| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Immunology |
Department of Obstetrics, Gynecology, and Reproductive Sciences, Yale University School of Medicine, New Haven, Connecticut
Requests for reprints: Gil Mor, Department of Obstetrics, Gynecology, and Reproductive Sciences, Reproductive Immunology Unit, Yale University School of Medicine, 333 Cedar Street, FMB 301, New Haven, CT 06520. Phone: 203-785-6294; Fax: 203-785-4883; E-mail: gil.mor{at}yale.edu.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Although the adaptive immune system prevents tumor growth through immunosurveillance, the innate immune system is thought to promote tumor growth through inflammation-dependent mechanisms (2, 8). Recognition of bacterial and/or viral products by innate immune cells, such as macrophages, may induce an inflammatory response associated with tumor promotion (3). Indeed, it has been observed that bacterial infection following surgery can promote growth of metastases in experimental animals and human patients (3). Helicobacter pylori infection is the world's leading cause of stomach cancer, and H. pylori is established as a definite carcinogen for the development of gastric cancer.
The innate immune system recognizes the presence of bacterial pathogens through the expression of a family of membrane receptors known as Toll-like receptors (TLR). The Toll gene was initially found to be important in dorsoventricular polarization during embryogenesis in Drosophila (9). Subsequently, several mammalian homologues have been identified and characterized (10). These TLRs play an important role in immunosurveillance and responses towards commensal and pathogenic microorganisms (11). TLRs are transmembrane proteins with a conserved intracellular signaling domain homologous to the interleukin-1 receptor (IL-1R) domain and a specific leucine-rich repeat extracellular domain (12). TLRs recognize not only microbial-associated pathogen-associated molecular patterns (PAMP) expressed by bacteria and viruses but also host-derived PAMPs, such as stress proteins (13). TLRs generally signal through a MyD88-dependent manner, leading to a proinflammatory response. Signaling via MyD88 involves the early activation of nuclear factor-
B (NF-
B), which leads to the production of proinflammatory cytokines (14). However, MyD88-independent TLR signaling can also occur. MyD88-independent signaling involves the activation of the late phase of NF-
B and also activation of IFN regulatory factor 3, which leads to the production of type I IFN (IFN
/ß), IFN-inducible gene products, and an immune regulatory response (15).
TLR-4 upon recognition of its ligand lipopolysacharide (LPS) can induce the production of proinflammatory cytokines, including IL-6, tumor necrosis factor-
(TNF-
), and IL-12, through MyD88 and potentially through NF-
B activation. Although the link between Gram-negative bacteria, LPS, TLRs, TNF-
, NF-
B, and inflammation has been well characterized, the association between TLRs and cancer remains unknown.
In the present study, we show a link between TLR-4-MyD88 signaling, inflammation, tumor growth, and chemoresistance. We describe the expression of TLR-4 in epithelial ovarian cancer (EOC) cells and the differential effect of TLR-4 ligation by LPS and paclitaxel in MyD88-positive (MyD88+) and MyD88-negative (MyD88) EOC cells. In addition, we show that in EOC cells, signaling through TLR-4 and MyD88 represent a major source of proinflammatory cytokines, which promote tumor growth. Furthermore, we have identified a new mechanism for the acquisition of paclitaxel chemoresistance and therefore a novel target for the development of molecularly directed therapy in paclitaxel-resistant ovarian cancer.
| Materials and Methods |
|---|
|
|
|---|
Patients and samples. Tissue and ascites samples were collected from stage III/IV ovarian cancer patients. Tissues were cut in small aliquots and snap frozen in liquid nitrogen. All patients signed consent forms, and the use of patient samples was approved under Yale University's Human Investigations Committee (HIC #10425).
