| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Endocrinology |
1 Cancer Biology Program, Department of Medicine, Beth Israel Deaconess Medical Center and Harvard Medical School; Departments of 2 Pediatric Oncology and 3 Medical Oncology, Dana-Farber Cancer Institute and Harvard Medical School; 4 Department of Pathology, Brigham and Women's Hospital and Harvard Medical School, Boston, Massachusetts; 5 Broad Institute at Harvard and MIT, Cambridge, Massachusetts; and 6 Department of Pharmacology, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania
Requests for reprints: Steven Balk, Department of Medicine, Beth Israel Deaconess Medical Center, 330 Brookline Avenue, Boston, MA 02215. Phone: 617-667-3918; Fax: 617-667-5339; E-mail: sbalk{at}bidmc.harvard.edu.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Significantly, the AR is expressed at high levels in most cases of androgen-independent prostate cancer, with the AR gene being amplified in about one third of cases (2–5). Moreover, these androgen-independent prostate cancer resume their expression of multiple AR-regulated genes (such as PSA), indicating that AR transcriptional activity becomes reactivated at this stage of the disease (5–8). Studies using prostate cancer cell lines and xenografts similarly show that progression to androgen-independent prostate cancer is associated with increased levels of AR and resumed expression of androgen-regulated genes, and that AR down-regulation at this stage by small interfering RNA (siRNA) or other methods can suppress tumor growth (9–11).
In addition to increased AR expression, AR mutations in androgen-independent prostate cancer can enhance AR activation by weak androgens, other steroid hormones, or drugs (12, 13). Although the overall frequency of AR mutations in androgen-independent prostate cancer is low, mutant ARs that are stimulated by the AR antagonist flutamide are more frequent in patients treated long term with this drug, and these patients have increased responses to another AR antagonist (bicalutamide), indicating that there is positive selection for alterations that can enhance AR activity (12, 14). Further mechanisms that may stimulate AR transcriptional activity in androgen-independent prostate cancer include increased expression of transcriptional coactivator proteins and activation of signal transduction pathways that can enhance AR responses to low levels of circulating androgens, including the Ras/Raf/mitogen-activated protein kinase pathway, protein kinase A, and phosphatidylinositol 3-kinase (15, 16). Finally, direct measurements of intraprostatic androgens in castrated men with androgen-independent prostate cancer have shown that levels are not significantly reduced compared with normal prostate, indicating that increased testosterone uptake or synthesis may be a mechanism for reactivation of AR activity in androgen-independent prostate cancer (8, 17, 18).
Several groups have used cDNA or oligonucleotide microarrays to elucidate molecular features of primary prostate cancer associated with metastatic potential, as patients with these tumors may benefit from adjuvant therapies, whereas others may be treated effectively with more conservative therapies (19–25). Comparable gene expression studies to identify mechanisms that mediate progression to androgen-independent prostate cancer have been more limited and used smaller numbers of tumors, largely due to difficulties in obtaining appropriate frozen androgen-independent prostate cancer samples (5, 26–28). In this study, we used Affymetrix oligonucleotide microarrays to examine gene expression in 33 metastatic androgen-independent prostate cancer samples derived from bone marrow biopsies, the predominant site for metastatic prostate cancer. These were compared with a group of 22 laser capture–microdissected (LCM) primary prostate cancer samples to identify genes that may contribute to metastatic behavior or androgen independence. This analysis identified a series of genes characterized previously as candidate biomarkers of more aggressive prostate cancer and additional genes that may contribute to metastatic growth. With respect to AR signaling, the data showed marked increases in AR message levels in the androgen-independent prostate cancer samples and increases in multiple genes involved in androgen metabolism, including aldo-keto reductase family 1, member C3 (AKR1C3, also called 17ß-hydroxysteroid dehydrogenase type 5, 17ßHSD5), the prostatic enzyme mediating conversion of adrenal androstenedione to testosterone (29–33). The increased expression of AKR1C3 in androgen-independent prostate cancer, in conjunction with increases in other enzymes mediating androgen synthesis and catabolism, indicates that enhanced intracellular production of testosterone and dihydrotestosterone from adrenal androgens is a mechanism for prostate cancer progression to androgen independence.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Primary prostate cancer was isolated by LCM from frozen biopsies or radical prostatectomies in hormone-naive patients. Frozen sections (8 µm) were stained with H&E and air-dried. LCM was done on sections using a PixCell II LCM System (Arcturus Engineering, Mountain View, CA), using about 4,000 laser pulses of 15-µm diameter and 25-mW pulse power to collect malignant epithelial cells. For biopsy samples with scant tumor tissue, multiple sections were used to reach a total of 4,000 laser pulses. Immediately following LCM, captured tissue was dissolved in lysis buffer from the Absolutely RNA Nanoprep kit (Stratagene, La Jolla, CA) and frozen at –20°C until RNA isolation.
