| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Cell, Tumor, and Stem Cell Biology |
1 Department of Microbiology and Immunology, School of Medicine, Temple University; 2 Department of Pathology and Laboratory Medicine, University of Pennsylvania, Philadelphia, Pennsylvania; and 3 Department of Clinical Cytobiology, Medical Center for Postgraduate Education, Warsaw, Poland
Requests for reprints: Tomasz Skorski, Department of Microbiology and Immunology, School of Medicine, Temple University, MRB, Room 548A, 3400 North Broad Street, Philadelphia, PA 19140. Phone: 215-707-9157; Fax: 215-707-9160; E-mail: tskorski{at}temple.edu.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Although studies with the use of knockout mice suggest that STAT5 might be dispensable during BCR/ABLmediated transformation per se (5), other reports, including our own, implicate STAT5 in protection from apoptosis and stimulation of proliferation of leukemia cells (69). We and others showed that STAT5-dependent stimulation of the Bcl-2 family members Bcl-xL and A1, and the proto-oncogene pim-1 contribute to protection from apoptosis and growth factor independence in BCR/ABLtransformed cells (10, 11).
Another STAT5 downstream effector is the basic helix-loop-helix (bHLH) Id1 protein (9, 12). Although most members of the family of bHLH contain a basic DNA-binding domain and act as transcription factors (13, 14), Id1 lacks the domain. It can, however, associate with other members of the bHLH family and impair their DNA-binding capacity (13). Therefore, the main function of Id1 is to regulate gene transcription by sequestering the ubiquitously expressed bHLH transcription factors.
With regard to function, Id1 can inhibit cell differentiation and stimulate proliferation, migration, and angiogenesis (13, 14). Enhanced expression of Id1 has been reported frequently in higher-grade, less-differentiated malignancies. The distinct role of Id1 in promoting tumor cell invasive and metastatic capacity are highlighted by the following observations: (a) in primary breast cancer cells, the expression of Id1 was associated with infiltrating, more aggressive tumors (15); (b) overexpression of Id1 causes mammary epithelial cells to invade the basement membrane (16); (c) constitutive expression of Id1 in nonaggressive breast cancer cell line confers a more invasive phenotype (15); and (d) Id1 expression is associated with the invasive behavior of endometrial carcinomas (17).
Id1-mediated enhancement of the invasive capacity of breast carcinoma cells was associated with the increased expression of 120 kDa gelatinase (16). It is tempting to speculate that this gelatinase consists of a 92 kDa matrix metalloproteinase-9 (MMP9) and a 25 kDa neutrophil gelatinase-associated lipocalin, which protects MMP9 from degradation (18). MMP9, a type IV collagenase, belongs to a family of over 20 MMPs that are characterized by their ability to degrade extracellular matrix and their dependence on Zn2+ binding for proteolytic activity (19). There is compelling evidence that MMPs can induce or enhance tumor cell proliferation, survival, invasiveness, angiogenesis, and metastatic capacity (20). MMP9 acts in part by dissolving connective tissue barriers composed of collagens I, IV, V, VII, and XI.
Our genome scale profiling of gene expression identified elevated expression of both Id1 and MMP9 in CML cells (21). However, the exact role of these two proteins in the BCR/ABLmediated leukemogenesis remains unexplored.