Cell lines. Human EOC cell lines A2780 and CP70 (gifts from Dr. T.C. Hamilton; ref. 16) were propagated in RPMI plus 10% fetal bovine serum (Gemini Bio-Products, Woodland, CA) at 37°C in a 5% CO2 atmosphere. Primary EOC cells were isolated from malignant ovarian ascites and cultured as previously described (17). EOC cells were isolated from tumors as previously described (17, 18). The normal ovarian surface epithelial cell line immortalized with telomerase was cultured as previously described (19). Purity of the EOC cells was 100% as determined by immunostaining for cytokeratin antigen.
Immunohistochemistry. Twenty-four samples of ovarian cancer tissues were evaluated for immunocytochemistry. The expression and cellular localization of TLR-4 and MyD88 by EOC cells was done as previously described (20). In short, sections of tumor samples (5 µm) were blocked with either 10% horse or goat serum in PBS for 1 hour at room temperature. Following three washes with PBS, samples were incubated overnight at 4°C with either the anti-TLR-4 (Santa Cruz Biotechnology) or the anti-MyD88 antibody. Mouse IgG1 or rabbit serum served as negative controls. After three washes with PBS, specific staining was detected by incubating with either a peroxidase-conjugated horse anti-mouse antibody (1:1,000 dilution) or a peroxidase-conjugated goat anti-rabbit antibody (1:1,000 dilution) for 1 hour followed by a 5-minute incubation with 3,3'-diaminobenzidine substrate (Vector Laboratories, Burlingame, CA). Cells and tissue sections were then counterstained with hematoxylin (Sigma Chemical) before dehydration with ethanol and Histosolve (Shandon, Inc., Pittsburgh, PA). Slides were then mounted with Permount (Fisher Scientific, Pittsburgh, PA) and visualized by light microscopy.
Cell viability assay. Cell viability was evaluated using the CellTiter 96 Aqueous One Solution Cell Proliferation Assay (Promega, Madison, WI) according to the manufacturer's instructions. The values from the treated cells were compared with the values generated from the untreated cells and reported as percent viability. Each experiment was done at least thrice.
Protein preparation. Protein was extracted as previously described (17). Briefly, cell pellets were lysed in a cold solution of 1% NP40 and 0.1% SDS in PBS, with freshly added protease inhibitor cocktail (20 µL/mL; Sigma Chemical) and 2 mmol/L phenylmethylsulfonyl fluoride (Sigma Chemical). Protein concentration was determined by Bio-Rad Protein Assay (Bio-Rad, Hercules, CA), and proteins were stored at 40°C until further use.
For separation of the cytoplasmic and nuclear fractions, cell pellets were processed using the NE-PER Nuclear and Cytoplasmic Extraction kit (Pierce Biotechnology, Rockford, IL) according to the manufacturer's instructions.
SDS-PAGE and Western blots. Twenty-microgram protein was denatured in sample buffer [2.5% SDS, 10% glycerol, 5% ß-mercaptoethanol, 0.15 mol/L Tris (pH 6.8), and 0.01% bromophenol blue] and subjected to 12% SDS-PAGE as previously described (17). Antibodies used: rabbit anti-TLR-4 (Santa Cruz Biotechnology; 1:1,000), rabbit anti-MyD88 (eBiosciences, San Diego, CA; 1:1,000), mouse anti-NF-
B (Santa Cruz Biotechnology; 1:1,000), mouse anti-DNA topoisomerase 1 (BD Biosciences, San Jose, CA; 1:500), and rabbit anti-actin (Sigma Chemical; 1:10,000). Proteins were visualized using enhanced chemiluminescence (Pierce Biotechnology).
RNA isolation and reverse transcription-PCR. Total RNA was isolated using the RNeasy Mini kit (Qiagen, Valencia, CA) according to the manufacturer's instructions. Reverse transcription was done on 5 µg of total RNA using the First Strand cDNA Synthesis kit (Amersham Biosciences, Buckinghamshire, United Kingdom) according to the manufacturer's instructions. The primers used for amplification of human TLR-4 is as follows: forward primer, TGGATACGTTTCCTTATAAG; reverse primer, GAAATGGAGGCACCCCTTC. Thirty cycles of PCR were done at 95°C for 15 seconds, 54°C for 45 seconds, and 72°C for 60 seconds. The size of the product was 449 bp.
Caspase-Glo 3/7 assay. Ten micrograms of protein in a 50-µL total volume was mixed with 50 µL of equilibrated Caspase-Glo 3/7 reagents (Promega). After incubating at room temperature for 1 hour, luminescence was measured using TD 20/20 Luminometer (Turner Designs, Sunnyvale, CA). Blank values were subtracted, and fold increase in activity was calculated based on activity measured from untreated cells. Each sample was measured in triplicates.
Cytokine and chemokine studies. Chemokine production was determined using the Human Cytokine Array kit, III (for cell culture supernatants; RayBiotech, Atlanta, GA) as previously described (20). The intensity of the signals was quantified by densitometry using a digital imaging analysis system and 1D Image Analysis Software (Eastman Kodak Co., Rochester, NY). The signal intensities were normalized against the positive controls on each array membrane, which were given the arbitrary unit of 1. Any expression levels below 0.2 unit were considered nonsignificant.
The concentrations of the IL-6, GRO-a, MCP-1 were evaluated by ELISA, according to the manufacturer's instructions (R&D Systems, Minneapolis, MN). A panel of 10 cytokines, proinflammatory and anti-inflammatory, was simultaneously evaluated using the Fast Quant Human II kit (Whatman/Schleicher and Schuell, Keene, NH) according to the manufacturer's instructions. The signal was detected using the Genepix 4000 microarray reader, and the results were analyzed using the Genepix 3.0 software (Whatman/Schleicher and Schuell).
RNA interference. EOC cells were transiently transfected with a GFP-expressing plasmid containing silencing RNA (siRNA) directed against MyD88 (psiRNA-hMyD88, Invivogen, San Diego, CA). Briefly, 1.5 x 105 cells were seeded in 60-mm dishes and cultured overnight until 40% to 60% confluent. Cells were then transfected for 18 hours with 2 µg of DNA using Fugene 6 transfection reagent (Roche Applied Science, Indianapolis, IN). Ratio of Fugene to DNA was 3:1. Following transfection, cells were allowed to recover in growth media for 24 hours before treatment.
MyD88 transfections. Transfection was done using a plasmid containing the full-length cDNA of human MyD88 (pUNO-hMyD88, Invivogen). CP70 and A2780 cells were grown in 75-mm2 surface tissue culture flasks until they reached 50% confluence; 12 µL of the Fugene 6 transfection reagent was added into 4 mL of serum-free media for each transfection. After 5 minutes of incubation at room temperature, 1 µg of the plasmid pUNO-hMyD88 was added to the serum-free media containing Fugene 6 transfection reagent, and the mixtures were incubated at room temperature for another 15 minutes. The growth media in each flask were discarded, and the corresponding Fugene 6/plasmid/serum-free media mixture was added, and the flasks were incubated overnight at 37°C 5% CO2. The transfection media were replaced with fresh growth media the second day, and the cells were allowed to recover for 24 hours after transfection before treatments.
Laser capture microdissection. Ovarian cancer specimens (n = 24) obtained in the operating room were snap frozen in liquid nitrogen and stored in cryovials at 80°C. For laser capture microdissection, a small fraction of tissue was embedded in ornithine carbamyl transferase at 20°C. Eight-micrometer sections were cut with a microtome and fixed on Leica glass foiled PEN membrane slides. The specimens were fixed in 95% ethanol and H&E stained. Dehydration was done by immersing the slides in 100% ethanol followed by Histosolve (xylene substitute) and air-drying for 10 to 15 minutes.
Using the Leica Laser Capture Microdissection System (Leica Microsystems, Bannockburn, IL), 6,000 ovarian cancer cells were selected and collected in PCR Eppendorf tubes containing sample buffer used for preparation of samples for Western blot analysis. Samples underwent five cycles of thawing and freezing followed by 10 minutes at 95°C. Afterward, the samples were stored at 20°C until used for Western blot analysis.
Statistical analysis. Data are expressed as mean ± SD (21). Statistical significance (P < 0.05) was determined using one-way ANOVA with the Bonferonni correction. Survival curve of the patients were done by the method of Kaplan-Meier (22), and the significance of the difference was estimated by log-rank test.
| Results |
|---|
|
|
|---|
|
|
We then evaluated whether the expression of TLR-4 and MyD88 could be determined in cancer cells isolated with laser microdissector. Thus, ovarian cancer cells were microdissected from 8-µm tissue sections using Laser Capture Micro dissector. Cells were collected in sample buffer, and TLR-4 and MyD88 expression was evaluated by Western blot. Figure 2D shows the area before and after microdissection. Figure 2E shows the presence of TLR-4 and MyD88 in microdissected ovarian cancer cells.
MyD88 expression is required for LPS-induced tumor growth. Once the expression of TLR-4 in EOC samples was established, we evaluated the biological function of this receptor. In addition, we also evaluated the significance of MyD88 status. Therefore, EOC cell lines expressing MyD88 (MyD88+) and those shown to lack MyD88 (MyD88) were treated with increasing concentrations of LPS (one of the main ligands for TLR-4) for 24 and 48 hours, and cell viability was determined using the CellTiter 96 AQueous One Solution Cell Proliferation Assay. Figure 3A shows the results for R182 (MyD88+) and A2780 (MyD88). A significant increase in cell proliferation was observed at 24 hours (P < 0.01) and 48 hours (P < 0.01) in MyD88+ but not in MyD88 EOC cells. Thus, LPS induced a time-dependent and dose-dependent increase in cell proliferation in cells expressing MyD88 but not in MyD88 EOC cells. LPS had no effect on OSE cell viability, which are also negative for MyD88 expression (data not shown). These results suggest that the proliferative effect of LPS in EOC cells depends on the presence of MyD88.
|
The results from the cytokine array lead to the identification of specific cytokines/chemokines that were significantly affected by LPS treatment. To validate these results, we then did ELISA and compared the differential response between MyD88+ and MyD88 EOC cells. Thus, EOC cell lines were treated for 48 hours with 10 µg/mL LPS, and the levels of GRO-
, MCP-1, and IL-6 were determined. These cytokines were selected because their secretion was shown to be the most significantly affected by LPS treatment (Fig. 3B). Unstimulated MyD88+ EOC cells constitutively express all the cytokines tested. In addition, TLR-4 ligation significantly induced secretion of GRO-
(P < 0.05; Fig. 3C), MCP-1 (P < 0.05; Fig. 3D), and IL-6 (P < 0.01; Fig. 3E). In contrast, unstimulated MyD88 EOC cells secreted undetectable or low levels of these proinflammatory cytokines, which were not affected by TLR-4 ligation with LPS (Fig. 3C-E). These findings suggest that the increased production of proinflammatory cytokines in response to LPS was dependent on MyD88 expression in EOC cells.
TLR-4 activates the NF-
B pathway in MyD88 expressing EOC cells. NF-
B is one of the main intracellular pathways mediating the induction of cytokine expression following TLR-4 activation. Therefore, we next determined if the ligation of TLR-4 induces NF-
B activation in EOC cells. Thus, EOC cells were incubated in the presence or absence of LPS (10 µg/mL) for 1, 2, and 4 hours, and the activation status of NF-
B was determined by Western blot analysis. As shown in Fig. 4
, in MyD88+ EOC cells, the p65 active form of NF-
B was translocated to the nucleus 1 hour after treatment with LPS (Fig. 4A). This shows that in MyD88+ EOC cells, the ligation of TLR-4 by LPS induces NF-
B activation. Interestingly, constitutive nuclear localization of p65 NF-
B was observed in MyD88 EOC cells, and its level was not affected by LPS treatment (Fig. 4B). Therefore, we determined the status of the NF-
B inhibitor, I
B-
, in these cells. Our results show I
B-
degradation in MyD88+ cells in response to LPS. In contrast, constitutive degradation of I
B-
was not observed in MyD88 cells; in addition, no change in its level was observed after LPS treatment (Fig. 4C). These results suggest that TLR-4 ligation by LPS results in early-phase activation of NF-
B in MyD88+ but not in MyD88 EOC cells.
|
|
To further characterize the effect of paclitaxel and LPS on the secretion of several cytokines and chemokines in MyD88+ and MyD88 EOC cells, we used a high-throughput microarray system (Whatman/Scleicher and Schull) to measure the levels of IL-6, IL-4, IL-8, IL-12, RANTES, and IFN-
. Cytokine secretion was measured in the supernatants of EOC cells following 48 hours of incubation with either LPS (10 µg/mL) or paclitaxel (20 µmol/L). As shown in Fig. 6A-C
, MyD88+ EOC cells displayed constitutive secretion of the proinflammatory cytokines IL-6, IL-8, and RANTES, and treatment with LPS or paclitaxel resulted in increased secretion of these proinflammatory cytokines. In contrast, MyD88 EOC cells showed neither constitutive secretion nor LPS-induced or paclitaxel-induced IL-6, IL-8, or RANTES secretion. Interestingly, neither MyD88+ nor MyD88 EOC cells secreted detectable levels of IL-4, IL-12, and IFN-
, with or without treatment with either LPS or paclitaxel (Fig. 6D-F).
|
|
We then determined whether the expression of MyD88 confers resistance that is specific to paclitaxel. Thus, wt A2780 EOC cells (carboplatin sensitive) and A2780 EOC cells transfected with MyD88 were treated with 100 µg/mL carboplatin or 2 µmol/L paclitaxel for 48 hours. Apoptosis was determined by measuring caspase-3/7 activity. As shown in Fig. 7E, wt A2780 cells showed significant increase in caspase-3/7 activity following treatment with carboplatin or paclitaxel. Upon the introduction of MyD88, the cells retained its sensitivity to carboplatin but not paclitaxel. This suggests that the protective effect of MyD88 is specific for paclitaxel-induced apoptosis.
TLR-4 ligation by paclitaxel induces the expression of antiapoptotic proteins. TLR-4 ligation through NF-
B and inflammatory molecules promotes cell survival by the induction of the expression of antiapoptotic proteins (24, 25). The expression of X-linked inhibitor of apoptosis (XIAP), a major inhibitor of caspase-3 and caspase-9, and the expression of Akt has been associated with tumor growth and chemoresistance in ovarian cancer cells (2628). Therefore, we evaluated the expression of XIAP and phosphorylated Akt (pAkt) following paclitaxel treatment in MyD88+ cells. As shown in Fig. 8
, a significant increase in pAkt was observed 4 hours after treatment with paclitaxel. Similarly, XIAP levels increased 2 hours after treatment. In contrast, no change on the levels of total Akt was observed (Fig. 8).
|
|
| Discussion |
|---|
|
|
|---|
It has been observed in animal studies that surgical removal of a primary tumor is often followed by rapid growth of previously dormant metastases, and LPS has been suggested to be responsible for this effect (29). Indeed, BALB/c mice receiving a tail vein injection of 4T1 mouse mammary carcinoma cells showed an increase in lung metastases following LPS injection (30). LPS is recognized by TLR-4, which is expressed by the cells of the innate immune system. Following its ligation, it has been shown to induce NF-
B activation, cytokines/chemokines production, and inflammation (14).
