| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Cell, Tumor, and Stem Cell Biology |
1 Department of Molecular Genetics, Lerner Research Institute, Cleveland Clinic Foundation and Departments of 2 Genetics and 3 Radiation Oncology and Pharmacology, Case Western Reserve University, Case Comprehensive Cancer Center, Cleveland, Ohio
Requests for reprints: Mark W. Jackson, Department of Molecular Genetics, Lerner Research Institute/NC20, Cleveland Clinic Foundation, 9500, Euclid Avenue, Cleveland, OH 44195. Phone: 216-368-5674; Fax: 216-368-8919; E-mail: mwj7{at}cwru.edu.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The relationship among p53, Hdm2, and HdmX is complex, with an interaction between Hdm2 and HdmX required for complete p53 regulation (11, 12, 18, 19). HdmX requires Hdm2 to move from the cytoplasm to the nucleus, whereas HdmX is required to extend the half-life of Hdm2, although it is less clear whether the Hdm2-HdmX complex regulates p53 directly (18). Furthermore, the hdm2 gene is transcriptionally regulated by p53 (20, 21). Therefore, activation of p53 induces hdm2 transcription, and the increased levels of Hdm2 protein down-regulates p53 and HdmX. In response to DNA damage, the Hdm2-p53 and HdmX-p53 interactions are disrupted, facilitating the tumor suppressor functions of p53 (22, 23). Conversely, DNA damage enhances the degradation of HdmX and Hdm2 via ATM-dependent phosphorylation, leading to impaired deubiquitination of both proteins by the HAUSP deubiquitinating enzyme (24, 25).
Although the two proteins differ with respect to their ability to ubiquitinate p53, the p53-binding pockets of Hdm2 and HdmX are similar. Not surprisingly, both proteins are found overexpressed in human tumors, including breast carcinomas and sarcomas, many of which maintain wild-type p53 (26–28). Therefore, the selective pressure to eliminate p53 commonly results in either inhibition of wild-type p53 activities or p53 mutation. Tumors harboring both classes of p53 inactivating events have been the focus of studies to identify novel anticancer strategies. Diverse approaches aimed at disrupting the interaction between Hdm2 and p53 to facilitate wild-type p53 activities include the use of antibodies directed at Hdm2, inhibitory peptides, and antisense oligonucleotides or small interfering RNAs to inhibit Hdm2 expression (29–31). Recently, two drug discovery screens identified a series of Nutlin compounds and RITA, low molecular weight compounds capable of disrupting the p53-Hdm2 interaction, leading to p53-dependent toxicity in tumor cell lines and xenograft tumors in mice (32, 33). In addition to activating wild-type p53, the PRIMA-1 compound was also found to structurally alter tumor-derived p53 mutants and restore their wild-type conformation, inducing apoptosis in a series of cancer cell lines (34).
Recent identification of genetic elements capable of cooperating to transform human cells has permitted scientists to examine the contribution of specific genes to the transformation process. Evaluation of the response to therapeutic agents of cells transformed in vitro may also provide conclusive evidence regarding the involvement of a specific gene in resistance to a given treatment. In this report, we expand upon a recent model of human cell transformation that is dependent upon p53 inactivation, asking whether the genetic event responsible for p53 inactivation dictates the response to Nutlin-3. Our model system consists of normal human fibroblasts transduced with adenoviral E1A, oncogenic Ras mutant (RasV12), and the hTERT subunit of telomerase. When cells carrying these genes lose p53 function in response to Mdm2, Hdm2, HdmX, or knock down by short hairpin RNA (shRNA), they become fully transformed (35).4 We report here that the inactivation of p53 by Hdm2 or HdmX yields cells that differ greatly in their sensitivity to Nutlin-3 due to the selective disruption of p53-Hdm2 interactions. Cells transformed by HdmX have a significant survival advantage, whereas ablation of HdmX expression using shRNA sensitizes transformed cells to Nutlin-3. Our findings indicate that the interactions among p53, Hdm2, and HdmX must be maintained in proper balance for appropriate tumor surveillance and suppression. Transformation due to Hdm2 or HdmX overexpression alters the balance of this sensitive regulatory network, with profound implications for the therapeutic efficiency of specific compounds.