Cancer Research The Future of Cancer Research: Science and Patient Impact Tumor Immunology: New Perspectives
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Affar, E. B.
Right arrow Articles by Shi, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Affar, E. B.
Right arrow Articles by Shi, Y.
[Cancer Research 66, 3456-3462, April 1, 2006]
© 2006 American Association for Cancer Research

Molecular Biology, Pathobiology, and Genetics

Targeted Ablation of Par-4 Reveals a Cell Type–Specific Susceptibility to Apoptosis-Inducing Agents

El Bachir Affar1, Margaret Po-shan Luke1, Frédérique Gay1, Dominica Calvo1, Guangchao Sui1, Robert S. Weiss2, En Li3 and Yang Shi1

1 Department of Pathology, Harvard Medical School, Boston, Massachusetts; 2 Department of Biomedical Sciences, Cornell University, Ithaca, New York; and 3 Cardiovascular Research Center, Massachusetts General Hospital, Harvard Medical School, Charlestown, Massachusetts

Requests for reprints: Yang Shi, Department of Pathology, Harvard Medical School, 77 Louis Pasteur Avenue, NRB854b, Boston, MA 02115. Phone: 617-432-4318; Fax: 617-432-6687; E-mail: yang_shi{at}hms.harvard.edu.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The prostate apoptosis response-4 (Par-4) protein has been shown to function as an effector of cell death in response to various apoptotic stimuli, and down-regulation of this protein has been suggested to be a key event during tumorigenesis. Several studies suggest an essential function for the COOH-terminal leucine repeats/death domain of Par-4 in mediating apoptosis. We investigated the biological role of this domain in vivo by generating knock-out mice expressing a Par-4 mutant protein lacking the COOH terminus domain. We found that the Par-4 mutant mice are viable and fertile with no overt phenotype, thus excluding an essential role for the COOH terminus domain of Par-4 in embryogenesis and developmental apoptosis. To determine the requirement of Par-4 for apoptosis, we treated primary fibroblasts with various stimuli that trigger mitochondria and membrane receptor cell death pathways. Fibroblasts isolated from Par-4 mutant mice are as sensitive as the wild-type cells to these apoptosis-inducing agents. Similar effects were observed following RNA interference (RNAi)–mediated knockdown of Par-4 in these cells. In contrast, RNAi-mediated depletion of Par-4 in HeLa cells resulted in a significant inhibition of apoptosis induced by various proapoptotic agents. Taken together, our findings provide strong genetic evidence that the proapoptotic function of Par-4 is dependent on the cellular context and raise the possibility that alterations of Par-4 function may occur during carcinogenesis. (Cancer Res 2006; 66(7): 3456-62)


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
The ubiquitously expressed prostate apoptosis response-4 (Par-4) protein was first identified as a gene whose expression is elevated in prostate cancer cells undergoing apoptosis following treatment with calcium ionophores (1). Consistently, an increase in Par-4 expression concomitant with cell death has been observed in the rat prostate after castration. In addition, inhibition of calcium signaling prevented Par-4 elevation and regression of the prostate gland (1). Furthermore, this protein has been suggested to induce and/or promote apoptosis in several cell types in response to various stress stimuli (2–13). Depending on the cellular context, Par-4 overexpression has been shown either to be sufficient to induce apoptosis (2, 7, 9, 14, 15) or to increase the sensitivity of the cells to apoptotic agents (3, 5, 10, 11, 16). In addition, inhibition of Par-4 expression or function decreases or abolishes the apoptotic response induced by various treatments (3, 10–12). Recently, it has been reported that Par-4-deficient cells are more resistant to tumor necrosis factor-{alpha} (TNF-{alpha})–induced apoptosis than the wild-type cells (17).

Consistent with its ability to induce and promote cell death, Par-4 has been shown to be down-regulated during cellular transformation induced by Ras oncogene (18, 19). Down-regulation of Par-4 was proposed to be a critical event in tumorigenesis because ectopic expression of Par-4 decreases cell survival in colony formation assay and inhibits tumor formation of Ras-transformed cells (19). In addition, a significant down-regulation of Par-4 expression was also detected in human renal carcinoma cells (20). Supporting these findings, it has been shown recently that the Par-4 knock-out mice are prone to cancer (21).

Several studies investigating the role and mechanism of action of Par-4 in apoptosis have attributed a crucial function to the COOH terminus domain of the protein. One of the most noticeable structural features of Par-4 COOH terminus is the leucine zipper repeats and the putative death domain found in several other proteins involved in apoptosis (2), suggesting the importance of this region for Par-4 function. Moreover, it has been shown in several cases that the COOH terminus region of Par-4, but not its NH2 terminus, can interfere with Par-4 function by a likely dominant-negative inhibition effect (3, 11, 22). The importance of the COOH terminus domain for Par-4 function is further supported by the fact that all described physical interactions between Par-4 and its binding partners (PKCs, WT1, DLK/ZIP, THAP1, Dopamine D2 receptor, and Akt) require this domain (2, 5, 11, 13, 23, 24). For instance, it has been proposed that Par-4 promotes apoptosis by inhibiting, via its COOH terminus domain, the atypical PKCs kinases, which are important upstream regulators of the survival function of nuclear factor-{kappa}B (2, 14, 15, 17, 25, 26). Alternatively, we have previously shown that Par-4 interacts, through the COOH terminus domain, with the WT1 tumor suppressor gene (23). This interaction is proposed to increase the WT-1-mediated repression function (23). Consistently, Par-4 and WT1 interact physically and functionally on the promoter of the antiapoptotic protein, Bcl-2 (27), whose expression is down-regulated by Par-4 (16, 27, 28). Recently, it has been shown that Akt binds and phosphorylate Par-4 resulting in an inhibition of its proapoptotic function. Akt-mediated inactivation of Par-4 seems to be an important event for the survival of cancer cells (13).

Although numerous studies suggest a crucial role of Par-4 COOH terminus domain in apoptosis, direct evidence for its functional requirement in this process is still lacking. In this study, we used a conditional gene targeting strategy to generate mice expressing a Par-4 protein lacking its COOH terminus. These mice develop normally and do not display any obvious abnormal morphology. Furthermore, we found that the apoptotic response of the Par-4 mutant and Par-4 RNA interference (RNAi)–depleted primary fibroblasts is indistinguishable from that of the wild-type cells. In contrast, a significant resistance to several apoptotic agents is observed in HeLa tumoral cells following depletion of Par-4 by RNAi. Altogether, these data indicate that the requirement of Par-4 for apoptosis is cell type specific and suggest possible alterations of the Par-4 function during tumorigenesis.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Preparation of the targeting construct and generation of Par-4 mutant mice. A mouse strain 129/Sv genomic DNA library (Stratagene, La Jolla, CA) was screened using the rat par-4 cDNA. Of the isolated clones, genomic fragments containing exons corresponding to the COOH terminus region were isolated and mapped by restriction enzyme digestions. These fragments were used to construct a targeting vector in which exons 4 and 5 of the par-4 gene were flanked with LoxP sequences (see Fig. 1 ). Generation of embryonic stem cells and conditional knock-out mice were carried out as described previously (29). The Par-4 conditional mice were generated to mutate par-4 in a cell- or tissue-specific manner in case of embryonic lethality caused by par-4 mutation in the entire organism. In this study, we generated the constitutive mutant mice by crossing the Par-4 conditional mice with the EIIa mouse strain, which ubiquitously expresses Cre recombinase (30). The excision of the par-4 allele was germ line transmitted, ensuring the deletion of the Par-4 COOH terminus domain in all tissues.


Figure 1
View larger version (26K):
[in this window]
[in a new window]
  		Figure 1. Generation of the Par-4 mutant mice. A, schematic representation of a portion of the par-4 genomic locus surrounding the targeted exons (E4 and E5). The targeting construct contains three LoxP sites ({blacktriangleright}) flanking the exons 4 and 5 and the neomycin resistance cassette. The recombined locus (par-4LoxP) and the excised locus (mpar-4) resulting from the action of Cre recombinase. Position of the 5' external probe (probe A) and the 3' internal probe (probe B). X, XhoI; S, SacI; K, KpnI; Sl, SalI. B, identification of mice with homologous recombination of the par-4 locus. The genomic DNA was digested with SacI and analyzed by Southern blotting with the 5' external probe. Lanes 1 and 4, wild-type mice; lanes 2 and 3, heterozygous mice with a recombined par-4 allele. C, Western blotting analysis of total liver proteins from mice with germ line transmission of the excised Par-4 COOH terminus. Top, wild-type Par-4 protein and the mutant protein lacking the COOH terminus. Actin protein was also detected to verify the equal loading of proteins.

 
Isolation and treatment of mouse embryonic fibroblasts. Embryos were isolated from pregnant females at 13.5 days after coitum. Mouse embryonic fibroblasts (MEF) were isolated from the carcasses using trypsin digestion. The cells were then plated and cultured for 2 days before treatment with various apoptosis inducers and subsequent harvesting at the indicated times. All manipulations and treatments of MEFs were done during the first two to three passages, before the onset of senescence as judged by their exponential proliferation rates and the absence of large and flat cells. Etoposide, vincristine, ionomycin, Adriamycin, cycloheximide, and staurosporine were purchased from Sigma-Aldrich (St. Louis, MO). Fas ligand and ionophore A23187 were from Alexis (San Diego, CA). TNF-{alpha} was from R&D Systems (Minneapolis, MN). For UVC treatment of the cells, the culture dishes were irradiated with 20 J/m2 in PBS using a UV cross-linker (UVC 500, Hoefer Scientific Instruments, San Francisco, CA).

3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay. When incubated with the cells, the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) compound is metabolized into a colored product whose absorbance is proportional to the viability of the cells (31). Briefly, MEFs were treated with various apoptosis inducers as indicated in the figure legends. After the treatment, the medium was removed and replaced with serum-free medium containing MTT at 200 µg/mL. The cells were then incubated at 37°C for 30 minutes, and the product of the reaction was extracted with DMSO. The absorbance was then measured at 490 nm with a microplate reader, and the results were expressed as the percentage of MTT conversion relative to the absorbance of the untreated cells.

Flow cytometry analysis. The cell cycle analysis was conducted essentially according Shah et al. (32). Briefly, cells were fixed with 50% ethanol for 10 minutes at room temperature. The cells were washed with PBS, treated with 100 µg/mL RNase A for 30 minutes at 30°C, stained with 50 µg/mL propidium iodide, and analyzed with a FACSCalibur machine and Cellquest software (Becton Dickinson, Mountain View, CA).

Caspase activity assay and Western blotting. Cells were lysed in an ice-cold hypotonic buffer [25 mmol/L HEPES (pH 7.5), 1 mmol/L EGTA, 5 mmol/L MgCl2, 0.1% Triton X-100, 1 mmol/L phenylmethylsulfonyl fluoride, 1 mmol/L DTT, anti-protease mixture tablet]. DEVDase activity was assayed in the total cell extract using the substrate DEVD-pNA according to the method described by Gurtu et al. (33). Protein determination was done using the Bradford's procedure (34). SDS-PAGE, Western blotting, and peroxidase-based chemiluminescence detection were done according to standard laboratory protocols. The anti-Par-4 antibody (R334) was from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). The anti-LaminA/C antibody was from Cell Signaling Technology, Inc. (Beverly, MA). The anti-Actin antibody was from Chemicon International, Inc. (Temecula, CA).

RNAi-mediated knockdown of Par-4 and treatments with apoptosis-inducing agents. RNAi was conducted using a DNA vector–based approach as previously described (35). We generated two different RNAi constructs that target identical sequences of the mouse and human par-4 cDNA: RNAi A, GGCAAGGGGCAGATCGAGAAGA; RNAi B, GTGCTTAGATGAGTACGAAGAT. The RNAi constructs for Par-4 and the control vectors were cotransfected in MEFs along with a green fluorescent protein (GFP)–encoding plasmid using LipofectAMINE 2000. The efficiency of the RNAi-mediated Par-4 knockdown in the GFP-positive cells was determined by immunostaining using an anti-Par-4 antibody as previously described (35). For cell death assays, the RNAi or the control plasmids were cotransfected with the pBABE vector containing the puromycin resistance encoding gene. The transfected cells were selected for 2 to 3 days with 3 and 1.5 µg/mL of puromycin in MEFs and HeLa cells, respectively. Control and Par-4-depleted cells were treated with various apoptosis-inducing agents and analyzed for survival by a direct counting using trypan blue exclusion assay.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Generation of Par-4 COOH terminus–deficient mice. We used the bacteriophage P1–derived Cre-LoxP system to generate Par-4 COOH terminus–deficient mice (36, 37). The targeting construct contained a phosphoglycerate kinase-neomycin selection cassette that was also flanked with two LoxP sites, allowing excision of the selection marker (Fig. 1A). We first generated a conditional mouse strain in which exons 4 and 5 encoding in the COOH terminus of the Par-4 were flanked by two LoxP sites. As shown in Fig. 1B, Southern blotting experiments with a 5' external probe showed only one band in the wild-type mice (lanes 1 and 4). Two bands were observed in the Par-4 conditional mice, the wild-type band and a lower band corresponding to the predicted recombined allele (Fig. 1B, lanes 2 and 3). We first wanted to determine the effects of the deletion of Par-4 COOH terminus in all mouse tissues. Thus, we crossed the Par-4 conditional mice with a mouse strain expressing the Cre recombinase under the control of the adenoviral promoter EIIa, which allows the expression of the enzyme in both somatic and germinal cells (30). We next established mouse lines with a germ line–transmitted Par-4 lacking its COOH terminus (mPar-4). As indicated in Fig. 1C, the full length Par-4 protein was detected in the liver of the wild-type mice (lane 1). The heterozygous (lanes 4 and 5) and the homozygous (lanes 2 and 3) animals express the mutant protein lacking the COOH terminus region. Analysis of Par-4 protein expression in other tissues of Par-4 COOH terminus–deficient mice showed identical results (data not shown). Because we excised exons 4 and 5, we could not exclude the possibility of splicing between exons 3 and 6, the last exon of the par-4 gene. If this was to occur, a stop codon would be created, abolishing the translation of the last exon. Therefore, only the NH2-terminal 220 amino acids of Par-4 corresponding to exons 1, 2, and 3 were expressed in the mutant mice.

Par-4 mutant mice are viable and fertile with no overt pathologies. The Par-4 mutant mice were born at the expected Mendelian ratio. Furthermore, the Par-4 mutant mice were fertile and did not show any noticeable difference in body weight and global characteristics compared with their wild-type littermates. However, the Par-4 mutant mice exhibited noticeable depression-like behaviors (24). Histopathologic examination of various tissues of the mice did not reveal any gross morphologic and anatomic abnormalities (data not shown). These data indicate that a functional COOH terminus domain of Par-4 protein is not required for cell growth, proliferation, and embryonic development. In addition, we did not observe any decrease of the survival of the Par-4 mutant mice due to spontaneous tumorigenesis.

Par-4 is not required for apoptosis in primary fibroblasts. To determine the role of Par-4 in cell death, we isolated MEFs from wild-type and mutant mice. These cells were treated with several agents known to induce cell death through the mitochondria pathway, and cell death was analyzed over time using the MTT assay. We first treated the cells with calcium ionophores, chemicals that were previously reported to trigger the Par-4-dependent apoptosis response (1, 3). As shown in Fig. 2 , following treatment with ionomycin or A23187, the cell viability decreased in a dose-dependent manner, as determined by the low percentage of MTT conversion when compared with the untreated cells. However, no significant differences were observed between the wild-type and the Par-4 mutant MEFs. This indicates that the Par-4 COOH terminus is not required for calcium overload–mediated cell death. We next treated the wild-type and the Par-4 mutant MEFs with staurosporine, an inhibitor of PKCs widely used to trigger mitochondria-mediated apoptosis (38, 39). Following treatment with two concentrations of staurosporine, the percentage of cell death in wild-type and Par-4 mutant MEFs was essentially the same (Fig. 2). We also used etoposide and adriamycin (40) to determine the sensitivity of Par-4 mutant MEFs to DNA-damaging agents. As shown in Fig. 2, the Par-4 mutant cells were as sensitive as their wild-type counterparts, because no significant differences in MTT metabolization were observed between the two cell types following treatment with two concentrations of etoposide and Adriamycin.


Figure 2
View larger version (17K):
[in this window]
[in a new window]
  		Figure 2. Viability of wild-type and Par-4 mutant MEFs following treatments with different cell death inducers. Low-passage MEFs were treated with various apoptosis inducing agents for the indicated times and were then analyzed for their capability to metabolize the MTT compound. The experiments have been done on at least two different MEFs preparations. For each treatment and genotype, the data are expressed as a percentage of the values measured at time 0. Points, averages of three to five determinations; bars, SD. Wild-type ({blacksquare}) and the Par-4 (bullet) mutant MEFs treated with 2 µmol/L ionomycin, 2 µmol/L A23187, 200 nmol/L staurosporine, 30 µmol/L etoposide, and 0.5 µg/mL adriamycin. Wild-type ({circ}) and the Par-4 (x) mutant MEFs treated with 10 µmol/L ionomycin, 5 µmol/L A23187, 1 µmol/L staurosporine, 100 µmol/L etoposide, and 2 µg/mL adriamycin.

 
Because the MTT conversion assay does not distinguish the mode of cell death, we specifically examined apoptotic cell death with fluorescence-activated cell sorting analysis of the sub-G0 population following treatment with apoptotic inducers and labeling of the DNA with propidium iodide. Figure 3A shows a representative cell cycle profile in wild-type and Par-4 mutant cells. After UVC treatment, both wild-type and Par-4 mutant MEFs underwent apoptotic cell death as indicated by the accumulation of cells with low DNA content at the sub-G0 population. Analysis of the percentage of the sub-G0 cells did not show significant differences between the wild-type and the Par-4 mutant cells treated with UVC, etoposide, or staurosporine (Fig. 3B). Furthermore, we analyzed caspases activation, a hallmark of apoptotic cell death, by analyzing the cleavage products of one of their substrates, Lamin A/C. In response to etoposide and UVC treatments, the Lamin A/C were cleaved to a similar extent in the wild-type and the Par-4 mutant cells (Fig. 3C). Thus, similar apoptotic responses are observed in wild-type and Par-4 COOH terminus–deficient cells in response to various cell death inducers.


Figure 3
View larger version (32K):
[in this window]
[in a new window]
  		Figure 3. Apoptosis upon activation of the mitochondria pathway in wild-type and Par-4 mutant MEFs. Flow cytometry analysis of the sub-G0 population following treatment inducing cell death. The cells were treated with various apoptosis inducers and were harvested at the indicated time, fixed, stained with the propidium iodide, and analyzed for their DNA content by flow cytometry. A, a representative example showing a cell cycle profile in untreated wild-type and Par-4 mutant MEFs. Following treatment with UVC (20 J/m2), a cell population with a lower DNA content, indicative of apoptosis is observed in both cell types (bottom). B, quantification of the sub-G0 cell population following treatment with apoptosis inducers (1 µmol/L staurosporine, 100 µmol/L etoposide, and 20 J/m2 UVC) in wild-type (open columns) and Par-4 mutant (dark columns) cells. Columns, averages obtained from three analysis; bars, SD. C, caspase-mediated Lamin A/C cleavage in wild-type and Par-4 mutant MEFs following apoptotic treatment. Cells were treated with 100 µmol/L etoposide or 20 J/m2 UVC, and both floating and attached cells were harvested at the indicated times for Western blotting analysis using an anti-Lamin A/C antibody. The cleavage product of Lamin A/C, a characteristic of apoptosis, was produced at the same extent in both cell types.

 
To determine the sensitivity of the Par-4 mutant cells to receptor-mediated apoptosis, we treated MEFs with Fas ligand and TNF-{alpha} in the presence of cycloheximide to inhibit survival pathways. The cell death was analyzed by trypan blue exclusion assay. Following treatment with Fas ligand, the percentage of viable wild-type or mutant cells decreased gradually to ~30% after 48 hours (Fig. 4A ). This response was similar in the wild-type and Par-4 mutant cells. In response to TNF-{alpha}, the wild-type and mutant MEFs underwent similar rate of cell death (Fig. 4A). We next examined caspase activity by using the peptide DEVD-pNA. This analysis showed that in response to Fas and TNF, no differences in caspases activation was observed between the wild-type and the Par-4 mutant MEFs (Fig. 4B).


Figure 4
View larger version (17K):
[in this window]
[in a new window]
  		Figure 4. Apoptosis following activation of cell membrane receptors. A, cell death determined by trypan blue exclusion assay in wild-type and Par-4 mutant MEFs following treatment with Fas ligand (100 ng/mL) and TNF-{alpha} (30 ng/mL) in the presence of cycloheximide (10 µg/mL). Wild-type ({blacksquare}) and the Par-4 ({blacktriangleup}) mutant MEFs. Points, average percentages measured at time 0 of three determinations; bars, SD. B, caspase activation following apoptotic treatments. The wild-type MEFs (open columns) and the Par-4 mutant cells (dark columns). The total cell extracts were used to determine the DEVDase activity indicative of caspase activation. Columns, averages of three determinations; bars, SD.