RNA amplification and probe generation. Total RNA for the LCM samples was eluted into a final volume of 10 µL and used in its entirety for RNA amplification. For RNA from the above androgen-independent prostate cancer samples, 50 ng were suspended in a total volume of 10 µL for RNA amplification and probe generation in conjunction with the RNA from the primary tumors. Two serial rounds of double-stranded cDNA synthesis and in vitro transcription were carried out to obtain sufficient cRNA for microarray analysis. Briefly, first-strand cDNA was synthesized using a T7-(dT24) primer and SuperScript III reverse transcriptase (Invitrogen, San Diego, CA). After second-strand cDNA synthesis, the double-stranded cDNA was phenol-chloroform extracted and subjected to in vitro transcription using a commercial kit (Ambion, Austin, TX). The resultant cRNA was RNAeasy column purified (Qiagen, Valencia, CA), and 600 ng of cRNA in 10 µL DEPC water were carried into the second round for further amplification.
For the second round of in vitro transcription amplification, the single-stranded cDNA was primed with random hexamers, whereas the double-stranded cDNA synthesis was primed with the T7-(dT24) primer. The double-stranded cDNA was extracted as described above and subjected to in vitro transcription with the addition of biotinylated CTP and UTP in a 1:4 proportion to nonbiotinylated CTP and UTP. The cleanup of the labeled cRNA was done with RNeasy Mini Columns and eluted with 50 µL DEPC–treated water. RNA was quantified by spectrophotometer, and the quality was assessed by running a 1% denaturing agarose gel. After fragmentation, cRNA target from the androgen-independent prostate cancer and primary prostate cancer samples were hybridized to Affymetrix 133A oligonucleotide microarrays, with the primary and androgen-independent prostate cancer samples being analyzed at the same time using the same lot of chips.
Statistical analysis of expression data. Expression values were derived by probe set level analysis from the raw CEL files with R statistical software (R Development Core Team, 2004. R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. ISBN 3-900051-00-3)7 and BioConductor packages and libraries (34). Background correction, normalization, and expression value calculation of perfect match probe intensities was done with the RMA function of the BioConductor package "Affy." Chip-wide median signal intensities of the raw data ranged from 95 to 250, whereas the normalized median intensities of the 59 chips were close to 50 (interquartile range, 48.5-50.5; min, 47.0; max, 54.8). A comparison of these data with those produced by MAS5 (Affymetrix, Inc., Santa Clara, CA) and dChip (PM and PM-MM models) did not reveal great differences in the fold change ranking of the most highly expressed genes, but there was substantial variability in the expression values and statistical significance of weakly expressed genes. The PM-only models were less noisy at low signal intensities. A parallel analysis of this data set using dChip and dChip-generated expression values (PM-only and PM-MM models) gave very similar results.
Expression values were threshholded at the mean + 2 SDs to make the fold change of gene expression more robust against the influence of outliers. No further prefiltering for variance, expression level, or presence/absence call was used in the R-based analysis. The complete microarray data set consisted of these 59 samples and 22,283 probe sets on the microarray. A 22,066-member gene subset was formed by removing the control probes and 150 genes specifically expressed at high levels in the normal bone marrow samples (principally globins), which might otherwise contribute to the androgen-independent prostate cancer samples with even very low levels of normal marrow contamination. This subset was further reduced to 2,336 probe sets by removing genes that had minimal variability in the data set. Of these 2,336 probe sets, the majority (1,862 probe sets) were selecting based on high variability of expression, with SD/mean expression (coefficient of variance) >0.6. Also included were an additional 472 probe sets with a coefficient of variance between 0.3 and 0.6 and a fold change difference in the ratio of mean expression in androgen-independent prostate cancer versus primary tumors of >1.6. This second criterion was empirically found to be a concise means of identifying probe sets with extremely low t test adjusted Ps (third quartile Ps < 2.5 x 10–6; maximum, 0.59 x 10–3) and modest fold change ratios.
Statistically significant differences in gene expression/probe intensity between the local tumors and the androgen-independent prostate cancer bone marrow metastases were determined by calculation of Welch's t statistic for all probes in the array. Ps derived from the t statistics were adjusted with the Benjamini and Hochberg false discovery rate method as implemented in the BioConductor multitest package. Probe sets with adjusted Ps < 0.05 and a fold change in expression >1.8-fold were deemed significant.
A dendrogram of the gene expression results from the primary and metastatic androgen-independent prostate cancer tumors was prepared using divisive clustering with a Euclidean distance metric (Diana algorithm; ref. 35). The PAM algorithm was used to determine which genes were the most predictive classifiers of primary versus metastatic androgen-independent prostate cancer (36). The PAM analysis was done by randomly splitting the data set into training (41 samples) and test groups (14 samples), running the training and prediction programs, and collecting approximately the same number of predictive genes per run by adjusting the threshold within the zero prediction error range. In typical training runs, the number of predictive genes could be reduced to 2 to 3 before classification errors occurred. An estimate of the relative predictive power of an extended range of genes was produced by tabulating the results of 100 trials, randomly splitting the data set for each trial, and adjusting the threshold to yield 10 genes.
Real-time RT-PCR. Quantitative real-time RT-PCR amplifications were done on unamplified RNA extracted from additional metastatic androgen-independent prostate cancer samples and from primary prostate cancer samples containing high volumes of tumor, which were not LCM purified. The primers and probes (Biosource International, Camarillo, CA) were as follows: AKR1C3 forward, GAGAAGTAAAGCTTTGGAGGTCACA; AKR1C3 reverse, CAACCTGCTCCTCATTATTGTATAAATGA; AKR1C3 probe, FAM-ACTTATATGGCGGAACCCAGCTTCTATT-TAMRA; cyclin-dependent kinase subunit 2 (CKS2) forward, TCTTCGCGCTCTCGTTTCA; CKS2 reverse, AGATCTGCTTGTGGGCCATC; CKS2 probe, FAM-TTTCTGCAGCGCGCCACGA-TAMRA; leucine-rich repeat containing 15 (LRRC15) forward, CGTAATCTGCGTTGTTGGGA; LRRC15 reverse, TCTCTGAACCACAGCCATGG; LRRC15 probe, FAM-CCAGCAGTGGCCTTGGGAAGGAA-TAMRA; AKR1C2 forward, CCTAAAAGTAAAGCTCTAGAGGCCGT; AKR1C2 reverse, GAAAATGAATAAGATAGAGGTCAACATAG; AKR1C2 probe, FAM-CCGTTATCTTCGGCCCAAGGGT. Each reaction used 50 ng of RNA and was normalized by coamplification of 18S RNA. Reactions were carried out on an ABI Prism 7700 Sequence Detection System using Taqman Gold RT-PCR reagents (PE Applied Biosystems, Foster City, CA).
Immunohistochemistry. Tissue microarrays containing primary prostate cancer and metastatic androgen-independent prostate cancer from warm autopsies were prepared as described, and additional androgen-independent prostate cancer samples were obtained from transurethral prostate resections in patients with recurrent prostate cancer and bladder obstruction (26). AKR1C3 was detected using the mouse monoclonal anti-AKR1C3 antibody NP6-G6.A6, which does not cross-react with other AKR1C family members (33). For antigen retrieval, sections were microwaved for 20 minutes in 10 mmol/L citric acid (pH 6). The specific and control antibodies (nonimmune mouse IgG) were used at final concentrations of 5 µg/mL overnight at 4°C followed by a biotinylated anti-mouse secondary, horseradish peroxidase–conjugated streptavidin, and 3,3'-diaminobenzidine substrate.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Significantly, unsupervised clustering of the Affymetrix expression data (Diana algorithm) clearly distinguished the primary and metastatic androgen-independent prostate cancer (Fig. 1), and most of the predictive genes were expressed at higher levels in the primary tumors (Table 1; refs. 35, 36). Moreover, four of the top five predictive genes were androgen regulated (ACPP, KLK3, KLK2, and NKX3.1), and additional strongly androgen-regulated genes were also among the top 100 predictive genes (PART1, SARG, and MSMB). These findings indicate that decreased AR transcriptional activity (
2- to 3-fold) is the major single feature distinguishing the metastatic androgen-independent prostate cancer samples from the primary tumors, which is certainly consistent with the castrate androgen levels in the androgen-independent prostate cancer patients. However, whereas the levels of these AR-regulated genes were decreased relative to the primary tumors, they remained as major transcripts in metastatic androgen-independent prostate cancer. For example, the mean expression of PSA in the metastatic androgen-independent prostate cancer tumors was in the top 1% of all genes among these tumors. Taken together, these results indicated that the progression to androgen-independent prostate cancer entailed partial reactivation of AR transcriptional functions (despite castrate androgen levels), but not to the degree observed in primary androgen-dependent tumors with normal androgen levels.
|
|
Genes differentially expressed in primary versus androgen-independent prostate cancer. The above analysis was focused on genes whose expression could most accurately classify the primary versus metastatic androgen-independent tumors, but did not identify genes that clearly contributed to metastatic or androgen-independent growth. Therefore, we next analyzed the data to identify genes expressed at significantly different levels in the two sets and ordered them based on fold difference. Genes whose expression was significantly higher (P < 0.05 after multiple testing adjustment) in the primary versus the metastatic tumors are shown in Table 2, whereas genes with higher expression in metastatic androgen-independent prostate cancer are shown in Table 3.
|
|
Many of the genes most highly overexpressed in the metastatic androgen-independent prostate cancer tumors encoded collagens and other extracellular matrix proteins, which were potentially derived from normal bone (Table 3). Therefore, a further analysis was done to determine whether these extracellular matrix proteins were expressed at higher levels in the bone marrow metastases versus the normal bone marrow samples. Among the collagens, most were expressed at significantly higher levels in the metastatic prostate cancer samples (COL11A1, COL5A2, COL3A1, COL6A3, and COL4A1), indicating that they were derived from tumor or tumor-induced stromal cells. Most of the other extracellular matrix proteins were also significantly increased in the metastatic prostate cancer samples compared with normal bone, with the exceptions being SPP1, IBSP, SPARC, CSPG2, FBN1, OMD, and LAMA4 (although the increases in SPP1 and IBSP were borderline significant). Interestingly, previous studies have shown that SPP1 and IBSP, whereas normally expressed by osteoblasts, are also expressed by tumor cells and at increased levels by bone cells in bone metastases from prostate as well as breast cancer. Moreover, their increased expression may play a role in tumor progression (38, 39). Taken together, these results indicated that most of the increases in transcripts encoding extracellular matrix proteins likely reflected tumor-induced stroma and new bone formation.
Among the tumor cell–derived transcripts, AR expression was increased in the majority of androgen-independent tumors (average 5.84-fold increase), with marked increases in a subset of the tumors (Fig. 2A). This finding is consistent with other studies showing that AR message and protein are highly expressed in androgen-independent prostate cancer, and that the AR gene is amplified in 30% of cases (2–5). The increased expression of several other genes in Table 3, including MMP9, WNT5A, EZH2, and E2F3, has also been associated previously with higher grade local prostate cancer, disease recurrence, or metastatic prostate cancer (20, 23, 40, 41). Additional genes previously associated with more aggressive prostate cancer that were increased (2-fold) in the metastatic androgen-independent prostate cancer samples were SDC1, SKP2, and BIRC5 (42–45). Significantly, expression of BIRC5/survivin was also increased in a recent series of 13 androgen-independent prostate cancer samples compared with local prostate cancer (27).
|
Increased expression of genes regulating androgen metabolism in androgen-independent prostate cancer. In addition to increased AR expression in androgen-independent prostate cancer, there were increases in a series of genes mediating androgen synthesis (AKR1C3, SRD5A1, and HSD3B2) and catabolism (AKR1C2, AKR1C1, and UGTB15; Table 3; Fig. 3). AKR1C3 (also called 17ßHSD5) has a number of substrates, including progesterone, estrone (converted to 17ß-estradiol), and prostaglandin D2, but its role in androgen metabolism in prostate is reduction of androstenedione to testosterone (refs. 29–33, 48; Fig. 3). Type 1 5
-reductase (SRD5A1) and type 2 5-reductase (SRD5A2, the major isoform in normal prostate) both convert testosterone to the higher-affinity dihydrotestosterone. Interestingly, levels of SRD5A2 expression were moderately reduced (50%) in the androgen-independent prostate cancer tumors, consistent with recent studies showing decreased SRD5A2 in prostate cancer and a shift from SRD5A2 to SRD5A1 (49–51).
|
Expression of the AKR1C3-related genes, AKR1C2 and AKR1C1, was also increased in the androgen-independent prostate cancers (Table 3). In contrast to AKR1C3, AKR1C2 reduces dihydrotestosterone to the inactive 5-androstane-3,17ß-diol (3-diol), which is subsequently glucuronidated to 5-androstane-3,17ß-diol glucuronide (3-diolG) and eliminated into the circulation (Fig. 3; refs. 32, 53, 54). AKR1C2 can also catalyze the reverse oxidative reaction (3-diol to dihydrotestosterone), but intracellularly, it seems to function primarily as a dihydrotestosterone reductase. The role of AKR1C1 in androgen metabolism is similarly to reduce dihydrotestosterone, but to 5-androstane-3ß,17ß-diol, a possible endogenous ligand for the estrogen receptor ß in prostate (55). Therefore, increased expression of this enzyme may have effects on signaling through other receptors as well as AR. Finally, there was increased expression of UDP glycosyltransferase 2, B15 (UGT2B15), which in conjunction with UGT2B17 mediates glucuronidation of dihydrotestosterone metabolites. Taken together, the increased expression of enzymes mediating dihydrotestosterone synthesis (AKR1C3, SRD5A1, and HSD3B2) and catabolism (AKR1C2, AKR1C1, and UGT2B15) indicates that intracellular conversion of weak adrenal androgens to testosterone and dihydrotestosterone is enhanced in androgen-independent prostate cancer cells and may contribute to prostate cancer relapse after androgen deprivation therapy.
Increased AKR1C2 and AKR1C3 expression by real-time RT-PCR and AKR1C3 by immunohistochemistry. Real-time RT-PCR using unamplified RNA, and primers shown previously to distinguish between AKR1C3 and the related AKR1C1, AKR1C2, and AKR1C4, confirmed that AKR1C3 message was increased in androgen-independent prostate cancer (Fig. 4A; refs. 32, 54). Consistent with the Affymetrix microarray data, there was an average increase of about 4-fold, with approximately one third of the androgen-independent prostate cancer showing particularly high expression levels (Fig. 4A and B). The increased expression of AKR1C2 in the androgen-independent tumors was similarly shown by real-time RT-PCR (Fig. 4C), with both the RT-PCR and Affymetrix analyses indicating that there was particularly high expression in a subset of the androgen-independent tumors (Fig. 4C and D).
|
To determine whether the increased AKR1C3 message expression was reflected in protein expression by androgen-independent prostate cancer tumor cells, we next assessed AKR1C3 protein by immunohistochemistry using a series of formalin-fixed and paraffin-embedded primary and androgen-independent prostate cancer samples. Previous studies by in situ hybridization and immunohistochemistry in nonneoplastic prostate showed AKR1C3 expression in blood vessels, stromal fibroblasts, and basal cells, whereas primary prostate cancer had increased staining in tumor and in endothelial cells (30, 33). We similarly found little or no AKR1C3 expression in nonneoplastic prostate luminal epithelium (Fig. 5A) and negative or heterogeneous weak staining in most primary androgen-dependent prostate cancers (Fig. 5B and C). In contrast, intermediate to strong AKR1C3 staining was observed in androgen-independent prostate cancer samples obtained from bone, prostate, and other sites (Fig. 5D-J). Overall, intermediate to strong staining was observed in only 1 of 18 primary androgen-dependent tumors versus 11 of 19 androgen-independent prostate cancer (P < 0.001).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The role of adrenal androgens in prostate cancer progression to androgen independence has been an important and controversial issue. Early studies using bilateral surgical adrenalectomy or hypophysectomy to ablate adrenal androgen production resulted in pain relief in the majority of patients and objective responses in up to 30%, but there was significant morbidity associated with this therapy, and it was replaced by medical adrenalectomy using aminoglutethimide or ketoconazole (56, 57). Response rates of about 40% have been reported to aminoglutethimide (usually given with hydrocortisone) in men with androgen-independent prostate cancer (58–60). Significantly, this treatment only partially suppresses adrenal androgen production (by about 50%), and responses have been correlated with the level of adrenal suppression (60). Similar results have been obtained using treatment with ketoconazole to suppress adrenal androgen production (61–64).
Taken together, the increased expression of HSD3B2, AKR1C3, and SRD5A1 in androgen-independent prostate cancer, in conjunction with responses to therapies that decrease adrenal androgen production, supports the conclusion that adrenal androgens provide a stimulus for androgen-independent prostate cancer in at least a subset of patients. Nonetheless, data from a series of clinical trials show that the combination of castration (orchiectomy or LHRH agonist) and an AR antagonist to block AR stimulation by residual adrenal androgens results in only a very small improvement in disease-specific survival, despite more rapid responses and lower nadir PSA levels with the combined therapies (65). Importantly, the conclusion that can be drawn from these studies is that available AR antagonists do not have substantial activity against the androgen-independent tumor cells that emerge subsequent to androgen deprivation therapy. Consistent with this conclusion, the majority of prostate cancers that recur after orchiectomy or LHRH agonist monotherapy do not respond to secondary treatments with AR antagonists, including high-dose therapy with the relatively pure AR antagonist bicalutamide (14). Significantly, increased intracellular synthesis of testosterone and dihydrotestosterone may explain the poor response rate to direct AR antagonists versus antagonists of adrenal androgen production, as the direct AR antagonists have much lower affinities for the AR (micromolar range) than testosterone and dihydrotestosterone (high picomolar to low nanomolar range).
The increased expression of SRD5A1 suggests that enhanced conversion of testosterone to the higher-affinity dihydrotestosterone may also contribute to AR activation in androgen-independent prostate cancer. However, there are no studies showing that 5-reductase inhibitors are effective in androgen-independent prostate cancer. This may reflect the use of finasteride in most studies, as this inhibitor has more activity towards SRD5A2, which is the predominant 5-reductase in normal prostate. Interestingly, in one reported small phase I study of a dual type 1 and 2 5-reductase antagonist (LY320236), there were four responses among 15 patients with androgen-independent prostate cancer (66). Moreover, the drug caused a dramatic increase in serum estradiol levels (10-fold) in these castrated patients, consistent with high levels of intracellular testosterone synthesis and catabolism to estradiol by aromatase in the absence of 5-reductase activity. Importantly, as this finding illustrates, testosterone reduction by 5-reducatse not only produces dihydrotestosterone but is also an initial step in testosterone catabolism. Indeed, the increased expression of AKR1C2, AKR1C1, and UGT2B15 in androgen-independent prostate cancer suggests that dihydrotestosterone produced by 5-reductase may be rapidly catabolized. In this case, 5-reductase inhibitors may cause an increase in intracellular testosterone, which would render them less effective at suppressing AR activity. Further studies are clearly needed to determine the precise significance of increased SRD5A1 in androgen-independent prostate cancer.
Previous studies found that expression of AKR1C2 was decreased in primary prostate cancer relative to normal prostate, and this was proposed as a mechanism for increasing intracellular dihydrotestosterone in primary prostate cancer (53, 54). The current study is not inconsistent with these results, but indicates that increased testosterone synthesis becomes the more dominant mechanism for increasing androgen during the progression to androgen independence, with the increases in catabolic enzymes being part of a coordinated response to process the androgen signal. It should be noted that the extent to which this increase in testosterone synthesis is an early adaptation to androgen withdrawal therapy versus a late event occurring in a subset of tumor cells that triggers androgen-independent growth is not yet clear. Interestingly, a recent study examining selected genes in androgen-independent prostate cancer found increased expression of HSD17B2, which functions to catabolize testosterone and estrogen, and increased expression of multiple enzymes that catabolize androgens was observed in primary prostate cancer after neoadjuvant docetaxel treatment (27, 67). Finally, another study that examined three cases of androgen ablation–resistant prostate cancer found increased expression of several enzymes mediating early steps in sterol biosynthesis (5).
In summary, this study indicates that AR transcriptional activity is reactivated in androgen-independent prostate cancer and identifies the intracellular conversion of adrenal androgens to testosterone as a mechanism mediating this reactivation. The increased intracellular conversion of adrenal androstenedione to testosterone by AKR1C3 also provides an explanation for the relatively high levels of testosterone in androgen-independent prostate cancer biopsy samples (8, 17, 18). The clinical significance of this mechanism in androgen-independent prostate cancer is supported by responses to therapies that suppresses adrenal androgen production. However, it is not yet clear whether even total abrogation of adrenal androgens can completely suppress AR transcriptional activity in androgen-independent prostate cancer. Moreover, it is certainly unclear whether such complete suppression of AR activity would result in complete or durable clinical responses. These issues need to be addressed through the development of more potent AR antagonists or therapies that more effectively target adrenal androgens and their metabolism.
|
Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
|
Footnotes |
|---|
Received 11/ 7/05. Revised 12/13/05. Accepted 1/ 4/06.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
|
|
 |
|
  M.-E. Taplin, M. M. Regan, Y.-J. Ko, G. J. Bubley, S. E. Duggan, L. Werner, T. M. Beer, C. W. Ryan, P. Mathew, S.-M. Tu, et al. Phase II Study of Androgen Synthesis Inhibition with Ketoconazole, Hydrocortisone, and Dutasteride in Asymptomatic Castration-Resistant Prostate Cancer Clin. Cancer Res., November 15, 2009; 15(22): 7099 - 7105. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Cai, H. Wang, Y. Xu, S. Chen, and S. P. Balk Reactivation of Androgen Receptor-Regulated TMPRSS2:ERG Gene Expression in Castration-Resistant Prostate Cancer Cancer Res., August 1, 2009; 69(15): 6027 - 6032. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. E. Knudsen and H. I. Scher Starving the Addiction: New Opportunities for Durable Suppression of AR Signaling in Prostate Cancer Clin. Cancer Res., August 1, 2009; 15(15): 4792 - 4798. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Y. Chun, N. Nadiminty, S. Dutt, W. Lou, J. C. Yang, H.-J. Kung, C. P. Evans, and A. C. Gao Interleukin-6 Regulates Androgen Synthesis in Prostate Cancer Cells Clin. Cancer Res., August 1, 2009; 15(15): 4815 - 4822. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. J. Armstrong and P. G. Febbo Using Surrogate Biomarkers to Predict Clinical Benefit in Men with Castration-Resistant Prostate Cancer: An Update and Review of the Literature Oncologist, August 1, 2009; 14(8): 816 - 827. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Cai, D. C. Portnoy, H. Wang, X. Jiang, S. Chen, and S. P. Balk Androgen Receptor Expression in Prostate Cancer Cells Is Suppressed by Activation of Epidermal Growth Factor Receptor and ErbB2 Cancer Res., June 15, 2009; 69(12): 5202 - 5209. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Attard, A. H.M. Reid, D. Olmos, and J. S. de Bono Antitumor Activity with CYP17 Blockade Indicates That Castration-Resistant Prostate Cancer Frequently Remains Hormone Driven Cancer Res., June 15, 2009; 69(12): 4937 - 4940. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Nakamura, P. J. Hornsby, P. Casson, R. Morimoto, F. Satoh, Y. Xing, M. R. Kennedy, H. Sasano, and W. E. Rainey Type 5 17{beta}-Hydroxysteroid Dehydrogenase (AKR1C3) Contributes to Testosterone Production in the Adrenal Reticularis J. Clin. Endocrinol. Metab., June 1, 2009; 94(6): 2192 - 2198. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Lou, M. Yeager, H. Li, J. G. Bosquet, R. B. Hayes, N. Orr, K. Yu, A. Hutchinson, K. B. Jacobs, P. Kraft, et al. Fine mapping and functional analysis of a common variant in MSMB on chromosome 10q11.2 associated with prostate cancer susceptibility PNAS, May 12, 2009; 106(19): 7933 - 7938. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Mendiratta, E. Mostaghel, J. Guinney, A. K. Tewari, A. Porrello, W. T. Barry, P. S. Nelson, and P. G. Febbo Genomic Strategy for Targeting Therapy in Castration-Resistant Prostate Cancer J. Clin. Oncol., April 20, 2009; 27(12): 2022 - 2029. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. B. Riggins, J. P-J. Lan, U. Klimach, A. Zwart, L. R. Cavalli, B. R. Haddad, L. Chen, T. Gong, J. Xuan, S. P. Ethier, et al. ERR{gamma} Mediates Tamoxifen Resistance in Novel Models of Invasive Lobular Breast Cancer Cancer Res., November 1, 2008; 68(21): 8908 - 8917. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. E. MacLean, W. S. M. Chiu, C. Ma, J. F. McManus, R. A. Davey, R. Cameron, A. J. Notini, and J. D. Zajac A floxed allele of the androgen receptor gene causes hyperandrogenization in male mice Physiol Genomics, October 8, 2008; 33(1): 133 - 137. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. W. Hsing, L. W. Chu, and F. Z. Stanczyk Androgen and Prostate Cancer: Is the Hypothesis Dead? Cancer Epidemiol. Biomarkers Prev., October 1, 2008; 17(10): 2525 - 2530. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Attard, A. H.M. Reid, T. A. Yap, F. Raynaud, M. Dowsett, S. Settatree, M. Barrett, C. Parker, V. Martins, E. Folkerd, et al. Phase I Clinical Trial of a Selective Inhibitor of CYP17, Abiraterone Acetate, Confirms That Castration-Resistant Prostate Cancer Commonly Remains Hormone Driven J. Clin. Oncol., October 1, 2008; 26(28): 4563 - 4571. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. C. Hodgson, H. C. Shen, A. N. Hollenberg, and S. P. Balk Structural basis for nuclear receptor corepressor recruitment by antagonist-liganded androgen receptor Mol. Cancer Ther., October 1, 2008; 7(10): 3187 - 3194. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Sharifi, E. M. Hurt, S. B. Thomas, and W. L. Farrar Effects of Manganese Superoxide Dismutase Silencing on Androgen Receptor Function and Gene Regulation: Implications for Castration-Resistant Prostate Cancer Clin. Cancer Res., October 1, 2008; 14(19): 6073 - 6080. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H.-S. Martinsson-Ahlzen, V. Liberal, B. Grunenfelder, S. R. Chaves, C. H. Spruck, and S. I. Reed Cyclin-Dependent Kinase-Associated Proteins Cks1 and Cks2 Are Essential during Early Embryogenesis and for Cell Cycle Progression in Somatic Cells Mol. Cell. Biol., September 15, 2008; 28(18): 5698 - 5709. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. M Day, H. J Tutill, A. Purohit, and M. J Reed Design and validation of specific inhibitors of 17{beta}-hydroxysteroid dehydrogenases for therapeutic application in breast and prostate cancer, and in endometriosis Endocr. Relat. Cancer, September 1, 2008; 15(3): 665 - 692. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Azzarello, K.-M. Fung, and H.-K. Lin Tissue Distribution of Human AKR1C3 and Rat Homolog in the Adult Genitourinary System J. Histochem. Cytochem., September 1, 2008; 56(9): 853 - 861. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. A. Locke, E. S. Guns, A. A. Lubik, H. H. Adomat, S. C. Hendy, C. A. Wood, S. L. Ettinger, M. E. Gleave, and C. C. Nelson Androgen Levels Increase by Intratumoral De novo Steroidogenesis during Progression of Castration-Resistant Prostate Cancer Cancer Res., August 1, 2008; 68(15): 6407 - 6415. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Hoon Lee, H. Gong, S. Khadem, Y. Lu, X. Gao, S. Li, J. Zhang, and W. Xie Androgen Deprivation by Activating the Liver X Receptor Endocrinology, August 1, 2008; 149(8): 3778 - 3788. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Vasaitis, A. Belosay, A. Schayowitz, A. Khandelwal, P. Chopra, L. K. Gediya, Z. Guo, H.-B. Fang, V. C.O. Njar, and A. M.H. Brodie Androgen receptor inactivation contributes to antitumor efficacy of 17{alpha}-hydroxylase/17,20-lyase inhibitor 3{beta}-hydroxy-17-(1H-benzimidazole-1-yl)androsta-5,16-diene in prostate cancer Mol. Cancer Ther., August 1, 2008; 7(8): 2348 - 2357. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Sharifi, W. L. Dahut, and W. D. Figg The Genetics of Castration-Resistant Prostate Cancer: What Can the Germline Tell Us? Clin. Cancer Res., August 1, 2008; 14(15): 4691 - 4693. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. M. Dehm, L. J. Schmidt, H. V. Heemers, R. L. Vessella, and D. J. Tindall Splicing of a Novel Androgen Receptor Exon Generates a Constitutively Active Androgen Receptor that Mediates Prostate Cancer Therapy Resistance Cancer Res., July 1, 2008; 68(13): 5469 - 5477. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. O'Prey, S. Wilkinson, and K. M. Ryan Tumor Antigen LRRC15 Impedes Adenoviral Infection: Implications for Virus-Based Cancer Therapy J. Virol., June 15, 2008; 82(12): 5933 - 5939. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. B. Montgomery, E. A. Mostaghel, R. Vessella, D. L. Hess, T. F. Kalhorn, C. S. Higano, L. D. True, and P. S. Nelson Maintenance of Intratumoral Androgens in Metastatic Prostate Cancer: A Mechanism for Castration-Resistant Tumor Growth Cancer Res., June 1, 2008; 68(11): 4447 - 4454. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Hamada, T. Sissung, D. K. Price, R. Danesi, C. H. Chau, N. Sharifi, D. Venzon, K. Maeda, K. Nagao, A. Sparreboom, et al. Effect of SLCO1B3 Haplotype on Testosterone Transport and Clinical Outcome in Caucasian Patients with Androgen-Independent Prostatic Cancer Clin. Cancer Res., June 1, 2008; 14(11): 3312 - 3318. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K Wako, T Kawasaki, K Yamana, K Suzuki, S Jiang, H Umezu, T Nishiyama, K Takahashi, T Hamakubo, T Kodama, et al. Expression of androgen receptor through androgen-converting enzymes is associated with biological aggressiveness in prostate cancer J. Clin. Pathol., April 1, 2008; 61(4): 448 - 454. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. I. Scher, S. Halabi, I. Tannock, M. Morris, C. N. Sternberg, M. A. Carducci, M. A. Eisenberger, C. Higano, G. J. Bubley, R. Dreicer, et al. Design and End Points of Clinical Trials for Patients With Progressive Prostate Cancer and Castrate Levels of Testosterone: Recommendations of the Prostate Cancer Clinical Trials Working Group J. Clin. Oncol., March 1, 2008; 26(7): 1148 - 1159. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. W. Ross, W. K. Oh, W. Xie, M. Pomerantz, M. Nakabayashi, O. Sartor, M.-E. Taplin, M. M. Regan, P. W. Kantoff, and M. Freedman Inherited Variation in the Androgen Pathway Is Associated With the Efficacy of Androgen-Deprivation Therapy in Men With Prostate Cancer J. Clin. Oncol., February 20, 2008; 26(6): 842 - 847. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Hara, H. Miyazaki, A. Lee, C. P. Tran, and R. E. Reiter Androgen Receptor and Invasion in Prostate Cancer Cancer Res., February 15, 2008; 68(4): 1128 - 1135. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. M. Dehm and D. J. Tindall Androgen Receptor Structural and Functional Elements: Role and Regulation in Prostate Cancer Mol. Endocrinol., December 1, 2007; 21(12): 2855 - 2863. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Villar, M. I. Arenas, C. M. MacCarthy, M. J. Blanquez, O. M. Tirado, and V. Notario PCPH/ENTPD5 Expression Enhances the Invasiveness of Human Prostate Cancer Cells by a Protein Kinase C{delta} Dependent Mechanism Cancer Res., November 15, 2007; 67(22): 10859 - 10868. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. R. Plymate, K. Haugk, I. Coleman, L. Woodke, R. Vessella, P. Nelson, R. B. Montgomery, D. L. Ludwig, and J. D. Wu An Antibody Targeting the Type I Insulin-like Growth Factor Receptor Enhances the Castration-Induced Response in Androgen-Dependent Prostate Cancer Clin. Cancer Res., November 1, 2007; 13(21): 6429 - 6439. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. C. Hodgson, I. Astapova, A. N. Hollenberg, and S. P. Balk Activity of Androgen Receptor Antagonist Bicalutamide in Prostate Cancer Cells Is Independent of NCoR and SMRT Corepressors Cancer Res., September 1, 2007; 67(17): 8388 - 8395. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Tamura, M. Furihata, T. Tsunoda, S. Ashida, R. Takata, W. Obara, H. Yoshioka, Y. Daigo, Y. Nasu, H. Kumon, et al. Molecular Features of Hormone-Refractory Prostate Cancer Cells by Genome-Wide Gene Expression Profiles Cancer Res., June 1, 2007; 67(11): 5117 - 5125. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. A. Mostaghel, S. T. Page, D. W. Lin, L. Fazli, I. M. Coleman, L. D. True, B. Knudsen, D. L. Hess, C. C. Nelson, A. M. Matsumoto, et al. Intraprostatic Androgens and Androgen-Regulated Gene Expression Persist after Testosterone Suppression: Therapeutic Implications for Castration-Resistant Prostate Cancer Cancer Res., May 15, 2007; 67(10): 5033 - 5041. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Perez de Castro, G. de Carcer, and M. Malumbres A census of mitotic cancer genes: new insights into tumor cell biology and cancer therapy Carcinogenesis, May 1, 2007; 28(5): 899 - 912. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. J. Ryan, S. Halabi, S.-S. Ou, N. J. Vogelzang, P. Kantoff, E. J. Small, and for the Cancer and Leukemia Group B Adrenal Androgen Levels as Predictors of Outcome in Prostate Cancer Patients Treated with Ketoconazole Plus Antiandrogen Withdrawal: Results from a Cancer and Leukemia Group B Study Clin. Cancer Res., April 1, 2007; 13(7): 2030 - 2037. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. S. de Bono, J. Bellmunt, G. Attard, J. P. Droz, K. Miller, A. Flechon, C. Sternberg, C. Parker, G. Zugmaier, V. Hersberger-Gimenez, et al. Open-Label Phase II Study Evaluating the Efficacy and Safety of Two Doses of Pertuzumab in Castrate Chemotherapy-Naive Patients With Hormone-Refractory Prostate Cancer J. Clin. Oncol., January 20, 2007; 25(3): 257 - 262. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Z. Lu, S. E. Wardell, K. L. Burnstein, D. Defranco, P. J. Fuller, V. Giguere, R. B. Hochberg, L. McKay, J.-M. Renoir, N. L. Weigel, et al. International Union of Pharmacology. LXV. The Pharmacology and Classification of the Nuclear Receptor Superfamily: Glucocorticoid, Mineralocorticoid, Progesterone, and Androgen Receptors Pharmacol. Rev., December 1, 2006; 58(4): 782 - 797. [Full Text] [PDF]
|
|
|
|
|
|
D. R. Bauman, S. Steckelbroeck, D. M. Peehl, and T. M. Penning Transcript Profiling of the Androgen Signal in Normal Prostate, Benign Prostatic Hyperplasia, and Prostate Cancer Endocrinology, December 1, 2006; 147(12): 5806 - 5816. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. J. Desai, A.-H. Ma, C. G. Tepper, H.-W. Chen, and H.-J. Kung Inappropriate Activation of the Androgen Receptor by Nonsteroids: Involvement of the Src Kinase Pathway and Its Therapeutic Implications Cancer Res., November 1, 2006; 66(21): 10449 - 10459. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Chen, Y. Xu, X. Yuan, G. J. Bubley, and S. P. Balk Androgen receptor phosphorylation and stabilization in prostate cancer by cyclin-dependent kinase 1 PNAS, October 24, 2006; 103(43): 15969 - 15974. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. T. Page, D. W. Lin, E. A. Mostaghel, D. L. Hess, L. D. True, J. K. Amory, P. S. Nelson, A. M. Matsumoto, and W. J. Bremner Persistent Intraprostatic Androgen Concentrations after Medical Castration in Healthy Men J. Clin. Endocrinol. Metab., October 1, 2006; 91(10): 3850 - 3856. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. G. Febbo and P. W. Kantoff Noise and Bias in Microarray Analysis of Tumor Specimens J. Clin. Oncol., August 10, 2006; 24(23): 3719 - 3721. [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