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Plasmids and retroviral infection. Plasmids (pBabe-Bleo H-Ras-V12, pLPCX-E1A, LV-Hdm2, and shRNA constructs) and protocols for the production and growth of IMR-ERT cells and derivatives have been described elsewhere (36, 37). HdmX cDNA was kindly provided by Dr. Steven Berberich (Wright State University, Dayton, OH). The FLAG-tagged versions of HdmX were created by PCR amplification using PFU turbo polymerase (La Jolla, CA), the forward primer containing a HinDIII site, GGGGAAGCTTTTGACATCATTTTCCACCTCTGCT and reverse primer, ACCAATAATTCCAAAAATATCGTATTATTCTTAAGGGGG. To create the full-length HdmX expression vector, the PCR product was cut with HindIII alone and cloned into the pFLAG-CMV2 vector (Sigma, St. Louis, MO) cut with HinDIII and EcoRV. To create the HdmX
C expression vector, the PCR product was cut with HinDIII and EcoRI. An EcoRI site within the HdmX cDNA 1177-1182 removes amino acids 395 to 490 and, upon ligation into the HinDIII/EcoRI sites of the pFLAG-CMV2 vector, adds 11 unique amino acids to the end of the protein. Each pFLAG-CMV2 vector was subsequently cut with SnaBI [unique to the cytomegalovirus (CMV) promoter] and BamHI (3' MCS) and cloned into the retroviral vectors pLNCX2 and pLPCX (Clontech). Retroviruses encoding the cDNA of interest were packaged in Phoenix-Ampho (pBabe, pLPCX, and pLNCX2 derivatives) or 293T cells (LV-Hdm2, sh-Scrambled, or sh-p53) together with a second-generation packaging construct (pCMV-dR8.74) and pMD2G (both provided by D. Trono, University of Geneva). Supernatant media containing virus were collected at 36 to 48 hours, supplemented with 4 µg/mL polybrene, filtered through a 0.22-µm filter, and added to cells overnight. Uninfected cells were removed by selection with G418 (400 µg/mL), puromycin (1 µg/mL), or zeocin (200 µg/mL).
Soft agar assays. Cells (1 x 105 per 60-mm dish) were resuspended in 0.6% Type VII agarose (Sigma) and plated onto a bottom layer of 1.2% agar. For Nutlin-3 treatment, cells were plated into soft agar and left to grow for 24 to 48 hours, after which 1 to 2 mL of fresh media with or without 10 µmol/L Nutlin-3 was added to the top agar and left 24 hours to 2 weeks before photographing and quantifying.
Western, immunoprecipitation, and in vitro binding assays. Whole-cell extracts and immunoprecipitation were carried out as previously described with exceptions as noted (11). Hdm2 and HdmX were immunoprecipitated using 2A10 (Oncogene Research Products, La Jolla, CA) and BL1258 (Bethyl Laboratories, Montgomery, TX) antibodies, respectively. Extracts containing equal quantities of proteins, determined by the Bradford method, were separated by SDS-PAGE (8-12.5% acrylamide) and transferred to polyvinylidene difluoride membranes (Millipore, Bedford, MA). Antibodies to p53 (DO-1 and C19 goat polyclonal) and p21Waf1 (C19) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Additional Hdm2 antibodies IF2 and 4B11 were from Oncogene Research Products. Primary antibodies were detected with goat-anti-mouse or goat-anti-rabbit antibody conjugated to horseradish peroxidase (Hoffman-La Roche, Basel, Switzerland), using enhanced chemiluminescence (Perkin-Elmer, Wellesley, MA). For in vitro binding assays, GST-HdmX was produced in bacteria from the pGEX4 vector. Recombinant Hdm2 and p53 protein were produced and ELISA-based interaction studies were done as previously described (38). Briefly, recombinant p53 was bound to an ELISA plate (96-well format), and recombinant Hdm2 or HdmX were preincubated with the indicated doses of Nutlin3, added to the wells containing p53, and incubated for 1 hour. After extensive washing, the amount of Hdm2 or HdmX bound to p53 was quantified using Hdm2- or HdmX-specific proteins via colorimetric analysis.