 
Because the Par-4 mutant MEFs express the NH2-terminal fragment of the protein, we can not exclude that deletion of the Par-4 COOH terminus is not sufficient to abolish the activity of this protein. We, thus, also conducted RNAi in MEFs to determine the effects of knockdown of Par-4 on apoptosis. A shown in Fig. 5A , the two RNAi constructs efficiently depleted endogenous Par-4 in MEFs. Following treatments with several apoptosis inducing agents, the Par-4-depleted cells underwent a similar extent of cell death as that observed in the control-transfected cells (Fig. 5B).


Figure 5
View larger version (28K):
[in this window]
[in a new window]
  		Figure 5. RNAi-mediated knockdown of Par-4 in MEFs and treatment with apoptosis-inducing agents. A, MEFs were cotransfected with the Par-4 RNAi or the control vectors and a plasmid encoding a GFP. After 3 days, immunostaining for endogenous Par-4 was done with a R334 polyclonal antibody, and the nuclei were stained with 4',6-diamidino-2-phenylindole (DAPI). B, MEFs were cotransfected with the Par-4 RNAi or control constructs and a vector containing the puromycin resistance gene and selected for 3 days with 3 µg/mL puromycin. Control and Par-4-depleted cells were treated with 100 µmol/L etoposide, 5 µmol/L A23187, 2 µg/mL adriamycin, 1 µmol/L staurosporine, and 100 nmol/L vincristine for 72 hours and analyzed for survival by direct counting using trypan blue exclusion assay. For each treatment, the data are expressed as a percentage of the values measured at time 0. Columns, averages of three to four determinations; bars, SD.

 
Depletion of Par-4 renders HeLa cells resistant to apoptosis-inducing agents. Because Par-4 overexpression has been shown to induce apoptosis in some tumoral but not normal cells (7, 9, 15), we wanted to determine whether Par-4-mediated apoptosis is cell type specific. Thus, we depleted Par-4 in HeLa cells and treated them with various apoptosis-inducing agents. As shown in Fig. 6A , the two Par-4 RNAi constructs depleted endogenous Par-4 protein. However, the RNAi-B construct was more potent than the RNAi-A construct in depleting Par-4. Interestingly, the cells partially depleted in Par-4 showed only a small increase in surviving cells after treatment with etoposide and staurosporine (Fig. 6B). In contrast, cells with near complete depletion of Par-4 showed a significant resistance to most apoptosis-inducing agents (Fig. 6B). Consistent with these viability assays, Par-4-depleted cells showed less caspase activation than the control RNAi-transfected cells (Fig. 6C).


Figure 6
View larger version (27K):
[in this window]
[in a new window]
  		Figure 6. Par-4 depletion in HeLa cells and sensitivity to apoptosis-inducing agents. A, HeLa cells were cotransfected with the Par-4 RNAi or the control vectors and a plasmid containing the puromycin resistance gene. After 2 days of selection with 1.5 µg/mL puromycin, detection of endogenous Par-4 was done by Western blotting using the R334 polyclonal antibody. Anti-actin was used to verify equal loading of the proteins. B, HeLa cells transfected with the Par-4 RNAi or control constructs were treated with 100 nmol/L staurosporine, 100 µmol/L etoposide, 5 µmol/L A23187, 2 µg/mL Adriamycin, or 20 J/m2 for 48 hours and analyzed for survival by a direct counting using trypan blue exclusion assay. For each treatment, the data are expressed as a percentage of the values measured at time 0. Columns, averages of three to four determinations; bars, SD. C, caspase activation following apoptotic treatments. Total cell extracts were used to determine the DEVDase activity indicative of caspase activation. Columns, averages of four determinations; bars, SD.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
In this study, we have used a gene targeting approach to delete the COOH terminus of the Par-4 protein in mice. The homozygous mutant mice are viable and do not show any obvious abnormal phenotype. These results are in agreement with recent reports showing that genetic deletion of the entire par-4 gene had no effect on embryonic development, and that the Par-4-deficient mice did not exhibit apparent pathologies or morphologic alterations (17, 41). Of note, Blast Search in the National Center for Biotechnology Information database failed to detect any putative Par-4 homologue or protein structurally similar that might have compensated for the loss of function caused by the deletion of Par-4 COOH terminus.

We first used primary fibroblasts to investigate the role of Par-4 in apoptosis. Because the proapoptotic function of Par-4 was proposed to mainly involve the mitochondria pathway (4, 16, 42, 43), we used several well-established apoptotic agents that activate proapoptotic and/or inhibit survival pathways converging to the mitochondria to induce cytochrome c release, which in turn triggers caspase activation and apoptosis. Although etoposide, adriamycin, UVC, and staurosporine were previously shown to induce apoptosis under the predominant requirement of the mitochondria-associated components (44–48), no significant differences were observed between wild-type and Par-4 mutant primary fibroblasts following treatment by these apoptotic inducers. Because previous finding suggested an involvement of Par-4 in Fas-mediated apoptosis in cancer cell lines (7), we examined the apoptosis response induced by extracellular ligands, such as Fas and TNF. Our results did not show any significant difference between the wild-type and the Par-4 mutant fibroblast in response to these proapoptotic treatments.

The results obtained in primary fibroblasts suggest that the COOH terminus of Par-4 and possibly the full-length protein are not required for apoptosis. However, several studies conducted to understand the relationship between the structure and the proapoptotic function of Par-4 have ascribed a critical function for the COOH terminus of the protein (2, 3, 22). In fact, this leucine repeat domain has been shown to mediate physical interactions with all previously described Par-4 binding proteins (2, 5, 11, 13, 23). Recently, we have identified extracellular signal-regulated kinase 5 kinase as a Par-4-interacting protein in vitro and in vivo and showed that this interaction also occurs via the COOH terminus of Par-4.4 Therefore, it is likely that this domain mediates important functions of the Par-4 protein. Because the RNAi-mediated knockdown of Par-4 has no effect on the sensitivity of primary fibroblasts to apoptosis-inducing agents, it is likely that Par-4 is not required for apoptosis in this cell type.

In contrast, depletion of Par-4 in HeLa tumoral cells conferred a significant resistance to various apoptotic agents. Consistent with these results, it has been previously shown that prostate cancer cells are more resistant to apoptotic agents following Par-4 depletion (13). These results suggest that the role of Par-4 in apoptosis is cell type specific. Interestingly, previous studies reported that overexpression of Par-4 triggers apoptosis in various cancer cell lines but not in normal and primary cells (9). Furthermore, Par-4 has also been shown to display a proapoptotic function in cells transformed with the oncogene Ras but not in normal cells (15). Finally, mutational analysis revealed that the SAC domain (selective for apoptosis induction in cancer cells) of Par-4 induces apoptosis in cancer but not in primary and normal cells (9). Taken together with our loss of function experiments showing that Par-4 mediates apoptosis in HeLa cells but not primary fibroblasts, these data raise the possibility that the differential effect of Par-4 on apoptosis is the result of a carcinogenic process.

The molecular mechanism underlying this selective effect of Par-4 on apoptosis is currently unknown. Nevertheless, a correlation between Par-4 translocation to the nucleus and susceptibility to apoptosis by Par-4 has been previously established in several cell types (9). For instance, it has been shown that protein kinase A, whose activity is frequently elevated in tumoral cells, phosphorylates Par-4 and promotes its apoptotic function in cancer cells by modulating its subcellular distribution (12). It is thus conceivable that alterations of the molecular pathways regulating Par-4 nuclear translocation and function in transformed and tumoral cells may explain the selective susceptibility of certain cells to apoptosis mediated by Par-4.

In conclusion, using genetic and RNAi approaches, we showed that the role of Par-4 in apoptosis is cell type specific. This findings provide a basis for further investigation of Par-4 function in apoptosis in normal versus cancer cells.


   Acknowledgments
 
Grant support: Taplin Foundation fellowship (E. Bachir Affar and F. Gay), NIH/Viral Oncology Training Grant T32CA09031 (G. Sui), Hoechst Marion Roussel (Y. Shi), and NIH (Y. Shi).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


   Footnotes
 
Note: E. Li is currently at the Novartis Institutes for Biomedical Research, Models of Diseases Center, 250 Massachusetts Avenue, Cambridge, MA 02139.

4 Our unpublished data. Back

Received 3/22/05. Revised 1/31/06. Accepted 2/ 3/06.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Sells SF, Wood DP, Jr., Joshi-Barve SS, et al. Commonality of the gene programs induced by effectors of apoptosis in androgen-dependent and -independent prostate cells. Cell Growth Differ 1994;5:457–66.[Abstract]
  2. Diaz-Meco MT, Municio MM, Frutos S, et al. The product of par-4, a gene induced during apoptosis, interacts selectively with the atypical isoforms of protein kinase C. Cell 1996;86:777–86.[CrossRef][Medline]
  3. Sells SF, Han SS, Muthukkumar S, et al. Expression and function of the leucine zipper protein Par-4 in apoptosis. Mol Cell Biol 1997;17:3823–32.[Abstract]
  4. Chan SL, Tammariello SP, Estus S, Mattson MP. Prostate apoptosis response-4 mediates trophic factor withdrawal-induced apoptosis of hippocampal neurons: actions prior to mitochondrial dysfunction and caspase activation. J Neurochem 1999;73:502–12.[CrossRef][Medline]
  5. Page G, Kogel D, Rangnekar V, Scheidtmann KH. Interaction partners of Dlk/ZIP kinase: co-expression of Dlk/ZIP kinase and Par-4 results in cytoplasmic retention and apoptosis. Oncogene 1999;18:7265–73.[CrossRef][Medline]
  6. Culmsee C, Zhu Y, Krieglstein J, Mattson MP. Evidence for the involvement of Par-4 in ischemic neuron cell death. J Cereb Blood Flow Metab 2001;21:334–43.[CrossRef][Medline]
  7. Chakraborty M, Qiu SG, Vasudevan KM, Rangnekar VM. Par-4 drives trafficking and activation of Fas and Fasl to induce prostate cancer cell apoptosis and tumor regression. Cancer Res 2001;61:7255–63.[Abstract/Free Full Text]
  8. Roussigne M, Cayrol C, Clouaire T, Amalric F, Girard JP. THAP1 is a nuclear proapoptotic factor that links prostate-apoptosis-response-4 (Par-4) to PML nuclear bodies. Oncogene 2003;22:2432–42.[CrossRef][Medline]
  9. El-Guendy N, Zhao Y, Gurumurthy S, Burikhanov R, Rangnekar VM. Identification of a unique core domain of par-4 sufficient for selective apoptosis induction in cancer cells. Mol Cell Biol 2003;23:5516–25.[Abstract/Free Full Text]
  10. Bieberich E, MacKinnon S, Silva J, Noggle S, Condie BG. Regulation of cell death in mitotic neural progenitor cells by asymmetric distribution of prostate apoptosis response 4 (PAR-4) and simultaneous elevation of endogenous ceramide. J Cell Biol 2003;162:469–79.[Abstract/Free Full Text]
  11. Kawai T, Akira S, Reed JC. ZIP kinase triggers apoptosis from nuclear PML oncogenic domains. Mol Cell Biol 2003;23:6174–86.[Abstract/Free Full Text]
  12. Gurumurthy S, Goswami A, Vasudevan KM, Rangnekar VM. Phosphorylation of Par-4 by protein kinase A is critical for apoptosis. Mol Cell Biol 2005;25:1146–61.[Abstract/Free Full Text]
  13. Goswami A, Burikhanov R, de Thonel A, et al. Binding and phosphorylation of par-4 by akt is essential for cancer cell survival. Mol Cell 2005;20:33–44.[CrossRef][Medline]
  14. Berra E, Municio MM, Sanz L, Frutos S, Diaz-Meco MT, Moscat J. Positioning atypical protein kinase C isoforms in the UV-induced apoptotic signaling cascade. Mol Cell Biol 1997;17:4346–54.[Abstract]
  15. Nalca A, Qiu SG, El-Guendy N, Krishnan S, Rangnekar VM. Oncogenic Ras sensitizes cells to apoptosis by Par-4. J Biol Chem 1999;274:29976–83.[Abstract/Free Full Text]
  16. Boehrer S, Chow KU, Beske F, et al. In lymphatic cells par-4 sensitizes to apoptosis by down-regulating bcl-2 and promoting disruption of mitochondrial membrane potential and caspase activation. Cancer Res 2002;62:1768–75.[Abstract/Free Full Text]
  17. Garcia-Cao I, Lafuente MJ, Criado LM, Diaz-Meco MT, Serrano M, Moscat J. Genetic inactivation of Par4 results in hyperactivation of NF-kappaB and impairment of JNK and p38. EMBO Rep 2003;4:307–12.[CrossRef][Medline]
  18. Qiu SG, Krishnan S, el-Guendy N, Rangnekar VM. Negative regulation of Par-4 by oncogenic Ras is essential for cellular transformation. Oncogene 1999;18:7115–23.[CrossRef][Medline]
  19. Barradas M, Monjas A, Diaz-Meco MT, Serrano M, Moscat J. The downregulation of the pro-apoptotic protein Par-4 is critical for Ras-induced survival and tumor progression. EMBO J 1999;18:6362–9.[CrossRef][Medline]
  20. Cook J, Krishnan S, Ananth S, et al. Decreased expression of the pro-apoptotic protein Par-4 in renal cell carcinoma. Oncogene 1999;18:1205–8.[CrossRef][Medline]
  21. Garcia-Cao I, Duran A, Collado M, et al. Tumour-suppression activity of the proapoptotic regulator Par4. EMBO Rep 2005;6:577–83.[CrossRef][Medline]
  22. Guo Q, Fu W, Xie J, et al. Par-4 is a mediator of neuronal degeneration associated with the pathogenesis of Alzheimer disease. Nat Med 1998;4:957–62.[CrossRef][Medline]
  23. Johnstone RW, See RH, Sells SF, et al. A novel repressor, par-4, modulates transcription and growth suppression functions of the Wilms' tumor suppressor WT1. Mol Cell Biol 1996;16:6945–56.[Abstract]
  24. Park SK, Nguyen MD, Fischer A, et al. Par-4 links dopamine signaling and depression. Cell 2005;122:275–87.[CrossRef][Medline]
  25. Diaz-Meco MT, Lallena MJ, Monjas A, Frutos S, Moscat J. Inactivation of the inhibitory kappaB protein kinase/nuclear factor kappaB pathway by Par-4 expression potentiates tumor necrosis factor alpha-induced apoptosis. J Biol Chem 1999;274:19606–12.[Abstract/Free Full Text]
  26. Leitges M, Sanz L, Martin P, et al. Targeted disruption of the zetaPKC gene results in the impairment of the NF-kappaB pathway. Mol Cell 2001;8:771–80.[CrossRef][Medline]
  27. Cheema SK, Mishra SK, Rangnekar VM, Tari AM, Kumar R, Lopez-Berestein G. Par-4 transcriptionally regulates Bcl-2 through a WT1-binding site on the bcl-2 promoter. J Biol Chem 2003;278:19995–20005.[Abstract/Free Full Text]
  28. Camandola S, Mattson MP. Pro-apoptotic action of PAR-4 involves inhibition of NF-kappaB activity and suppression of BCL-2 expression. J Neurosci Res 2000;61:134–9.[CrossRef][Medline]
  29. Donohoe ME, Zhang X, McGinnis L, Biggers J, Li E, Shi Y. Targeted disruption of mouse Yin Yang 1 transcription factor results in peri-implantation lethality. Mol Cell Biol 1999;19:7237–44.[Abstract/Free Full Text]
  30. Lakso M, Pichel JG, Gorman JR, et al. Efficient in vivo manipulation of mouse genomic sequences at the zygote stage. Proc Natl Acad Sci U S A 1996;93:5860–5.[Abstract/Free Full Text]
  31. Mosmann T. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J Immunol Methods 1983;16:55–63.
  32. Shah GM, Shah RG, Poirier GG. Different cleavage pattern for poly(ADP-ribose) polymerase during necrosis and apoptosis in HL-60 cells. Biochem Biophys Res Commun 1996;229:838–44.[CrossRef][Medline]
  33. Gurtu V, Kain SR, Zhang G. Fluorometric and colorimetric detection of caspase activity associated with apoptosis. Anal Biochem 1997;251:98–102.[CrossRef][Medline]
  34. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 1976;72:248–54.[CrossRef][Medline]
  35. Sui G, Soohoo C, Affar el B, et al. A DNA vector-based RNAi technology to suppress gene expression in mammalian cells. Proc Natl Acad Sci U S A 2002;99:5515–20.[Abstract/Free Full Text]
  36. Orban PC, Chui D, Marth JD. Tissue- and site-specific DNA recombination in transgenic mice. Proc Natl Acad Sci U S A 1992;89:6861–5.[Abstract/Free Full Text]
  37. Gu H, Zou YR, Rajewsky K. Independent control of immunoglobulin switch recombination at individual switch regions evidenced through Cre-loxP-mediated gene targeting. Cell 1993;73:1155–64.[CrossRef][Medline]
  38. Ishizaki Y, Voyvodic JT, Burne JF, Raff MC. Control of lens epithelial cell survival. J Cell Biol 1993;121:899–908.[Abstract/Free Full Text]
  39. Jarvis WD, Turner AJ, Povirk LF, Traylor RS, Grant S. Induction of apoptotic DNA fragmentation and cell death in HL-60 human promyelocytic leukemia cells by pharmacological inhibitors of protein kinase C. Cancer Res 1994;54:1707–14.[Abstract/Free Full Text]
  40. Lowe SW, Ruley HE, Jacks T, Housman DE. p53-dependent apoptosis modulates the cytotoxicity of anticancer agents. Cell 1993;74:957–67.[CrossRef][Medline]
  41. Lafuente MJ, Martin P, Garcia-Cao I, Diaz-Meco MT, Serrano M, Moscat J. Regulation of mature T lymphocyte proliferation and differentiation by Par-4. EMBO J 2003;22:4689–98.[CrossRef][Medline]
  42. Duan W, Rangnekar VM, Mattson MP. Prostate apoptosis response-4 production in synaptic compartments following apoptotic and excitotoxic insults: evidence for a pivotal role in mitochondrial dysfunction and neuronal degeneration. J Neurochem 1999;72:2312–22.[CrossRef][Medline]
  43. Pedersen WA, Luo H, Kruman I, Kasarskis E, Mattson MP. The prostate apoptosis response-4 protein participates in motor neuron degeneration in amyotrophic lateral sclerosis. FASEB J 2000;14:913–24.[Abstract/Free Full Text]
  44. Cecconi F, Alvarez-Bolado G, Meyer B, Roth KA, Gruss P. Apaf1 (CED-4 homolog) regulates programmed cell death in mammalian development. Cell 1998;94:727–37.[CrossRef][Medline]
  45. Yoshida H, Kong YY, Yoshida R, et al. Apaf1 is required for mitochondrial pathways of apoptosis and brain development. Cell 1998;94:739–50.[CrossRef][Medline]
  46. Kuida K, Haydar TF, Kuan CY, et al. Reduced apoptosis and cytochrome c-mediated caspase activation in mice lacking caspase 9. Cell 1998;94:325–37.[CrossRef][Medline]
  47. Soengas MS, Alarcon RM, Yoshida H, et al. Apaf-1 and caspase-9 in p53-dependent apoptosis and tumor inhibition. Science 1999;284:156–9.[Abstract/Free Full Text]
  48. Li K, Li Y, Shelton JM, et al. Cytochrome c deficiency causes embryonic lethality and attenuates stress-induced apoptosis. Cell 2000;101:389–99.[CrossRef][Medline]



This article has been cited by other articles:


Home page
 Nucleic Acids ResHome page
C. Lu, J.-Q. Chen, G.-P. Zhou, S.-H. Wu, Y.-F. Guan, and C.-S. Yuan
Multimolecular complex of Par-4 and E2F1 binding to Smac promoter contributes to glutamate-induced apoptosis in human- bone mesenchymal stem cells
Nucleic Acids Res., July 26, 2008; (2008) gkn426v1.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
Y. Zhao, R. Burikhanov, S. Qiu, S. M. Lele, C. D. Jennings, S. Bondada, B. Spear, and V. M. Rangnekar
Cancer Resistance in Transgenic Mice Expressing the SAC Module of Par-4
Cancer Res., October 1, 2007; 67(19): 9276 - 9285.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
S. Srinivasan, R. S. Ranga, R. Burikhanov, S.-S. Han, and D. Chendil
Par-4-Dependent Apoptosis by the Dietary Compound Withaferin A in Prostate Cancer Cells
Cancer Res., January 1, 2007; 67(1): 246 - 253.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Affar, E. B.
Right arrow Articles by Shi, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Affar, E. B.
Right arrow Articles by Shi, Y.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online