| Materials and Methods |
|---|
|
|
|---|
-p210BCR/ABL retroviral construct was obtained from Dr. Charles Sawyers (University of California at Los Angeles, Los Angeles, CA) and used before (22). Id1 cDNA was obtained from DNAX Research Institute of Molecular and Cellular Biology, Inc. (Paolo Alto, CA) and cloned in the sense (S) and antisense (AS) orientation in the pMIG1 retroviral construct containing IRES-green fluorescent protein (GFP) cassette (gift of Dr. Warren Pear, University of Pennsylvania, Philadelphia, PA). Luciferase reporter construct containing full-length MMP9 promoter was obtained from Dr. J. Pagano (The University of North Carolina at Chapel Hill, Chapel Hill, NC). Cells. 32Dcl3 murine hematopoietic cells (parental) and those expressing p210BCR/ABL, STAT5B dominant-active mutant (STAT5B-DAM), or p210BCR/ABL and STAT5B dominant-negative mutant (STAT5B-DNM) were characterized before (9, 23). FL5.12 murine hematopoietic cells and p210BCR/ABL transfectants were obtained from Dr. Warren Pear. BaF3 cells transformed with BCR/ABL and related fusion tyrosine kinases (FTK), such as TEL/ABL, TEL/JAK2, TEL/PDGFßR, NPM/ALK, and TEL/TRKC, were described before (24). Cells were maintained in Iscove's modified Dulbecco's medium (IMDM) supplemented with 10% fetal bovine serum (FBS), WEHI-conditioned medium as a source of interleukin-3 (IL-3; pretested concentrations adequate to support the proliferation of parental cells) and antibiotics. At least three clones per experimental group were used. Peripheral blood cells from two patients in myeloid and two patients in lymphoid CML-BC were obtained after informed consent, and CD34+ cells or mononuclear cells, respectively, were isolated as described (25). CD34+ mobilized peripheral blood progenitors were purchased from Cambrex BioScience, Walkersville, Inc. (Gaithersburg, NJ). Tk-ts13 cells were cultured in DMEM supplemented with 10% FBS and antibiotics.
Retroviral infections. Cells were infected with pMIG1 retrovirus containing Id1(S)-IRES-GFP, Id1(AS)-IRES-GFP or IRES-GFP (empty plasmid) as described before (10). GFP+ cells were obtained by sorting after 72 hours of continuous infection, expanded in the presence of WEHI-conditioned medium and used for experiments. Id1 mRNA and protein expression in GFP+ cells was determined by semiquantitative reverse transcription-PCR (RT-PCR) and Western analysis, respectively.
Inhibition of BCR/ABL kinase. ABL kinase inhibitor STI571 (imatinib mesylate, Gleevec) was obtained from Novartis Pharma (Basel, Switzerland). Cells (106/mL) were incubated for 8 or 24 hours with 1 µmol/L STI571 in the absence or presence of IL-3 (IL-6 was also added to lymphoid CML-BC cells), respectively, then washed and used for experiments.
Microarray analysis. The sample preparation and array protocol have been published previously (21).
Western analysis. Total protein cell lysates were obtained as previously described (10) and analyzed by SDS-PAGE followed by Western blotting with the use of anti-ABL (Ab-3, Oncogene Research Products, Cambridge, MA), anti-Id1 (C-20, Santa Cruz Biotechnology, Santa Cruz, CA), anti-Id2 (C-20, Santa Cruz Biotechnology), antiphosphotyrosine (PY20, Oncogene Research Products; and 4G10, Upstate Biotechnology, Lake Placid, NY), and antiactin (C-11, Santa Cruz Biotechnology) antibodies.
Semiquantitative RT-PCR. The reaction was done as described before (21) with modifications. Total RNA was extracted by RNeasy Mini kit 74104 (Qiagen, Valencia, CA). Reverse transcription reactions were done in the following conditions: 1 µg total RNA, 2 µg random primer p(dN)6 (Roche Diagnostics GmbH, Sandhofer Strasse 116, D-68305 Mannnheim, Germany), 10 µmol/L deoxynucleotide triphosphates (Eppendorf AG, Hamburg, Germany), 5 mmol/L DTT (Fisher Scientific, Fair Lawn, NJ), 40 units of RNAsin (Promega, Madison, WI), and 20 units of reverse transcriptase avian myeloblastosis virus (Roche), total reaction volume 20 µL. Ten microliters of reverse transcription reaction were used as a template for 25 cycles of 50 µL PCR (initial denaturation 94°C/5 minutes, denaturation 94°C/45 seconds, annealing 60°C/45 seconds, polymerization 72°C/45 seconds, final polymerization 72°C/5 minutes) along with 5 units of Taq polymerase (Promega) to amplify simultaneously Id1 and GADPH in the same test tubes. The following primers were used: 10 pmol Id1 (primers: forward, ATGAACGGCTGCTACTCACG; reverse, GCGACACAAGATGCGATCGT; PCR product, 261 bp) and 1.3 pmol GADPH (primers: forward, ACCACAGTCCATGCCATCAC; reverse, TCCACCACCCTGTTGCTGTA; PCR product, 452 bp). GADPH gene product was detected as loading/performance control of the semiquantitative PCR. The products were resolved in 2% agarose gels containing 0.5 µg/mL ethidium bromide.