TLRs represent a main receptor pathway, which can induce the expression of proinflammatory cytokines (15). TLRs are widely expressed by cells of the immune system and, in response to microbial products or stress factors, initiate an inflammatory process (10). In addition, TLRs have been described in nonimmune cells, such as mucosal epithelium and trophoblast cells (20, 31). Similar to immune cells, the ligation of TLRs in nonimmune cells results in the expression and secretion of proinflammatory cytokines (20). In this study, we have described the presence of TLR-4 in all EOC cells tested and the differential expression of MyD88. We also showed that in MyD88+ EOC cells, ligation of TLR-4 by LPS enhances cell proliferation and induces the production of chemokines and proinflammatory cytokines. Interestingly, unstimulated MyD88+ cells constitutively secrete cytokines/chemokines. This suggests the presence of endogenous ligands of TLRs (i.e., apoptotic bodies and cellular debris from necrotic cells), which can also act through TLR-4 or other TLRs, which are also present in EOC cells.1 The possible role of IL-1 on the constitutive secretion of cytokines/chemokines is another possibility that remains to be determined.
One of the main cytokines induced in EOC cells following LPS stimulation is IL-6. In addition, following TLR-4 ligation, these cells also secreted the chemokines MCP-1 and GRO-
. It is now well documented that chemokines can dramatically alter the neoplastic process, not only by recruiting leukocytes that will enhance the inflammatory environment but also by having a direct effect on nearby stromal and neoplastic cells (32). The induction of these chemokines by TLR-4 activation may, therefore, help to recruit inflammatory cells as well as to enhance tumor growth and neoplastic progression. Melanoma is one example in which chemokines have been shown to exert autocrine control over neoplastic proliferation (33, 34). Blocking GRO-
activity on the CXCR2 receptor attenuates melanoma cell proliferation in vitro, whereas overexpression of GRO-
and GRO-ß enhances tumor colony formation and tumorigenicity in nude mice (3436). In our study, ligation of TLR-4 by LPS induced a significant increase in GRO-
secretion, which may provide the stimuli for the proliferative effect observed on EOC cells following LPS treatment. Furthermore, the presence of proinflammatory cytokines and chemokines has been described as predictors of poor prognosis (37).
We observed differential response to LPS by EOC cells, which was due to the expression of the TLR intracellular signaling molecule MyD88. In the presence of MyD88, treatment with LPS results in the nuclear localization of NF-
B, increase cell proliferation, and cytokine/chemokine production. These results provide preliminary evidence of the involvement of NF-
B in TLR-4-MyD88 signaling pathway in EOC cells. However, the exact downstream signaling pathway after TLR-4-MyD88 activation still remains to be determined.
In the absence of MyD88, treatment with LPS failed to induce NF-
B translocation to the nucleus and had no effect on cellular proliferation nor on cytokine/chemokine production. Interestingly, however, the MyD88 A2780 EOC cell line constitutively express nuclear p65 NF-
B, yet does not constitutively express any of the proinflammatory cytokines observed in MyD88+ cells. These results suggest that the effect of NF-
B on cancer cells may be cell type specific, and the final output of NF-
B activation (e.g., cytokine production) is the determining factor on tumor progression and differentiation. The significance of this constitutive NF-
B nuclear localization in these cells, which is not related to the production of proinflammatory cytokines, is under investigation in our laboratory.
Differential response was also observed in EOC cells in response to paclitaxel. MyD88+ EOC cells responded to paclitaxel in similar manner as they did with LPS: they produced and secreted proinflammatory cytokines. In addition, these cells did not undergo apoptosis in response to paclitaxel. This is in contrast to MyD88 cells, which underwent apoptosis and did not secrete cytokine/chemokine in response to paclitaxel.
Studies in mice by Ding et al. showed that similar to LPS, treatment with paclitaxel activates murine macrophages and induces the secretion of inflammatory cytokines including, TNF-
, IL-6, and IL-8. This effect of paclitaxel was shown to be both TLR-4 and MyD88 dependent (23, 38). These results are supported by the in vivo observation showing a correlation between expression of MyD88 and progression-free survival. Although only a small number of patients were evaluated, the data indicate that the expression of MyD88 correlates with a poor survival. Our lab is actively evaluating whether the expression of MyD88 could be use as a marker to predict chemoresponse. Preliminary studies using laser capture microdissection suggest this possibility.2
In this study, we also show that in MyD88+ EOC cells, TLR-4 ligation is able to induce the activation of the Akt survival pathway and enhance the expression of the antiapoptotic protein XIAP. Both proteins have been shown to be highly expressed in ovarian cancer and are linked to the develop of chemoresistance (17, 27, 39). Therefore, in MyD88+ EOC cells, the proapoptotic effect of paclitaxel is overcome by the induction of the antiapoptotic proteins (pAKT and XIAP) following TLR-4 ligation. Therefore, in these cells, treatment with paclitaxel does not induce apoptosis but induces the secretion of cytokines/chemokines. The correlation between TLR-4-MyD88 signaling and the up-regulation of pAkt and XIAP remains to be determined. NF-
B may represent a potential link between these pathways.
During the past 20 years, multiple combinations of cytotoxic chemotherapeutics have been evaluated in patients with recurrent ovarian cancer. Our work provides new insight into a molecular mechanism that links inflammation and neoplastic development/progression. It suggests that an active TLR-4-MyD88 signaling pathway may be a risk factor for developing cancer and may be a novel target for the development of biomodulators aimed at reversing chemoresistance to paclitaxel.
| Acknowledgments |
|---|
We thank Nicholas F. Brady for support.
| Footnotes |
|---|
2 D-S. Silasi et al., in preparation. ![]()
Received 11/ 2/05. Revised 1/18/06. Accepted 1/26/06.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
H. Shojaei, H.-H. Oberg, M. Juricke, L. Marischen, M. Kunz, C. Mundhenke, F. Gieseler, D. Kabelitz, and D. Wesch Toll-like Receptors 3 and 7 Agonists Enhance Tumor Cell Lysis by Human {gamma}{delta} T Cells Cancer Res., November 15, 2009; 69(22): 8710 - 8717. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Q. DOAN, K. A. BOWEN, L. A. JACKSON, and B. M. EVERS Toll-like Receptor 4 Activation Increases Akt Phosphorylation in Colon Cancer Cells Anticancer Res, July 1, 2009; 29(7): 2473 - 2478. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. K. Bunt, V. K. Clements, E. M. Hanson, P. Sinha, and S. Ostrand-Rosenberg Inflammation enhances myeloid-derived suppressor cell cross-talk by signaling through Toll-like receptor 4 J. Leukoc. Biol., June 1, 2009; 85(6): 996 - 1004. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Chiron, C. Pellat-Deceunynck, M. Amiot, R. Bataille, and G. Jego TLR3 Ligand Induces NF-{kappa}B Activation and Various Fates of Multiple Myeloma Cells Depending on IFN-{alpha} Production J. Immunol., April 1, 2009; 182(7): 4471 - 4478. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Goto, T. Arigami, M. Kitago, S. L. Nguyen, N. Narita, S. Ferrone, D. L. Morton, R. F. Irie, and D. S.B. Hoon Activation of toll-like receptors 2, 3, and 4 on human melanoma cells induces inflammatory factors Mol. Cancer Ther., November 1, 2008; 7(11): 3642 - 3653. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Zimmer, J. Liu, J. L. Clayton, D. S. Stephens, and J. P. Snyder Paclitaxel Binding to Human and Murine MD-2 J. Biol. Chem., October 10, 2008; 283(41): 27916 - 27926. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Krockenberger, Y. Dombrowski, C. Weidler, M. Ossadnik, A. Honig, S. Hausler, H. Voigt, J. C. Becker, L. Leng, A. Steinle, et al. Macrophage Migration Inhibitory Factor Contributes to the Immune Escape of Ovarian Cancer by Down-Regulating NKG2D J. Immunol., June 1, 2008; 180(11): 7338 - 7348. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Andreani, G. Gatti, L. Simonella, V. Rivero, and M. Maccioni Activation of Toll-like Receptor 4 on Tumor Cells In vitro Inhibits Subsequent Tumor Growth In vivo Cancer Res., November 1, 2007; 67(21): 10519 - 10527. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |