP76 to defend against stress, or a greater susceptibility of cancer cells to agents which deplete RLIP76.

In the present studies, we examined these possibilities by using anti-RLIP76 IgG as a specific inhibitor, as well as both siRNA and antisense DNA oligonucleotides for specific depletion of RLIP76 in cell culture models of malignant and nonmalignant cells and extended these studies in vivo, using a syngeneic B16 mouse melanoma model. Results presented in this article indicate that RLIP76 is expressed to a greater degree in malignant cells, that RLIP76 inhibition or depletion causes preferential toxicity towards malignant cells, and that anti-RLIP76 antibodies as well as RLIP76-depleting siRNA or antisense phosphorothioate oligonucleotides exert significant antineoplastic effects in an animal model of melanoma.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Reagents. Keratinocyte serum-free medium (K-SFM) supplemented with 5 ng/mL EGF, 50 µg/mL bovine pituitary extract, and 2 mmol/L L-glutamine was purchased from Invitrogen, Carlsbad, CA. RPMI 1640, Ham's F12 K and DMEM medium, PBS, penicillin/streptomycin solution (P/S), fetal bovine serum (FBS), trypsin-EDTA, and trypan blue were purchased from Life Technologies, Inc., Grand Island, NY. Medium EGM-2 Bullet Kit was purchased from Cambrex BioScience (Walkersville, MD). Reagents for SDS-PAGE were purchased from Bio-Rad Laboratories (Hercules, CA). Doxorubicin (Adriamycin) was obtained from Adria Laboratories (Columbus, OH). [14C]Doxorubicin (specific activity, 57 mCi/mmol) was purchased from Amersham Corporation (Arlington Heights, IL). [{gamma}-32P]ATP (specific activity, 3,000 Ci/mmol) was purchased from Perkin-Elmer Life and Analytical Sciences (Shelton, CT). FITC-conjugated goat anti-rabbit antibodies were purchased from Vector Laboratories, Inc., Burlingame, CA. Transmessenger Transfection Reagent kit were purchased from Qiagen (Valencia, CA). Ninety-six–well nitrocellulose membrane plates (pore size, 0.45 µm) used in transport studies were purchased from the Millipore Corp. (Bedford, MA). Fluorescein terminal deoxynucleotidyl transferase (TdT)–mediated nick end labeling (TUNEL) apoptosis assay kit was procured from Promega (Madison, WI). Sources of other reagents were the same as previously described (3234).

Cell lines and cultures. Human small cell lung cancer (SCLC) lines H1618 and non–small cell lung cancer (NSCLC) lines H358 (bronchioalveolar), PC-3 (human prostate), and B16 mouse skin melanoma were purchased from American Type Culture Collection (Manassas, VA). Human lung bronchioepithelial cells (HLBEC) were kindly provided by Dr. John D. Minna, University of Texas Southwestern Medical Center (Dallas, TX). Human aortic vascular smooth muscle (HAVSMC), human liver (HepG2), and human breast (MCF7) cells were kindly donated by Dr. Paul Boor and Dr. Ana Pajor, respectively, University of Texas Medical Branch at Galveston, Galveston, TX. Human umbilical vascular endothelial cells (HUVEC) and human lung macrovascular endothelial cells (HLMVEC) were kindly provided by Dr. Fiemu Nwariaku, University of Texas Southwestern Medical center (Dallas, TX). Human ovary carcinoma (OVCAR-3) cells were kindly provided by Dr. Maya Nair, University of North Texas Health Science Center, Fort Worth, TX. All cells were cultured at 37°C in a humidified atmosphere of 5% CO2 in the appropriate medium: RPMI 1640 (SCLC, NSCLC, human melanoma, and OVCAR-3), DMEM (HAVSMC, HepG2, B16 mouse melanoma, and MCF7), K-SFM (HLBEC), Ham's F12 K (PC-3), and EGM-2 bullet kit (HUVEC and HLMVEC) medium supplemented with 10% (v/v) heat-inactivated FBS, 1% (v/v) P/S solution, 2 mmol/L L-glutamine, 10 mmol/L HEPES, 1 mmol/L sodium pyruvate, 4.5 g/L glucose, and 1.5 g/L sodium bicarbonate.

Preparations of total crude membrane fractions for Western blot analyses. Cells were pelleted and washed thrice with balanced salt solution (138 mmol/L NaCl, 5 mmol/L KCl, 0.3 mmol/L KH2PO4, 0.3 mmol/L Na2HPO4, 4 mmol/L NaHCO3, and 5.6 mmol/L glucose, pH 7.4). Washed cells were lysed in 10 mmol/L Tris-HCl (pH 7.4), containing 1.4 mmol/L ß-mercaptoethanol (BME), 0.1 mmol/L phenylmethylsulfonyl fluoride (PMSF), 0.05 mmol/L butylated hydroxytoluene (BHT), 0.1 mmol/L EDTA, and 0.5% (v/v) polidocanol. Lysates were sonicated thrice for 30 seconds at 50 W and incubated for 4 hours at 4°C with occasional shaking. After incubation, the resultant preparation was centrifuged at 105,000 x g for 2 hours at 4°C. The supernatant was collected and aliquots of crude detergent membrane fraction of cells containing 200 µg protein were applied to SDS-PAGE (35, 36) and Western blot analyses were done according to the method of Towbin et al. (37). Levels of RLIP76 protein in normal and cancer cells were measured by ELISA assay using anti-RLIP76 IgG as previously described (29). Purified recombinant human RLIP76 with purity assessed by amino acid composition analysis was used to generate calibration curves.

Purification of RLIP76 from normal and cancer cells. Dinitrophenyl S-glutathione (DNP-SG) affinity purification of RLIP76 from membrane fraction of cell lines was done as described previously (35). Briefly, cells were pelleted and washed thrice with balanced salt solution (138 mmol/L NaCl, 5 mmol/L KCl, 0.3 mmol/L KH2PO4, 0.3 mmol/L Na2HPO4, 4 mmol/L NaHCO3, and 5.6 mmol/L glucose, pH 7.4). Washed cells were lysed in 10 mmol/L Tris-HCl (pH 7.4), containing 1.4 mmol/L BME, 0.1 mmol/L PMSF, 0.05 mmol/L BHT, and 0.1 mmol/L EDTA (lysis buffer). Lysates were sonicated (3 x 30 seconds, 50 W) and centrifuged at 100,000 x g for 60 minutes at 4°C. The pellets were resuspended in lysis buffer containing 0.25% polidocanol, incubated for 4 hours at 4°C, and centrifuged at 48,000 x g for 1 hour. Supernatants were applied to DNP-SG Sepharose affinity column and apparently homogenous RLIP76 was obtained following the protocols described previously for recombinant RLIP76 (30, 31). The ATPase activity of RLIP76 was measured as previously described (32, 35, 38). Protein was estimated by the method of Minamide and Bamburg (39). SDS-PAGE was done in the system described by Laemmli (36) and Western blot analysis was done by the method of Towbin et al. (37).

Anti-RLIP76 antibodies. We have raised and purified polyclonal rabbit anti-human RLIP76 antibodies using procedures described previously (30, 31) and aliquots were stored at –87°C. Anti-RLIP76 antibodies used in these experiments were previously shown by Ouchterlony double immunodiffusion assay to be non–cross-reactive with any other proteins including P-glycoprotein or multi-drug resistance protein 1 (35).

Preparation of crude membrane inside-out vesicles. Crude membrane vesicles (inside-out vesicles, IOV) were prepared from the normal cell lines (HAVSMC, HLBEC, HLMVEC, and HUVEC) and cancer cell lines (SCLC, NSCLC, DG-1 human melanoma, mouse B16 melanoma, MCF7, HepG2, PC-3, and OVCAR-3) using established procedures as described by us for the human erythrocytes (32) and K562 cells (30).

Transport studies in IOVs. Transport studies in IOVs were done by the same method as described previously (32, 33), but instead of the no-protein proteoliposome, we used heat-inactivated IOVs as negative controls.

Drug sensitivity assay. Cell density measurements were done using a hemocytometer to count dye-excluding cells resistant to staining with trypan blue. Approximately 2 x 104cells were plated into each well of a 96-well flat-bottomed microtiter plate 24 hours prior to addition of medium containing varying concentrations of either preimmune serum or anti-RLIP76 IgG (0-100 µg/mL final concentration). 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay was carried out 96 hours later as previously described (38) with eight replicate wells per measurement, and three separate experiments to determine IC50. Measured absorbance values were directly linked with a spreadsheet for calculation of IC50, defined as the concentration that reduced formazan formation by 50%.

Depletion of RLIP76 expression in cells by RLIP76-siRNA and RLIP76-phosphorothioate antisense oligonucleotide was measured as follows: cells were incubated for 3 hours with 0 to 4 µg/well with either RLIP76 siRNA or RLIP76 phosphorothioate antisense oligonucleotide in Transmessenger Transfection Reagent according to the manufacturer-provided (Qiagen) protocol. Cells were then washed with PBS, followed by 48 hours incubation at 37°C in medium before MTT assay (38). The extent of RLIP76 depletion using RLIP76 siRNA was further confirmed by Western blot analyses.

RLIP76 siRNA preparation. RLIP76 siRNA was purchased from Dharmacon Research (Lafayette, CO), as described previously (29).

Effect of anti-RLIP76 IgG on apoptosis by TUNEL assays. For adherent cells, aliquots of cells (1 x 106 cells) were placed into 12-well plates containing coverslips. After 24 hours incubation with medium, coverslips were incubated with either preimmune serum or anti-RLIP76 IgG (37 µg/mL final concentration) for 24 hours, and then washed off with PBS. For floating cells, which grow in suspension, 1 x 106 cells were placed into 12-well plates and allowed to grow for 24 hours into medium and incubated with either preimmune serum or anti-RLIP76 IgG (37 µg/mL final concentration) for 24 hours than washed off with PBS and transferred to histologic slides using Cytopro Cytocentrifuge (Wescor, Inc., Logan, UT). Apoptosis was determined by the labeling of DNA fragmentation by TUNEL assay. The TUNEL assays were used to label the free 3'-OH DNA ends characteristic to DNA fragmentation using the reaction catalyzed by TdT. The modified TUNEL assays were done by fluorescence immunohistochemistry using the Promega Apoptosis Detection System according to the protocol provided by the manufacturer. Slides were analyzed by laser scanning fluorescence microscope (LSM510 META, Zeiss, Jena, Germany) using a standard fluorescein filter set to view the green fluorescence at 520 nm, and red fluorescence at >620 nm. Photographs taken at identical exposure at 400x magnification are presented. Apoptotic cells show green fluorescence and characteristic cell shrinkage.

Animal model. C57 BL/6 mice were obtained from Lexicon Genetics (The Woodlands, TX) and colonies were bred at the Animal Care Facility, University of Texas at Arlington, Arlington, TX. All animal experiments were carried out in accordance with a protocol approved by the Institutional Animal Care and Use Committee. Twenty-one 16-week-old mice were divided into seven groups of three animals (treated with PBS, preimmune IgG, scrambled siRNA, scrambled phosphorothioate oligonucleotide, anti-RLIP76 IgG, RLIP76508-528 siRNA, and RLIP76508-528 phosphorothioate antisense oligonucleotide). All 21 animals were injected with 2 x 106 B16 mouse melanoma cell suspensions in 100 µL of PBS, s.c. Animals were examined daily for signs of tumor growth. Treatment was administered when the tumor surface area exceeded 45 mm2 (day 11). Treatment consisted of 200 µg of anti-RLIP76 IgG, RLIP76508-528 siRNA, or RLIP76508-528 phosphorothioate antisense oligonucleotide in 100 µL PBS. Control groups were treated with 200 µg/100 µL preimmune IgG, scrambled siRNA, or scrambled phosphorothioate antisense, or diluent (PBS) alone. Tumors were measured in two dimensions using calipers.

RLIP76 phosphorothioate DNA preparation. The region spanning amino acid residues 171 to 185 (nucleotides 510-555 starting from 1 AUG codon in the open reading frame) in the NH2-terminal region of RLIP76 was chosen as the target region for synthesis of phosphorothioate DNA. The oxygen in the backbone of the DNA molecules was replaced by sulfur in each phosphate group, which makes the DNA backbone resistant to nucleases. However, the macromolecule remains electrically charged, impeding its passage across cell membrane. The selected DNA sequence was subjected to BLAST search (National Center for Biotechnology Information database) against expressed sequence tag libraries to ensure that only the selected gene was targeted. Chemically synthesized phosphorothioate DNA in desalted form was purchased from Biosynthesis, Inc., (Lewisville, TX). A 21-nucleotide-long scrambled phosphorothioate DNA was used as a control. The scrambled DNA sequence was not homologous with RLIP76 cDNA in a BLAST search against RLIP76. The targeted cDNA sequence (AAGAAAAAGCCAATTCAGGAGCC) corresponds to nt508-528. The corresponding phosphorothioated DNA sequence was GGCTCCTGAATTGGCTTTTTC. The sequence of the scrambled DNA was CATCGAAATCGTTGCAGTTAC. Transfection of phosphorothioate DNA was done using Maxfect transfection reagent (MoleculA) and assayed for silencing 24 hours after transfection.


    Results and Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Malignant cells contain a greater quantity of antigenically detectable RLIP76. Preliminary studies involving Western blot analyses of malignant cells indicated relatively larger amounts of RLIP76 in malignant versus normal cells. We therefore quantitated RLIP76 in various cell lines of different origin. Total RLIP76 was purified from the membrane fraction of several malignant cell lines, including human SCLC (H1618), NSCLC (H358), ovarian (OVCAR-3), breast (MCF-7), prostate (PC-3), liver (HepG2), melanoma (DG-1), mouse melanoma (B16-F1), and nonmalignant human cell lines of endothelial (HUVEC, HLMVEC), epithelial (HLBEC), and aortic smooth muscle (HAVSMC) origin. Purification tables for each are provided (Supplemental Table A), and SDS-PAGE and Western blot analyses of purified protein against anti-RLIP76 IgG are shown (Supplemental Fig. A). Purification folds of 120 to 153 were observed, and single protein band of intact RLIP76 were seen in SDS-PAGE, which were recognized by the anti-RLIP76 antibodies in Western blot analyses. No significant contamination was observed. Purified protein was quantified by ELISA and results are presented (Table 1). Western blot analyses of crude membrane fraction from each cell with lanes loaded with equal amounts of crude protein (200 µg) are shown (Fig. 1). These results showed the presence of RLIP76 in all cell lines, and a relatively greater amount of RLIP76 in malignant cells compared with nonmalignant cells. The exceptions to this were the MCF-7 breast cancer and the HepG2 hepatocellular carcinoma cell lines which contained very low levels of RLIP76, similar to that seen in nonmalignant cells.


View this table:
[in this window]
[in a new window]
 
Table 1. RLIP76 protein and transport activity in malignant and nonmalignant cell lines

 

Figure 1
View larger version (47K):
[in this window]
[in a new window]
 
Figure 1. Comparison of RLIP76 levels in cultured malignant cells versus nonmalignant cells. Aliquots of crude detergent extracts of the membrane fractions of malignant cells (H1618, H358, OVCAR-3, PC-3, MCF-7, B16, HepG2, and DG-1) and nonmalignant cells (HAVSM, HUVEC, HLMVEC, and HLBEC), containing 200 µg protein were used for SDS-PAGE and Western blotting against anti-RLIP76 IgG as primary antibody and horseradish peroxidase–conjugated goat anti-rabbit IgG as secondary antibody and developed with 4-chloro-1-napthol as chromogenic substrate. Results were quantified by scanning densitometry of the full-length RLIP76 protein band near 109 kDa. ß-Actin was used as an internal control.

 
Transport activity of RLIP76 is greater in malignant cells. Because RLIP76 represents the major transporter of doxorubicin as well as DNP-SG, as observed both in cell line studies (29) and in knockout mice (17), we examined whether the content of RLIP76 protein in these cells correlated with the total transport activity for these RLIP76 substrates in crude membrane vesicles. Membrane vesicles were prepared from plasma membrane fractions from each cell line, and enriched for the IOVs by wheat germ agglutinin affinity chromatography as previously described (32). Results of measurements of ATP-dependent transport of 14C-doxorubicin as well as 3H-DNP-SG, using a standardized 96-well plate transport assay (32), revealed greater transport of both substrates in cells containing greater amounts of RLIP76 protein, and a general correlation between RLIP76 protein level and transport activity (Table 1). The greatest transport activity was found in melanoma cells, and transport activity in malignant cells was generally greater than in nonmalignant cells, with the exception of MCF-7 and HepG2. Lower expression of RLIP76 in MCF-7 and HepG2 correlated with lower transport rates in the crude membrane vesicles (Table 1). An excellent correlation was observed between measured total doxorubicin or DNP-SG transport rate and either RLIP76 protein (Table 1) or RLIP76 ATPase activity (Supplemental Table A).

RLIP76 inhibition or depletion caused preferential cytotoxicity in malignant cells. The effect of RLIP76 inhibition by anti-RLIP76 IgG, or depletion by RLIP76 siRNA508-528 were examined by incubation with varying concentrations of either anti-RLIP76 IgG or RLIP76 siRNA508-528 followed by MTT assay. The optimal timing for the appearance of apoptosis after exposure to anti-RLIP76 IgG has previously been determined to be 96 hours (26), and concentration dependence studies have shown saturable effects with maximum cell kill near 40 µg/mL. This previously observed behavior of anti-RLIP76 IgG was confirmed in present studies in which maximum inhibition was observed near 40 µg/mL by MTT assay (data not presented). Whereas the preimmune IgG caused no significant cell kill, anti-RLIP76 caused cell kill which was greater for the malignant cell lines (P < 0.01). The two malignant cell lines, MCF-7 and HepG2, which had the lowest expression of RLIP76 and lowest transport activity towards doxorubicin and DNP-SG were also least susceptible to anti-RLIP76 IgG (Table 1). Maximal susceptibility was observed with the melanoma cell lines and the SCLC cell line (Fig. 2A).


Figure 2
View larger version (40K):
[in this window]
[in a new window]
 
Figure 2. Comparison of cytotoxicity effects of anti-RLIP76 IgG and RLIP76 siRNA between malignant and nonmalignant cells. A, effect of preimmune IgG (gray columns) and anti-RLIP76 IgG (white columns; 37 µg/mL final concentration) on cell survival was determined by MTT assay (38). B, depletion of RLIP76 expression in cells by RLIP76 siRNA was done, using Transmessenger Transfection Reagent Kit, according to the manufacturer's (Qiagen) instructions. Briefly, B16 melanoma (malignant) and HLMVEC (nonmalignant) cells were incubated for 3 hours with various concentrations of siRNA (ranging from 0 to 100 µg/mL final concentration) in Transmessenger Transfection Reagent, washed with PBS, followed by 48 hours of incubation at 37°C in medium before Western blotting with anti-RLIP76 IgG as primary antibody. C, the time-dependent effect of RLIP76 siRNA (fixed at 20 µg/mL final concentration) were also evaluated using eight malignant and four nonmalignant cells by determining RLIP76 protein levels by Western blot analyses at 0, 6, 12, 24, and 48 hours, after treatment of RLIP76 siRNA, using anti-RLIP76 IgG as primary antibody. D, MTT assay in eight malignant and four nonmalignant cells was also done 48 hours after treatment of siRNA: scrambled siRNA (gray columns) and RLIP76 siRNA (white columns; 20 µg/mL final concentration), using Transmessenger Transfection Reagent Kit (Qiagen). B and C, internal control (ß-actin) is shown below the respective Western blots from each cell line. A and D, columns, mean from three separate determinations with eight replicates each; bars, ± SD (n = 24).

 
Studies of the concentration-dependent effects of RLIP76 siRNA508-528 revealed complete depletion of RLIP76 protein after 24 to 48 hours at a concentration of 20 µg/mL. The nonmalignant cells were somewhat less sensitive to RLIP76 depletion as compared with malignant cells. For example, 10 µg/mL siRNA affected B16 melanoma cells significantly more than HLMVEC (Fig. 2B). The time for maximal depletion of RLIP76 protein was also determined by exposing cells to 40 µg/mL RLIP76 siRNA508-528 and performing Western blot analyses after varying times of exposure. The relative resistance of nonmalignant cells to RLIP76 depletion by siRNA was also observed in these time-dependence studies (Fig. 2C), in which several nonmalignant cell lines (HLMVEC, HLBEC, HAVSM, and HUVEC), were relatively less affected with respect to RLIP76 protein at 24 and 48 hours as compared with the malignant cell lines (B16, DG1, Ovcar-3, PC-3, H358, and H1618). Again, the behavior of MCF-7 and HepG2 cell lines was more like the nonmalignant cells, with lower overall levels of RLIP76 expression, and lower sensitivity to depletion of RLIP76 by the siRNA. In MTT cytotoxicity assays, RLIP76 siRNA508-528 killed the malignant cells in a concentration-dependent manner with relative sparing of the nonmalignant cells, again with the exception of MCF-7 and HepG2 (Fig. 2D). The relative efficacy of cell kill was greater with the siRNA (Fig. 2D) as compared with anti-RLIP76 IgG (Fig. 2A) in these cell culture studies. TUNEL assay for apoptosis done with anti-RLIP76 IgG revealed results consistent with those observed with the MTT assay (Fig. 3), with greater apoptosis seen in the malignant as compared with nonmalignant cells.


Figure 3
View larger version (40K):
[in this window]
[in a new window]
 
Figure 3. Effect of anti-RLIP76 IgG on apoptosis as determined by TUNEL assay. Malignant cells (H358, OVCAR-3, PC-3, and B16 melanoma) and nonmalignant cells (HAVSMC, HUVEC) were treated with either preimmune serum or anti-RLIP76 IgG (37 µg/mL final concentration) for 24 hours and then washed off with PBS. Approximately 1 x 106 cells were fixed onto poly-L-lysine-coated slides, and the TUNEL apoptosis assay was done using the Promega Apoptosis Detection Kit according to the protocol provided by the manufacturer. Slides were analyzed by laser scanning fluorescence microscope (Zeiss LSM510 META). Photographs taken at identical exposures (x400 magnification). Apoptotic cells show green fluorescence.

 
Anti-RLIP76, siRNA or antisense DNA caused complete regression of B16 melanoma in mice. The above observations of the antineoplastic effects of RLIP76 depletion were examined in a syngeneic mouse B16 melanoma model. C57B mice were injected on their flanks with 1 x 106 B16-F1 melanoma cells and tumors were measured by calipers daily. When the surface area of the tumor (product of bidimensional measurements) exceeded 40 mm2 (day 11), animals were injected i.p. with 100 µL diluent alone (PBS), or the same volume of diluent containing 200 µg anti-RLIP76 IgG, RLIP76 siRNA508-528, or RLIP76 phosphorothioate antisense508-528. Additional control animals were injected with preimmune IgG, scrambled siRNA, or antisense. Results of tumor measurements are presented with all control groups (including PBS, preimmune IgG, scrambled siRNA, or antisense) versus all treated groups (including anti-RLIP76 IgG, RLIP76 siRNA508-528, or RLIP76 phosphorothioate antisense508-528), separately (Fig. 4). The tumors regressed completely in all animals treated with either of the RLIP76-inhibiting/depleting therapy, whereas uncontrolled growth was observed in the control groups. Photographs of animals taken at 8 days after treatment are shown for all treatment groups (Fig. 4, right). Regrowth of tumors was seen in all treated animals beginning at ~day 30. Animals were treated again at day 33 with the same therapy, resulting in stabilization of disease (shown in Fig. 4, left). These striking findings indicate that RLIP76-depleting/inhibiting agents have dramatic activity against mouse melanoma.


Figure 4
View larger version (39K):
[in this window]
[in a new window]
 
Figure 4. Antineoplastic effects of RLIP76 inhibition or depletion in mouse melanoma. C57B mice were injected on their flanks with 2 x 106 B16 melanoma cells and tumors were measured by calipers. When the surface area of the tumor (product of bidimensional measurements) exceeded 40 mm2 (day 11), animals were injected i.p. with 100 µL diluent alone (PBS), or the same volume of diluent containing 200 µg of anti-RLIP76 IgG, RLIP76 siRNA508-528, or RLIP76 phosphorothioate antisense508-528. Additional control animals were injected with preimmune IgG, scrambled siRNA, or antisense. Left, tumor measurements for the index lesion are presented with all control groups ({blacklozenge}), preimmune IgG ({blacksquare}), scrambled siRNA ({blacktriangleup}) or antisense (x) versus all treated groups (*), anti-RLIP76 IgG (bullet), RLIP76 siRNA (+), or RLIP76 phosphorothioate antisense (–). Arrows, days on which treatment was given and repeated. Right, photographs of animals taken at 8 days after treatment are shown for all treatment groups.

 
The present results provide strong evidence for the overexpression of RLIP76 in certain malignant cells as compared with nonmalignant cells. Greater RLIP76 expression corresponded to greater transport activity for doxorubicin as well as DNP-SG. Furthermore, cells with greater expression of RLIP76 were relatively more dependent on this stress-defense protein as compared with cells with lower expression. The specificity of therapy was evident from the lack of effect of preimmune IgG, scrambled siRNA, or antisense as compared with the PBS control. Results of recent studies investigating the efficacy of novel targeted agents for therapy of melanoma using a syngeneic mouse B16 melanoma model (4044) were compared with the results of present studies. The present findings of regression of an established melanoma nodule with a single treatment 10 days after tumor implantation has not been observed in either of these previous studies in which partial treatment efficacy was observed only when treatment was begun at the time of tumor implantation.

Given the striking efficacy of this single-dose treatment in a highly resistant animal malignancy model as compared with previous therapies in the same model, advancing these therapies to a human clinical setting is strongly suggested. Animal studies are inherently limited because of the inability to obtain adequate toxicity data to compare the three different treatments with respect to relative toxicity. Because we did not explore the effects of varying doses in present studies, we cannot conclude which one of the three approaches would have greater clinical efficacy; this would of course depend on results of human clinical studies where therapeutic windows can be evaluated with respect to normal tissue versus cancer tissue toxicity. Whereas the anti-RLIP76 IgG was inferior to siRNA in cell culture studies, surprisingly, all three treatments were similar in efficacy on an equivalent dose basis in the animal model. The relatively greater efficacy of RLIP76 antibodies in vivo may be related to contributions of antibody-dependent cellular cytotoxicity, which is known to contribute significantly to the cytotoxic activity of other antibody therapies such as Rituxan and Herceptin (26). This would be a clear advantage of the antibody therapy. Because of the relatively controversial nature of gene therapy, the development of a humanized monoclonal antibody therapy targeting RLIP76 would seem to be a more reasonable avenue for further clinical development as compared with antisense therapy. However, the development of siRNA therapy would also seem to have one advantage: the relatively greater susceptibility towards RLIP76 depletion in malignant cells as compared with nonmalignant cells, an observation which could be exploited therapeutically.

Not all malignant cells overexpress RLIP76 as compared with nonmalignant cells: MCF-7 breast and HepG2 cells are clear examples. For MCF-7 cells, we have previously shown that RLIP76 represents only a 10% to 15% of total glutathione-conjugate and doxorubicin-transport mechanism, the remainder being accounted for by breast cancer resistance protein or multi-drug resistance protein-1 (45). These results do not rule out the possibility that other breast or hepatocellular carcinoma cell lines may be found which overexpress RLIP76. Taken together, our studies suggest that RLIP76, an important stress-defense signaling and transport protein, is present in relatively greater quantity in certain malignant cells including melanoma, ovarian cancer, prostate cancer, and lung cancer. Further studies in xenograft models with melanomas and the other susceptible cell lines are needed to show the general applicability of these observations prior to human clinical applications.


    Acknowledgments
 
Grant support: USPHS grant CA 77495 and CA104661 (S. Awasthi), EY 04396 and ES 021171 (Y.C. Awasthi), and the Cancer Research Foundation of North Texas (S. Singhal and S. Awasthi).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Dr. Nancy Rowe (Office of Information Technology, University of Texas at Arlington, Arlington, TX) for her assistance in the statistical analyses of the data.


    Footnotes
 
Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/).

Received 10/ 3/05. Revised 11/ 8/05. Accepted 12/ 9/05.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 

  1. Plosker GL, Figgitt DP. Rituximab: a review of its use in non-Hodgkin's lymphoma and chronic lymphocytic leukaemia. Drugs 2003;63:803–43.[CrossRef][Medline]
  2. Tohyama Y, Takano T, Yamamura H. B cell responses to oxidative stress. Curr Pharm Des 2004;10:835–9.[CrossRef][Medline]
  3. Jazirehi AR, Bonavida B. Cellular and molecular signal transduction pathways modulated by rituximab (rituxan, anti-CD20 mAb) in non-Hodgkin's lymphoma: implications in chemosensitization and therapeutic intervention. Oncogene 2005;24:2121–43.[CrossRef][Medline]
  4. Pegram MD, Pauletti G, Slamon DJ. HER-2/neu as a predictive marker of response to breast cancer therapy. Breast Cancer Res Treat 1998;52:65–77.[CrossRef][Medline]
  5. Ross JS, Fletcher JA, Bloom KJ, et al. Targeted therapy in breast cancer: the HER-2/neu gene and protein. Mol Cell Proteomics 2004;3:379–98.[Abstract/Free Full Text]
  6. Ren R. Mechanisms of BCR-ABL in the pathogenesis of chronic myelogenous leukaemia. Nat Rev Cancer 2005;5:172–83.[CrossRef][Medline]
  7. Bulgaru AM, Mani S, Goel S, Perez-Soler R. Erlotinib (Tarceva): a promising drug targeting epidermal growth factor receptor tyrosine kinase. Expert Rev Anticancer Ther 2003;3:269–79.[CrossRef][Medline]
  8. Awasthi S, Singhal SS, Sharma R, Zimniak P, Awasthi YC. Transport of glutathione-conjugates and chemotherapeutic drugs by RLIP76 (RALBP1): a novel link between G-protein and tyrosine kinase signaling and drug resistance. Int J Cancer 2003;106:635–46.[CrossRef][Medline]
  9. Sharma R, Brown D, Awasthi S, et al. Transfection with 4-hydroxynonenal-metabolizing glutathione S-transferase isozymes leads to phenotypic transformation and immortalization of adherent cells. Eur J Biochem 2004;271:1690–701.[Medline]
  10. Yadav S, Zajac E, Singhal SS, et al. POB1 over-expression inhibits RLIP76 mediated transport of glutathione-conjugates, drugs and promotes apoptosis. Biochem Biophys Res Commun 2005;328:1003–9.[CrossRef][Medline]
  11. Jullien-Flores V, Dorseuil O, Romero F, et al. Bridging Ral GTPase to Rho pathways. RLIP76, a Ral effector with CDC42/Rac GTPase-activating protein activity. J Biol Chem 1995;270:22473–7.[Abstract/Free Full Text]
  12. Jullien-Flores V, Mahe Y, Mirey G, et al. RLIP76, an effector of the GTPase Ral, interacts with AP2 complex: involvement of the Ral pathway in receptor endocytosis. J Cell Sci 2000;113:2837–44.[Abstract]
  13. Mirey G, Balakireva M, L'Hoste S, Rosse C, Voegeling S, Camonis J. A Ral guanine exchange factor-Ral pathway is conserved in Drosophila melanogaster and sheds new light on the connectivity of the Ral, Ras, and Rap pathways. Mol Cell Biol 2003;23:1112–24.[Abstract/Free Full Text]
  14. Ikeda M, Ishida O, Hinoi T, Kishida S, Kikuchi A. Identification and characterization of a novel protein interacting with Ral-binding protein 1, a putative effector protein of Ral. J Biol Chem 1998;273:814–21.[Abstract/Free Full Text]
  15. Quaroni A, Paul EC. Cytocentrin is a Ral-binding protein involved in the assembly and function of the mitotic apparatus. J Cell Sci 1999;112:707–18.[Abstract]
  16. Yamaguchi A, Urano T, Goi T, Feig LA. An Eps homology (EH) domain protein that binds to the Ral-GTPase target, RalBP1. J Biol Chem 1997;272:31230–4.[Abstract/Free Full Text]
  17. Awasthi S, Singhal SS, Yadav S, et al. RLIP76 is a major determinant of radiation sensitivity. Cancer Res 2005;65:6022–8.[Abstract/Free Full Text]
  18. Nakashima S, Morinaka K, Koyama S, et al. Small G protein Ral and its downstream molecules regulate endocytosis of EGF and insulin receptors. EMBO J 1999;18:3629–42.[CrossRef][Medline]
  19. Rosse C, Hoste S, Offner N, et al. RLIP, an effector of the Ral GTPases, is a platform for cdk1 to phosphorylate epsin during the switch off of endocytosis in mitosis. J Biol Chem 2003;278:30597–604.[Abstract/Free Full Text]
  20. Kariya K, Koyama S, Nakashima S, Oshiro T, Morinaka K, Kikuchi A. Regulation of complex formation of POB1/epsin/adaptor protein complex 2 by mitotic phosphorylation. J Biol Chem 2000;275:18399–406.[Abstract/Free Full Text]
  21. Morinaka K, Koyama S, Nakashima S, et al. Epsin binds to the EH domain of POB1 and regulates receptor-mediated endocytosis. Oncogene 1999;18:5915–22.[CrossRef][Medline]
  22. Cheng J, Sharma R, Yang Y, et al. Accelerated metabolism and exclusion of 4-hydroxy-nonenal through induction of RLIP76 and hGST5.8 is an early adaptive response of cells to heat and oxidative stress. J Biol Chem 2001;276:41213–23.[Abstract/Free Full Text]
  23. Yang Y, Sharma A, Sharma R, et al. Cells preconditioned with mild, transient UVA irradiation acquire resistance to oxidative stress and UVA-induced apoptosis: role of 4-hydroxynonenal in UVA mediated signaling for apoptosis. J Biol Chem 2003;278:41380–8.[Abstract/Free Full Text]
  24. Hu Y, Mivechi NF. HSF-1 interacts with Ral-binding protein 1 in a stress-responsive, multiprotein complex with HSP90 in vivo. J Biol Chem 2003;278:17299–306.[Abstract/Free Full Text]
  25. Awasthi S, Singhal SS, Singhal J, Cheng J, Zimniak P, Awasthi YC. Role of RLIP76 in lung cancer doxorubicin resistance: II. Doxorubicin transport in lung cancer by RLIP76. Int J Oncol 2003;22:713–20.[Medline]
  26. Awasthi S, Singhal SS, Singhal J, Yang Y, Zimniak P, Awasthi YC. Role of RLIP76 in lung cancer doxorubicin resistance: III. Anti-RLIP76 antibodies trigger apoptosis in lung cancer cells and synergistically increase doxorubicin cytotoxicity. Int J Oncol 2003;22:721–32.[Medline]
  27. Yadav S, Singhal SS, Singhal J, et al. Identification of membrane anchoring domains of RLIP76 using deletion mutants analyses. Biochemistry 2004;43:16243–53.[CrossRef][Medline]
  28. Stuckler D, Singhal J, Singhal SS, Yadav S, Awasthi YC, Awasthi S. RLIP76 transports vinorelbine and mediates drug resistance in non-small cell lung cancer. Cancer Res 2005;65:991–8.[Abstract/Free Full Text]
  29. Singhal SS, Yadav S, Singhal J, Zajac E, Awasthi YC, Awasthi S. Depletion of RLIP76 sensitizes lung cancer cells to doxorubicin. Biochem Pharmacol 2005;70:481–8.[CrossRef][Medline]
  30. Awasthi S, Cheng J, Singhal SS, et al. Novel function of human RLIP76: ATP-dependent transport of glutathione conjugates and doxorubicin. Biochemistry 2000;39:9327–34.[CrossRef][Medline]
  31. Awasthi S, Cheng J, Singhal SS, et al. Functional reassembly of ATP-dependent xenobiotic transport by the N- and C-terminal domains of RLIP76 and identification of ATP binding sequences. Biochemistry 2001;40:4159–68.[CrossRef][Medline]
  32. Awasthi S, Singhal SS, Srivastava SK, et al. Adenosine triphosphate-dependent transport of doxorubicin, daunomyicn, and vinblastine in human tissues by a mechanism distinct from the P-glycoprotein. J Clin Invest 1994;93:958–65.[Medline]
  33. Sharma R, Singhal SS, Wickramarachchi D, Awasthi YC, Awasthi S. RLIP76 (RALBP1)-mediated transport of leukotriene C4 (LTC4) in cancer cells: implications in drug resistance. Int J Cancer 2004;112:934–42.[CrossRef][Medline]
  34. Singhal SS, Yadav S, Singhal J, Drake K, Awasthi YC, Awasthi1 S. The role of PKC{alpha} and RLIP76 in transport-mediated doxorubicin-resistance in lung cancer. FEBS Lett 2005;579:4635–41.[Medline]
  35. Singhal SS, Singhal J, Sharma R, et al. Role of RLIP76 in lung cancer doxorubicin resistance: I. The ATPase activity of RLIP76 correlates with doxorubicin and 4-hydroxynonenal resistance in lung cancer cells. Int J Oncol 2003;22:365–75.[Medline]
  36. Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970;227:680–5.[CrossRef][Medline]
  37. Towbin H, Staehelin T, Gordon J. Electrophoretic transfer of protein from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc Natl Acad Sci U S A 1979;76:4350–3.[Abstract/Free Full Text]
  38. Awasthi S, Singhal SS, He NG, et al. Modulation of doxorubicin cytotoxicity by ethacrynic acid. Int J Cancer 1996;68:333–9.[CrossRef][Medline]
  39. Minamide LS, Bamburg JR. A filter paper dye-binding assay for quantitative determination of protein without interference from reducing agents or detergents. Anal Biochem 1990;190:66–70.[CrossRef][Medline]
  40. Wedge SR, Ogilvie DJ, Dukes M, et al. ZD6474 inhibits vascular endothelial growth factor signaling, angiogenesis, and tumor growth following oral administration. Cancer Res 2002;62:4645–55.[Abstract/Free Full Text]
  41. Tentori L, Leonetti C, Scarsella M, et al. Systemic administration of GPI 15427, a novel poly(ADP-ribose) polymerase-1 inhibitor, increases the antitumor activity of temozolomide against intracranial melanoma, glioma, lymphoma. Clin Cancer Res 2003;9:5370–9.[Abstract/Free Full Text]
  42. Verra NC, Jorritsma A, Weijer K, et al. Human telomerase reverse transcriptase-transduced human cytotoxic T cells suppress the growth of human melanoma in immunodeficient mice. Cancer Res 2004;64:2153–61.[Abstract/Free Full Text]
  43. Adams S, Miller GT, Jesson MI, Watanabe T, Jones B, Wallner BP. PT-100, a small molecule dipeptidyl peptidase inhibitor, has potent antitumor effects and augments antibody-mediated cytotoxicity via a novel immune mechanism. Cancer Res 2004;64:5471–80.[Abstract/Free Full Text]
  44. Schlereth B, Kleindienst P, Fichtner I, et al. Potent inhibition of local and disseminated tumor growth in immunocompetent mouse models by a bispecific antibody construct specific for Murine CD3. Cancer Immunol Immunother 2005;1–12 [Epub ahead of print].
  45. Sharma R, Singhal SS, Cheng J, et al. RLIP76 is the major ATP-dependent transporter of glutathione-conjugates and doxorubicin in human erythrocytes. Arch Biochem Biophys 2001;39:171–9.



This article has been cited by other articles:


Home page
Cancer Res.Home page
S. S. Singhal, J. Singhal, S. Yadav, M. Sahu, Y. C. Awasthi, and S. Awasthi
RLIP76: A Target for Kidney Cancer Therapy
Cancer Res., May 15, 2009; 69(10): 4244 - 4251.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S. Awasthi, S. S. Singhal, Y. C. Awasthi, B. Martin, J.-H. Woo, C. C. Cunningham, and A. E. Frankel
RLIP76 and Cancer
Clin. Cancer Res., July 15, 2008; 14(14): 4372 - 4377.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. S. Singhal, S. Yadav, K. Drake, J. Singhal, and S. Awasthi
Hsf-1 and POB1 Induce Drug Sensitivity and Apoptosis by Inhibiting Ralbp1
J. Biol. Chem., July 11, 2008; 283(28): 19714 - 19729.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
P. Margutti, P. Matarrese, F. Conti, T. Colasanti, F. Delunardo, A. Capozzi, T. Garofalo, E. Profumo, R. Rigano, A. Siracusano, et al.
Autoantibodies to the C-terminal subunit of RLIP76 induce oxidative stress and endothelial cell apoptosis in immune-mediated vascular diseases and atherosclerosis
Blood, May 1, 2008; 111(9): 4559 - 4570.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. S. Singhal, J. Singhal, S. Yadav, S. Dwivedi, P. J. Boor, Y. C. Awasthi, and S. Awasthi
Regression of Lung and Colon Cancer Xenografts by Depleting or Inhibiting RLIP76 (Ral-Binding Protein 1)
Cancer Res., May 1, 2007; 67(9): 4382 - 4389.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Singhal, S. S.
Right arrow Articles by Awasthi, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Singhal, S. S.
Right arrow Articles by Awasthi, S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online