RNA isolation and reverse transcription-PCR. Total RNA was isolated using Qiagen RNeasy miniprep kit (Qiagen, Valencia CA). RNA was analyzed for Noxa and p53 expression using an Applied Biosystems GeneAMP PCR System 9700 and Applied Biosystems assays Hs00382168_m1 and Hs00153340_m1 at the Gene Expression Array Core Facility of the Comprehensive Cancer Center of Case Western Reserve University and University Hospitals of Cleveland. Relative Noxa expression was normalized to p53 expression and plotted in Fig. 1D .
|
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To examine further the mechanism of resistance observed in the HdmX and sh-p53 cells following Nutlin-3 treatment, we plated cells onto tissue culture dishes and treated them with increasing doses of Nutlin-3. After 24 hours of treatment, cells were analyzed by fluorescence-activated cell sorting (FACS) and the Western method or fed with fresh media to monitor their long-term survival. In agreement with the observations made with cells in soft agar, vector controls and Hdm2-expressing cells showed a significant increase in the proportion of cells with a sub-G1 DNA content, indicating that the cells were undergoing apoptosis (Fig. 2A, top ). In contrast, HdmX-expressing and sh-p53 cells showed no little sign of undergoing apoptosis following Nutlin-3 treatment (Fig. 2A).
|
Nutlin-3 specifically disrupts the interaction between Hdm2 and p53. One explanation for the resistance of HdmX-expressing cells to Nutlin-3 treatment is that, in contrast to its ability to prevent Hdm2-p53 complexes (33), Nutlin-3 is unable to disrupt HdmX-p53 complexes. To test this point, IRM-ERT cells expressing Hdm2 and HdmX were treated with 10 µmol/L Nutlin-3 for 24 hours, after which Hdm2 or HdmX were immunoprecipitated, and their interactions with p53 were examined by Western analysis. After Nutlin-3 treatment, there was far less p53 bound to Hdm2 (Fig. 3A, compare lanes 1 and 2 ), although there was significantly more Hdm2 immunoprecipitated (compare lanes 1 and 2) and significantly more p53 present in the total lysate (compare lanes 5 and 6). The converse is true in HdmX-expressing cells, where far less HdmX was immunoprecipitated from the extract (compare lanes 3 and 4), yet the amount of p53 coprecipitated was greater (compare lanes 1 and 2, p53 blot). Furthermore, when p53 ubiquitination was examined in a longer exposure, it was noted that HdmX binds efficiently even to ubiquitinated p53 (Fig. 3A, bottom). We also observed an increase in HdmX binding to p53 upon immunoprecipitation of p53 from both Hdm2- and HdmX-expressing cells (data not shown). Further analysis of the p53-Hdm2 and p53-HdmX interactions using bacterially produced recombinant p53, Hdm2, and HdmX showed that Nutlin-3 directly disrupted the interaction between Hdm2 and p53, while doing little to disrupt the direct interaction between HdmX and p53 (Fig. 3B).
|
C mutant. Consistent with our initial observations, vector control cells showed an increasing population of cells having sub-G1 DNA content and significantly reduced long-term survival, whereas HdmX-expressing cells showed little sign of undergoing apoptosis and little decrease in long-term survival (Fig. 4A and B
). Examination of the HdmXC cells revealed a sensitivity to Nutlin-3 similar to vector control cells in both short-term survival, as shown by FACS, and long-term survival.
|
C- expressing cells show similar levels of Hdm2 and p21 induction relative to the control cells, again confirming the need for the COOH-terminal RING finger domain of HdmX for full p53 inhibition (Fig. 4C). Of interest, HdmX protein levels continued to decrease following Nutlin-3 treatment, whereas the HdmX mutant lacking the RING finger domain was not destabilized. To test whether p53 is degraded in cells expressing HdmX, cells were treated with Nutlin-3 for 24 hours and then treated with the proteosome inhibitor ALLN for an additional 4 hours. Combined treatment with Nutlin-3 and proteosome inhibitor induced more p53 accumulation and more slowly migrating forms of p53, consistent with p53 ubiquitination and degradation (Fig. 4D).
HdmX levels determine the sensitivity of normal and cancer cells to Nutlin-3. To insure that the results observed with the IMR-ERT cells are not the result of an undefined effect of E1A or RasV12 expression, we confirmed our findings in hTERT-HME1 cells, an untransformed mammary epithelial cell line. This experiment is particularly important in light of the previously reported interaction between HdmX and E1A, although we were unable to detect E1A bound to either HdmX or Hdm2 in our cells (data not shown). In response to Nutlin-3 treatment, hTERT-HME1 cells undergo arrest rather than apoptosis (data not shown). Similar to our findings in IMR-ERT cells, vector-infected and HdmXC-expressing cells had a 94% decrease in cell number following 10 µmol/L Nutlin-3 treatment relative to untreated cells (Fig. 5A
). In contrast, HdmX expression conferred significant protection from the Nutlin-3–mediated growth inhibition, with only a 32% decrease in cell number relative to control at the same concentration (Fig. 5A). Also consistent with the IRM-ERT cells is the decreased induction of Hdm2 and decreased expression of exogenous HdmX expression following Nutlin-3 treatment. The vector-infected and HdmXC-expressing cells showed equivalent Hdm2 induction (Fig. 5B).
|
Thus, in three different cell models, we conclude that HdmX expression is a determining factor of Nutlin-3 sensitivity. HdmX expression inhibits Hdm2 induction by decreasing Hdm2 transcription (a global effect of HdmX-mediated p53 inhibition) and by active cooperative degradation of Hdm2-HdmX complexes. With decreased levels of Hdm2 present, the stable HdmX protein continues to repress p53-dependent apoptosis or cell cycle arrest.
Combining Nutlin-3 and Adriamycin leads to the synergistic killing of Nutlin-3–resistant cells. Although the lack of p53-dependent apoptosis or arrest in cells expressing HdmX is clear, the fact that p53 protein is still stabilized in response to Nutlin-3 treatment may be exploited if the HdmX-mediated inhibition of p53 can be prevented. Importantly, much like Hdm2-p53 complexes, HdmX-p53 complexes can be disrupted by phosphorylation in response to DNA damage (22, 23). To assess whether DNA damage can facilitate the activity of p53 in HdmX-expressing cells treated with Nutlin-3, we first treated HdmX- or Hdm2-expressing cells with a low dose of Nutlin-3 (3 µmol/L), and 24 hours later, added Adriamycin, at either 10 or 20 nmol/L, for an additional 24 hours. Nutlin-3 treatment alone reduced cell survival by 20% in HdmX-expressing cells and 50% in Hdm2-expressing cells. Similarly, 10 nmol/L Adriamycin alone modestly decreased survival of both populations by 20%. However, combined treatment with Nutlin-3 and Adriamycin synergistically reduced the viability of both populations achieving a 98% reduction in viability for both populations at the highest dose of Adriamycin. Western analysis revealed that the induction of Hdm2 protein correlated inversely with survival, whereas HdmX protein levels correlated directly with survival, arguing that HdmX degradation is an important factor in the full activation of p53 in response to nongenotoxic induction.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
p53-Hdm2-HdmX triad: balance is the key. In normal cells, a defined balance in the relative levels of Hdm2 and HdmX, either individually or cooperatively, regulate p53 functions, keeping target gene transcription at levels that do not cause apoptosis or cell cycle arrest. Because hdm2 is a transcriptional target of p53, its expression also remains low relative to the levels induced after p53 activation, whereas hdmX expression remains constitutive in all experimental conditions examined thus far (20, 21, 23).
In this report, we use isogenic populations of normal human fibroblasts transformed by hTERT, E1A, oncogenic Ras, and either Hdm2, HdmX, or shRNA to p53 to determine the effects of Nutlin-3 in cells with wild-type p53. Hdm2-expressing cells are sensitive to Nutlin-3, whereas HdmX-expressing cells or cells with low levels of p53 remain unaffected. Upon treatment with Nutlin-3, Hdm2-p53 complexes are disrupted, leading to stabilization of p53. Provided that the level of HdmX protein is not high, the disruption of Hdm2-p53 complexes leaves enough free p53 to transactivate proapoptotic and/or cell cycle arrest genes, as well as hdm2 itself. The additional Hdm2 protein binds to HdmX, promoting its degradation and leading to a positive feedback loop, in which p53 activity continues to increase.
Unbalanced HdmX levels dictate sensitivity and resistance to Nutlin-3. In cells overexpressing HdmX, the level of Hdm2 is low due to the HdmX-mediated inhibition of p53-dependent transactivation. Upon treatment with Nutlin-3, HdmX-p53 complexes are unaffected, and the increase in p53 levels comes from the smaller pool of Hdm2-p53 complexes, leading to diminished induction of p53 target genes, including hdm2. Lower levels of Hdm2 lead to decreased HdmX degradation and ultimately more HdmX-p53 complexes, which keep p53 inactive. In contrast, decreased HdmX expression, as seen in our experiments using shRNA to HdmX, has the opposite effect. In this instance, p53-Hdm2 interactions are predominant, leaving the majority of p53 free following Nutlin-3 treatment. This effect translates into increased growth suppression or apoptosis, as seen in our experiments with cells growing in soft agar. What remains unclear from our experiments, and from most studies that examine Hdm2-HdmX interactions, is the contribution of the Hdm2-HdmX dimer to p53 regulation. Although Hdm2 and HdmX have been reported to require one another for stability and nuclear localization, respectively (18), whether a heterodimer can bind to p53 and ubiquitinate it remains unclear.
The fact that HdmX-p53 interactions are not disrupted by Nutlin-3 is, at first glance, unexpected. Detailed analysis of peptides by phage display suggested a strong similarity between the p53 binding domains of HdmX and Hdm2. However, there were also clear differences in the ability of specific peptides to disrupt p53-Hdm2 and p53-HdmX interactions, with as much as a 10-fold difference in competition (41). This may reflect the differences noted between critical amino acids shown to be important contact points between p53 and Hdm2: 4 of 14 differ between HdmX and Hdm2. Additionally, the p53-binding domains of the two proteins share only 66% similarity, more than enough difference to explain the differential effects of Nutlin-3 on Hdm2 and HdmX described here.
Is p53 function in tumor cells ever really wild type? The observations presented here are important in a number of respects. First, Hdm2 and HdmX overexpression are observed in diverse tumor types, predominantly in soft tissue and breast cancers. Conventional therapeutic approaches, such as chemotherapy and radiation therapy, tend to perform poorly in tumors that overexpress Hdm2, which is commonly associated with advanced, metastatic, and hormone-independent cancers. There is little information regarding whether HdmX-overexpressing tumors respond similarly. However, the cells transformed in vitro by Hdm2 or HdmX overexpression described here show similar apoptosis-resistant responses to Adriamycin or ionizing radiation (Fig. 6 ).4 Danovi et al. recently described the first comprehensive analysis of HdmX, Hdm2, and p53 expression in multiple tumor types (26). HdmX protein was overexpressed in nearly 20% of the breast, colon, and lung cancers examined. Sequence analysis of the p53 gene in tumors overexpressing HdmX revealed that p53 was wild type, and tumors having HdmX amplification had normal Hdm2 copy number (26). In addition, at least two different splice variants of HdmX have been detected in tumor samples, the expression of which correlates with decreased patient survival (42–44).
|
|
Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Steven Berberich for the HdmX cDNA and Richard Iggo (Oncogene Group, Swiss Institute for Experimental Cancer Research [ISREC], Epalinges, Switzerland) for the sh-Hdm2 constructs.
|
Footnotes |
|---|
Received 10/24/05. Revised 1/ 3/06. Accepted 1/19/06.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
|
|
 |
|
  W. Du, J. Wu, E. M. Walsh, Y. Zhang, C. Y. Chen, and Z.-X. J. Xiao Nutlin-3 Affects Expression and Function of Retinoblastoma Protein: ROLE OF RETINOBLASTOMA PROTEIN IN CELLULAR RESPONSE TO NUTLIN-3 J. Biol. Chem., September 25, 2009; 284(39): 26315 - 26321. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Rinaldo, A. Prodosmo, F. Siepi, A. Moncada, A. Sacchi, G. Selivanova, and S. Soddu HIPK2 Regulation by MDM2 Determines Tumor Cell Response to the p53-Reactivating Drugs Nutlin-3 and RITA Cancer Res., August 1, 2009; 69(15): 6241 - 6248. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Kallen, A. Goepfert, A. Blechschmidt, A. Izaac, M. Geiser, G. Tavares, P. Ramage, P. Furet, K. Masuya, and J. Lisztwan Crystal Structures of Human MdmX (HdmX) in Complex with p53 Peptide Analogues Reveal Surprising Conformational Changes J. Biol. Chem., March 27, 2009; 284(13): 8812 - 8821. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Forte and M. A. Luftig MDM2-Dependent Inhibition of p53 Is Required for Epstein-Barr Virus B-Cell Growth Transformation and Infected-Cell Survival J. Virol., March 15, 2009; 83(6): 2491 - 2499. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Tabe, D. Sebasigari, L. Jin, M. Rudelius, T. Davies-Hill, K. Miyake, T. Miida, S. Pittaluga, and M. Raffeld MDM2 Antagonist Nutlin-3 Displays Antiproliferative and Proapoptotic Activity in Mantle Cell Lymphoma Clin. Cancer Res., February 1, 2009; 15(3): 933 - 942. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Wade and G. M. Wahl Targeting Mdm2 and Mdmx in Cancer Therapy: Better Living through Medicinal Chemistry? Mol. Cancer Res., January 1, 2009; 7(1): 1 - 11. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. A. Bassett, W. Wang, F. Rastinejad, and W. S. El-Deiry Structural and Functional Basis for Therapeutic Modulation of p53 Signaling Clin. Cancer Res., October 15, 2008; 14(20): 6376 - 6386. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Shangary and S. Wang Targeting the MDM2-p53 Interaction for Cancer Therapy Clin. Cancer Res., September 1, 2008; 14(17): 5318 - 5324. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Shangary, D. Qin, D. McEachern, M. Liu, R. S. Miller, S. Qiu, Z. Nikolovska-Coleska, K. Ding, G. Wang, J. Chen, et al. Temporal activation of p53 by a specific MDM2 inhibitor is selectively toxic to tumors and leads to complete tumor growth inhibition PNAS, March 11, 2008; 105(10): 3933 - 3938. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W.-C. L. Chang, R. A. Coudry, M. L. Clapper, X. Zhang, K.-L. Williams, C. S. Spittle, T. Li, and H. S. Cooper Loss of p53 enhances the induction of colitis-associated neoplasia by dextran sulfate sodium Carcinogenesis, November 1, 2007; 28(11): 2375 - 2381. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. E. Kan, J. T. Patton, G. R. Stark, and M. W. Jackson p53-Mediated Growth Suppression in Response to Nutlin-3 in Cyclin D1 Transformed Cells Occurs Independently of p21 Cancer Res., October 15, 2007; 67(20): 9862 - 9868. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Hu, D. M. Gilkes, and J. Chen Efficient p53 Activation and Apoptosis by Simultaneous Disruption of Binding to MDM2 and MDMX Cancer Res., September 15, 2007; 67(18): 8810 - 8817. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. V. Wang, M. Wade, E. Wong, Y.-C. Li, L. W. Rodewald, and G. M. Wahl Quantitative analyses reveal the importance of regulated Hdmx degradation for P53 activation PNAS, July 24, 2007; 104(30): 12365 - 12370. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. S. Bentle, K. E. Reinicke, Y. Dong, E. A. Bey, and D. A. Boothman Nonhomologous End Joining Is Essential for Cellular Resistance to the Novel Antitumor Agent, {beta}-Lapachone Cancer Res., July 15, 2007; 67(14): 6936 - 6945. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. C.A. Graat, J. E. Carette, F. H.E. Schagen, L. T. Vassilev, W. R. Gerritsen, G. J.L. Kaspers, P. I.J.M. Wuisman, and V. W. van Beusechem Enhanced tumor cell kill by combined treatment with a small-molecule antagonist of mouse double minute 2 and adenoviruses encoding p53 Mol. Cancer Ther., May 1, 2007; 6(5): 1552 - 1561. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. E. Petre, S.-H. Sin, and D. P. Dittmer Functional p53 Signaling in Kaposi's Sarcoma-Associated Herpesvirus Lymphomas: Implications for Therapy J. Virol., February 15, 2007; 81(4): 1912 - 1922. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J.-C. W. Marine, M. A. Dyer, and A. G. Jochemsen MDMX: from bench to bedside J. Cell Sci., February 1, 2007; 120(3): 371 - 378. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Jiang, N. Pabla, R. F. Murphy, T. Yang, X.-M. Yin, K. Degenhardt, E. White, and Z. Dong Nutlin-3 Protects Kidney Cells during Cisplatin Therapy by Suppressing Bax/Bak Activation J. Biol. Chem., January 26, 2007; 282(4): 2636 - 2645. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. A. LaRusch, M. W. Jackson, J. D. Dunbar, R. S. Warren, D. B. Donner, and L. D. Mayo Nutlin3 Blocks Vascular Endothelial Growth Factor Induction by Preventing the Interaction between Hypoxia Inducible Factor 1{alpha} and Hdm2 Cancer Res., January 15, 2007; 67(2): 450 - 454. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Hu, D. M. Gilkes, B. Farooqi, S. M. Sebti, and J. Chen MDMX Overexpression Prevents p53 Activation by the MDM2 Inhibitor Nutlin J. Biol. Chem., November 3, 2006; 281(44): 33030 - 33035. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Wade, E. T. Wong, M. Tang, J. M. Stommel, and G. M. Wahl Hdmx Modulates the Outcome of P53 Activation in Human Tumor Cells J. Biol. Chem., November 3, 2006; 281(44): 33036 - 33044. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. W. Jackson, L. E. Patt, G. A. LaRusch, D. B. Donner, G. R. Stark, and L. D. Mayo Hdm2 Nuclear Export, Regulated by Insulin-like Growth Factor-I/MAPK/p90Rsk Signaling, Mediates the Transformation of Human Cells J. Biol. Chem., June 16, 2006; 281(24): 16814 - 16820. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