STAT5 activity. The DNA-binding activity of STAT5 was examined by electrophoretic mobility shift analysis using the Fc
RI INF-
-activated sequence motif as described previously (9).
MMP9 transactivation assay. MMP9 transactivation assay was examined by luciferase assay as previously described (9). In brief, Tk-ts13 hamster fibroblasts were cotransfected with Id1, BCR/ABL, BCR/ABL, and Id1AS, or insert-less expression vectors along with the luciferase reporter construct containing full-length MMP9 promoter and ß-galactosidase expression vector. Thirty-six hours after transfection, cells were starved from serum in DMEM + 0.1% bovine serum albumin for 48 hours and harvested for the luciferase assay using Dual-Luciferase Reporter Assay System (Promega) according to the protocol of the manufacturer. For each transfection, luciferase activity was normalized using ß-galactosidase activity as an internal control.
Zymography. Cells were incubated in serum-free IMDM at a concentration of 2 x 106/mL for 12 hours at 37°C in 5% CO2. Conditioned medium was concentrated with Amicon Ultra-15 centrifugal filter devices (Millipore Corporation, Bedford, MA) and MMP9 activity was assayed as described by Chemicon International (Temecula, CA) handbook with modifications. Briefly, 18 to 21 µL of the concentrated conditioned medium protein samples (
30 µg) were mixed with 6 to 7 µL of the 4x Tris-glycine sample buffer without reducing agent, incubated at room temperature for 20 minutes, and electrophoresed in 10% polyacrylamide gel containing 0.1% gelatin (Sigma-Aldrich, St. Louis, MO) at 4°C. Then, the gel was washed in 2.5% Triton X-100 for 30 minutes at room temperature and incubated for 18 hours at 37°C in 50 mmol/L Tris-HCl buffer (pH 7.4) containing 0.15 mol/L NaCl, 10 mmol/L CaCl2, and 0.02% NaN3 while gently shaking. Finally, the gel was stained for 1.5 hours with 0.1% Coomassie brilliant blue R250 and destained in 50% methanol and 10% acetic acid in H2O. The stained gel was photographed and processed in Adobe Photoshop.
Adhesion to collagen IV. Adherence to collagen IV was examined as described before (22). Briefly, 2 x 106 cells were suspended in 4 mL IMDM supplemented with 0.1% bovine serum albumin and incubated for 4 hours at 37°C in six-well plates coated with collagen IV (Becton Dickinson, Bedford, MA). Nonadherent cells were then removed and adherent cells were harvested after trypsinization and counted.
Invasion chamber assay. The assay was done as previously described (22). Briefly, 2 x 106 cells of murine hematopoietic cell lines and 2 x 105 primary cells suspended in 2 mL growth factorfree culture medium were placed in the upper chamber of Biocoat Matrigel invasion chambers (Becton Dickinson); the lower chamber was filled with 2 mL medium supplemented with IL-3 or IL-3 + IL-6 as chemoattractant for murine and human cells, respectively. MMP9-inactivating monoclonal antibodies (Ab-10, Oncogene Research Products; 5 µg/mL) or a gelatinase inhibitor ilomastat (GM6001, Chemicon International; 4 µg/mL) were added to the upper chamber; controls include nonimmune antibody and diluent, respectively. Viable cells able to migrate into the lower chamber and the percentage of living cells in the upper chamber were counted 24 hours later. Results were adjusted to represent the number of invasive cells present in the same number of living cells surviving the test.
Homing assay. In vivo invasion assay was done as described before (22). Briefly, cells were labeled with [5-3H]uridine (Moravec Biochemicals, Inc., Brea, CA; 16.2 Ci/mmol) for 24 hours at 37°C, washed, and injected i.v. into severe combined immunodeficient (SCID) mice (5 x 106/mouse). Cells from bone marrow (both femurs), spleen, liver, kidney, lungs, and brain were collected after 24 hours and deposited onto glass microfiber filters (Whatman International Ltd., Maidstone, United Kingdom). Cell-associated radioactivity was measured in a ß-scintillation counter.
Leukemogenesis in mice. Outbred SCID mice (Taconic Farms, Germantown, NJ) were injected i.v. with 106 cells pretested for the invasive capability. The development of leukemia was examined 3 and 7 days after leukemia inoculation and also in visibly morbid animals as described before (9). In brief, internal organs (bone marrow, spleen, liver, brain, lungs, and kidneys) were harvested, fixed, embedded, sectioned, stained with H&E, and examined under the microscope as described (9). A chloroacetate esterase (Leder) staining confirmed myeloid origin of the leukemia cells in the selected tissue sections. Animal studies were approved by the Institutional Animal Care and Use Committee at Temple University.
| Results |
|---|
|
|
|---|
|
Other members of the BCR/ABLrelated family of FTKs, such as TEL/ABL, TEL/PDGFßR, TEL/JAK2, NPM/ALK, but not TEL/TRKC, were also associated with stimulation of Id1 protein expression in BaF3 murine hematopoietic cells in the absence of IL-3 (Fig. 1E).
Role of Id1 in BCR/ABLmediated invasiveness. Prevention of cell apoptosis, induction of growth factor independence, and modulation of cell-extracellular matrix interactions are among the major functions of BCR/ABL (2, 3). To examine the role of Id1 in these processes, Id1 expression was up-regulated in the parental cells and down-modulated in the BCR/ABL counterparts by infection with pMIG1 retroviral particles carrying Id1 in sense and antisense orientation. Elevated or down-regulated expression of Id1 mRNA and protein levels in GFP+ cells was confirmed by semiquantitative RT-PCR and Western analysis, respectively (Fig. 2A and B, left ).
|
The percentage of apoptotic cells during the invasion test was usually <5% in BCR/ABLtransformed population; Id1 antisense did not change this number as expected. The apoptotic index in parental cells and cells expressing Id1 was usually
10% to 15%. This limited apoptosis was probably associated with the protective effect of IL-3 diffusing from the lower chamber to the upper chamber via the pores in the Matrigel membrane.
The homing ability of 32Dcl3 parental cells, 32Dcl3-BCR/ABL cells cotransfected with the control empty pMIG1 (BCR/ABL), pMIG1-Id1 antisense cDNA [BCR/ABL+Id1(AS)], or pMIG1-A1 antisense cDNA [BCR/ABL+A1(AS)] plasmids was determined in SCID mice injected with 3H-labeled cells as described before (22). As expected, radioactivity in the spleen and bone marrow from mice injected 24 hours earlier with BCR/ABL and BCR/ABL+A1(AS) cells was
2.5-fold higher than that detected in the corresponding organs on mice injected with the parental cells; however, this effect was reduced
2-fold in animals injected with BCR/ABL cells displaying down-regulation of Id1 protein (Fig. 3
). Interestingly, a strong reduction of cell-associated radioactivity was detected in the brain and lungs, but not in the liver and kidney of the latter mice compared with those injected with BCR/ABL and BCR/ABL+A1(AS) cells. Therefore, it seems that down-regulation of the Id1 protein impairs the ability of BCR/ABL leukemia cells to infiltrate hematopoietic tissues and invade some (brain, lungs) nonhematopoietic organs. The lack of the effect of Id1 down-regulation on homing in the liver and kidneys may be masked by nonspecific entrapment of injected cells in these organs. This speculation is supported by the fact that similar cellular associated radioactivity was detected in the livers and kidneys of mice inoculated with parental, BCR/ABL, and BCR/ABL+A1(AS) cells (Fig. 3).
|
Id1 is required for BCR/ABLmediated leukemogenesis. To determine whether Id1-dependent homing/infiltration activity plays a role in the BCR/ABLmediated leukemogenesis in vivo, SCID mice were injected with either GFP+ 32Dcl3-BCR/ABL cells cotransfected with the control empty plasmid (BCR/ABL) or the Id1 antisense cDNA [BCR/ABL +Id1(AS)]. All mice inoculated with the BCR/ABL cells succumbed to leukemia in 3.3 ± 0.5 weeks (Fig. 4, top ). Terminally ill animals contained elevated WBC counts (41.2 ± 20.9 x 103/mL); >90% of myeloid cells were GFP+. Histologic examination of the internal organs (bone marrow, spleen, liver, lung, kidney, and brain) in the terminally ill animals revealed the presence of myelogenous leukemia in essentially all organs. The extent of involvement ranged from focal to diffuse, the latter frequently with the architectural effacement of the organ and, occasionally, infiltration of the adjacent tissues. There was considerable variability in the degree of cell maturation among the involved sites with the hematopoietic-type organs (bone marrow, spleen, and liver) typically displaying more differentiated cells. Myeloid origin of the blasts was confirmed by the chloroacetoesterase staining. As compared with the BCR/ABL cell-injected mice, animals inoculated with the BCR/ABL+Id1(AS) cells displayed twice as long survival (6.5 ± 1.4 weeks, P < 0.05). Elevation of WBC counts (36.5 ± 8.3 x 103 cells/mL) was detected in these terminally ill recipients; again, >90% of myeloid cells were GFP+.
|
Histologically, there was a similar degree of cell maturation and organ involvement with the striking exception of the central nervous system and, possibly, the lungs. Ten of 11 BCR/ABL+Einjected mice developed central nervous system (CNS) involvement, in contrast to only 4 of 12 BCR/ABL+Id1(AS) mice. Furthermore, in seven of the BCR/ABL mice, the involvement was extensive and clearly infiltrative, whereas all four BCR/ABL+Id1(AS) mice displayed only focal, mostly meningeal involvement (Fig. 4, bottom, A and B). Lungs were involved in the leukemia process in all injected animals. However, only 6 of 12 mice injected with BCR/ABL+Id1(AS) cells displayed extensive infiltration of the lungs, compared with 8 of 11 of those injected with BCR/ABL cells (Fig. 4, bottom, C and D).
Higher CNS infiltration in mice injected with BCR/ABL cells observed in this work compared with that published before (9) may depend on the differential disease stage; samples were collected from the moribund animals and from those developing leukemia, respectively.
Id1 induces MMP9 expression and enhances invasiveness of the BCR/ABLtransformed cells. To determine the role of Id1 in the BCR/ABLmediated induction of MMP9 expression (27, 28) and functional activity, two types of experiments were done: transactivation studies with the use of MMP9 promoter and MMP9 gelatinase assay. Ectopic expression of Id1 or BCR/ABL greatly enhanced transactivation of the MMP9 promoter, whereas expression of Id1 antisense cDNA abrogated BCR/ABLdependent transactivation (Fig. 5A
). The zymography assay done to determine the MMP9 enzymatic activity was conducted using conditioned medium from the above-described 32Dcl3 cell populations: parental and those transfected with Id1 cDNA, BCR/ABLpositive, or BCR/ABLpositive and transfected with Id1 antisense cDNA (see Fig. 2A). As shown in Fig. 5B, MMP9 gelatinase activity was stimulated by the enhanced expression of Id1 (compare group 2 with 1) or the expression of BCR/ABL (compare group 3 with 1). In turn, inhibition of Id1 in BCR/ABLpositive cells decreased the activity of MMP9 by
5-fold (compare group 4 with 3). Gelatinase activity of another metalloprotease, MMP2, was not detectable, in accordance with other studies indicating that CML cells display this activity rarely and at a low level (27, 28).
|
|
| Discussion |
|---|
|
|
|---|
2-integrin in cells expressing BCR/ABL mutant lacking SH3 domain (BCR/ABL
SH3) was associated with decreased interaction with collagen IV and laminin, and invasion through Matrigel membrane (22). Therefore,
2-integrin and/or Rac-mediated regulation of cell invasiveness seem to depend on modulation of the cell-extracellular matrix adhesion and cell plasticity because inhibition of cell adhesion to the basement membrane components results in reduced tissue invasion by the malignant cells.
Here, we identified another mechanism stimulating extramedullar spread of BCR/ABLpositive leukemias. BCR/ABLSTAT5 signaling pathway is responsible for the enhanced expression of a helix-loop-helix transcription regulator Id1 leading to the overexpression of MMP9 metalloproteinase and enhanced capability to digest the basement membrane components. Altogether, it seems that BCR/ABL can stimulate cell invasiveness by at least three mechanisms: (a)
2-integrin affecting binding to Matrigel substrates (21); (b) Rac1-mediated modulation of the cytoskeleton and integrins, perhaps changing the cell plasticity and/or binding capability (29); and (c) Id1-MMP9mediated digestion of the basement membrane components (this article). The fact that cells expressing BCR/ABL
SH3 mutant have impaired invasion ability (21) while expressing Id1 (data not shown) suggests that
2-integrinmediated adhesion to the Matrigel membrane may play an important role in the subsequent Id1-MMP9directed invasion.
Id1 protein has been described previously as a downstream effector of STAT5 (9, 12) and its role in tissue invasion/metastasis by malignant cells is well documented (1517). BCR/ABLdependent increase in Id1 mRNA and protein expression in BCR/ABLtransformed cell lines and CML patients was detected using genome-wide screen (21) and Western analyses (this work), respectively. Down-regulation of Id1 in cytokine-independent BCR/ABLpositive 32Dcl3 cells and overexpression of Id1 in parental cells did not affect their response to growth factor withdrawal. Thus, it seems unlikely that Id1 may be responsible for the growth factor independence in BCR/ABLtransformed cells. This function is likely carried on by two other STAT5 downstream effectors: A1 and pim-1 (10). However, Id1 may exert yet unknown function(s) essential for early stages of BCR/ABLmediated transformation. This speculation is based on the observation that we have been unable to stably transform bone marrow cells harvested from Id1/ mice (ref. 33; obtained from Dr. R. Benezra, Memorial Sloan-Kettering Cancer Center, New York, NY) with BCR/ABL (data not shown). Because the loss of Id1 promotes cellular senescence associated with increased expression of the cell cycle inhibitor p16/Ink4a (34), we hypothesize that expression of BCR/ABL kinase may generate a stress signal, thus accelerating cell senescence and/or inducing apoptosis. Freshly transformed BCR/ABLpositive cells may not achieve growth factor independence initially (35); conversely, they sometimes display apoptosis (36). Therefore, "oversensitive" Id1/ cells may be unable to survive a "crisis" stage associated with the ABL kinasemediated transformation (37) and develop into fully transformed cells.
Although down-regulation of the Id1 protein expression neither affects growth factor independence nor adhesion to collagen IV, it impairs the invasive capacity of the BCR/ABLtransformed cells. The process of invasion consists of two events: adhesion to the basement membrane and actual penetration through the membrane (38). The first phenomenon is dependent on adhesion molecules, whereas the second phenomenon should require the Id1-MMP9 axis. In accordance, down-regulation of Id1 did not disturb adhesion of BCR/ABL+Id1(AS) cells to collagen IV while inhibiting invasion through the Matrigel membrane. On the other hand, overexpression of Id1 increased the invasive capability of cells; again, adhesion to collagen IV was not affected. These results support the notion that Id1 regulates invasion but not adhesion.
Interestingly, genome-wide screening revealed that CML-BC peripheral blood cells express higher levels of Id1 mRNA than those in the bone marrow, whereas CML-CP and CML-BC bone marrow cells display similar modestly up-regulated levels of Id1. Elevation of Id1 in CML-BC peripheral blood cells depended on the BCR/ABL kinase activity (see Fig. 1C and D), but was not accompanied by an increase in BCR/ABL expression (data not shown), implicating additional mechanism(s), e.g., deregulated protein degradation. Altogether, we speculate that whereas elevation of Id1 is a feature of CML as a whole, its overexpression in peripheral blood leukemic blasts seem to be associated with gain-of-function rather than progression from chronic phase to blast crisis. In concordance with this hypothesis, inhibition of Id1 expression affected the ability of BCR/ABL cells to penetrate through the Matrigel membrane in vitro and infiltrate hematopoietic (bone marrow, spleen) and some nonhematopoietic (brain, lung) organs. This effect was associated with delayed leukemogenesis in mice. BCR/ABLtransformed 32Dcl3 cells rather than bone marrow cells were used here to avoid the potential negative effect of down-regulation of Id1 on the proliferation of primary cells (as discussed before). In addition, mice that succumbed to leukemia induced by BCR/ABL cells expressing low levels of Id1 displayed reduced disease involvement in the brain and lungs compared with those inoculated with BCR/ABL cells expressing high levels of Id1. Thus, Id1 may play an important role in leukemogenesis by regulating the ability of leukemia cells to penetrate through basement membrane and infiltrate various organs. In addition, by promoting extramedullar localization of leukemia cells, Id1 can reduce the effectiveness of antileukemia drugs, e.g., imatinib mesylate (39). Because Id1 expression is increased mainly in CML-BC cells from peripheral blood, the above speculations may be most relevant to these cells.
GFP+ BCR/ABL+Id1(AS) leukemia cells harvested from bone marrow, spleen, and liver of terminally ill animals showed sustained inhibition of Id1 expression. This observation implicates that other mechanisms, in addition to Id1-MMP9 axis, play a role in the invasiveness of BCR/ABL leukemia cells. For example, decreased adhesion to stroma and fibronectin but increased adhesion to the basement membrane components laminin and collagen IV may underlie abnormal trafficking of BCR/ABL leukemia cells (40). Thus, a combination of mechanisms regulating adhesion and penetration through basement membranes and connective tissue components may determine the invasive properties of leukemia cells.
The role of Id1 in regulating invasiveness may not be limited to Ph chromosomepositive leukemias. We show here that BCR/ABLrelated FTKs, such as TEL/ABL, TEL/JAK2, TEL/PDGFßR, NPM/ALK, but not TEL/TRKC, also stimulated Id1 expression. Low level of Id1 in cells transformed by TEL/TRKC is accompanied by the lack of activation of STAT5 and stimulation of its downstream effectors, such as Bcl-xL and RAD51 (24, 41).
Id1-mediated stimulation of the invasive capacity of breast carcinoma cells was associated with overexpression of the 120 kDa gelatinase (16), which may consist of MMP9 and associated lipocalin neutrophil gelatinaseassociated lipocalin (18). Noteworthy, we show for the first time that Id1 induces transactivation of the MMP9 promoter leading to increase of the gelatinase activity. In concordance, other investigators showed MMP9 expression and activity in CML cells (27, 28, 42). Interestingly in this context, our earlier studies detected higher levels of MMP9 mRNA in CML-BC peripheral blood cells compared with the ones from bone marrow (21), concomitant with high levels of Id1 in the former cells. Hence, MMP9 may facilitate the release of leukemia cells from bone marrow to peripheral blood, in accordance with its role in tumor cell invasion (20). In support of this hypothesis, we show that MMP9 is responsible for enhanced invasion of the basement membrane by CML-BC myeloid and lymphoid peripheral blood cells and BCR/ABLtransformed cell lines compared with normal counterparts. MMP9 was also implicated in the penetration of normal CD34+ cells from the bone marrow to peripheral blood (43, 44).
BCR/ABLtransformed myeloid and lymphoid cell lines and patient cells displayed activation of STAT5 (45), overexpression of Id1, and MMP9-dependent invasion of the Matrigel membranes (this article). In addition, expression of a constitutively active STAT5B mutant or overexpression of the Id1 protein enhanced invasive properties of hematopoietic cell lines (data not shown and this work, respectively). Therefore, it is conceivable that BCR/ABL-STAT5-Id1-MMP9 pathway plays a role in the leukemia cell trafficking. This capacity, along with a variety of BCR/ABLmediated aberrations of the cell adhesion/migration (e.g., decreased adhesion to stroma and fibronectin combined with increased adhesion to the basement membrane components laminin and collagen IV) and an increase in spontaneous motility, may greatly contribute to leukemia course and outcome (22, 29, 31, 40, 4648). Accordingly, the integrin-dependent increase of adhesion to the basement membrane followed by Rac-modulated cell plasticity and MMP9-mediated digestion of the membrane components could represent an important mechanism in dissemination of the BCR/ABLtransformed cells.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank the members of Dr. George Tuszynski's laboratory for their help with zymograms and Elisabeth Bolton for critical reading of the manuscript.
| Footnotes |
|---|
Received 5/ 8/05. Revised 11/22/05. Accepted 1/30/06.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M. Stefanidakis, K. Karjalainen, D. E. Jaalouk, C. G. Gahmberg, S. O'Brien, R. Pasqualini, W. Arap, and E. Koivunen Role of leukemia cell invadosome in extramedullary infiltration Blood, October 1, 2009; 114(14): 3008 - 3017. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Zhang, M.-T. Ling, Q. Wang, C.-K. Lau, S. C. L. Leung, T. K. Lee, A. L. M. Cheung, Y.-C. Wong, and X. Wang Identification of a Novel Inhibitor of Differentiation-1 (ID-1) Binding Partner, Caveolin-1, and Its Role in Epithelial-Mesenchymal Transition and Resistance to Apoptosis in Prostate Cancer Cells J. Biol. Chem., November 16, 2007; 282(46): 33284 - 33294. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Rink, A. Slupianek, T. Stoklosa, M. Nieborowska-Skorska, K. Urbanska, I. Seferynska, K. Reiss, and T. Skorski Enhanced phosphorylation of Nbs1, a member of DNA repair/checkpoint complex Mre11-RAD50-Nbs1, can be targeted to increase the efficacy of imatinib mesylate against BCR/ABL-positive leukemia cells Blood, July 15, 2007; 110(2): 651 - 660. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Perk, I. Gil-Bazo, Y. Chin, P. de Candia, J. J.S. Chen, Y. Zhao, S. Chao, W. Cheong, Y. Ke, H. Al-Ahmadie, et al. Reassessment of Id1 Protein Expression in Human Mammary, Prostate, and Bladder Cancers Using a Monospecific Rabbit Monoclonal Anti-Id1 Antibody. Cancer Res., November 15, 2006; 66(22): 10870 - 10877. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |