Cancer Research Meeting Calendar  Protein Translation and Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, L.
Right arrow Articles by Coukos, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, L.
Right arrow Articles by Coukos, G.
[Cancer Research 66, 4627-4635, May 1, 2006]
© 2006 American Association for Cancer Research


Molecular Biology, Pathobiology, and Genetics

Integrative Genomic Analysis of Protein Kinase C (PKC) Family Identifies PKC{iota} as a Biomarker and Potential Oncogene in Ovarian Carcinoma

Lin Zhang1,3, Jia Huang2, Nuo Yang4, Shun Liang1, Andrea Barchetti1, Antonis Giannakakis1, Mark G. Cadungog1,3, Ann O'Brien-Jenkins1, Marco Massobrio7, Katherine F. Roby6, Dionyssios Katsaros7, Phyllis Gimotty5, Ralf Butzow8, Barbara L. Weber2 and George Coukos1,2,3

1 Center for Research on Reproduction and Women's Health, 2 Abramson Family Cancer Research Institute, Departments of 3 Obstetrics and Gynecology, 4 Genetics and Cell and Molecular Biology Program, and 5 Biostatistics and Epidemiology, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania; 6 Center for Reproductive Sciences, University of Kansas Medical Center, Kansas City, Kansas; 7 Department of Obstetrics and Gynecology, University of Turin, Turin, Italy; and 8 Departments of Obstetrics and Gynecology, University of Helsinki, Helsinki, Finland

Requests for reprints: George Coukos, Center for Research on Reproduction and Women's Health, University of Pennsylvania, 1331 Biomedical Research Building II/III, 421 Curie Boulevard, Philadelphia, PA 19104. Phone: 215-746-5137; Fax: 215-573-7627; E-mail: gcks{at}mail.med.upenn.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The protein kinase C (PKC) family plays a key regulatory role in a wide range of cellular functions as well as in various cancer-associated signal transduction pathways. Here, we investigated the genomic alteration and gene expression of most known PKC family members in human ovarian cancer. The DNA copy number of PKC family genes was screened by a high-resolution array-based comparative genomic hybridization in 89 human ovarian cancer specimens. Five PKC genes exhibited significant DNA copy number gains, including PKC{iota} (43.8%), PKCß1 (37.1%), PKC{gamma} (27.6%), PKC{zeta} (22.5%), and PKC{theta} (21.3%). None of the PKC genes exhibited copy number loss. The mRNA expression level of PKC genes was analyzed by microarray retrieval approach. Two of the amplified PKC genes, PKC{iota} and PKC{theta}, were significantly up-regulated in ovarian cancer compared with normal ovary. Increased PKC{iota} expression correlated with tumor stage or grade, and PKC{iota} overexpression was seen mostly in ovarian carcinoma but not in other solid tumors. The above results were further validated by real-time reverse transcription-PCR with 54 ovarian cancer specimens and 24 cell lines; overexpression of PKC{iota} protein was also confirmed by tissue array and Western blot. Interestingly, overexpressed PKC{iota} did not affect ovarian cancer cell proliferation or apoptosis in vitro. However, decreased PKC{iota} expression significantly reduced anchorage-independent growth of ovarian cancer cells, whereas overexpression of PKC{iota} contributed to murine ovarian surface epithelium transformation in cooperation with mutant Ras. We propose that PKC{iota} may serve as an oncogene and a biomarker of aggressive disease in human ovarian cancer. (Cancer Res 2006; 66(9): 4627-35)


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Epithelial ovarian cancer continues to be the leading cause of death among gynecologic malignancies (1). The lack of preventive strategies, early diagnostic methods, and effective therapies to treat recurrent ovarian tumors creates a pressing need to understand its pathogenesis and to identify molecular markers and targets for diagnosis as well as therapy (26). Cancer is a disease involving multistep dynamic changes in the genome. However, the genetic alteration events as well as their cooperation that promote malignant transformation and growth in ovarian carcinoma remain largely unknown (711).

The protein kinase C (PKC) family, a serine/threonine kinase family, plays a key regulatory role in a variety of cellular functions, including cell growth, differentiation, survival, apoptosis, signal transduction, gene expression, and hormone action (1216). PKCs can be subdivided into three major classes based on their structural and functional distinction, including conventional PKC isoforms (cPKC; {alpha}, ßI, ßII, and {gamma}), novel PKC isoforms (nPKC; {delta}, {varepsilon}, {eta}, and {theta}), and atypical PKC isoforms (aPKCs; {zeta} and {iota}/{lambda} in human/mouse; refs. 1216). cPKCs are diacylglycerol (DAG) sensitive and Ca2+ responsive. nPKCs are DAG sensitive but Ca2+ insensitive, and their C2-related domains do not retain Ca2+ coordinating residues. aPKCs have altered C1 domains and are not DAG sensitive, and regulation occurs in part through the NH2-terminal PB1 domain (16). Although the PKC family is involved in a wide range of cancer-associated signaling pathways and has been implicated in cancer (17, 18), the genomic alteration, expression, as well as physical/pathologic function of each PKC family isoenzyme in human cancer, including ovarian carcinoma, are still unclear. In this study, we used an integrated genomic approach to study the profile of most known isoenzymes of PKC family in human ovarian cancer and found that PKC{iota} may serve as an oncogene and a biomarker of aggressive disease in ovarian cancer.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Patients and specimens. The specimens used in this study were collected at the University of Pennsylvania (Philadelphia, PA) and the University of Turin (Turin, Italy). All tumors were from primary sites and were immediately snap frozen and stored at –80°C. Specimens were processed under procedures approved by the Health Insurance Portability and Accountability Act.

Cell lines and cell culture. A total of 18 ovarian cell lines were used in this study (19, 20). All cancer cell lines were cultured in DMEM (Invitrogen, Carlsbad, CA) supplemented with 10% fetal bovine serum (FBS; Invitrogen). Human ovarian surface epithelium (HOSE) cells were isolated by our laboratory (21) or provided by Dr. Michael J. Birrer [National Cancer Institute (NCI), Bethesda, MD; ref. 22]. Four immortalized HOSEs [IOSE398 (provided by Dr. Nelly Auersperg, University of British Columbia, Vancouver, British Columbia, Canada; ref. 23), ITOSE4, ITOSE6 (22), and HOSE6-14 (24)] were cultured in Medium 199:MCDB 105 (1:1; Sigma, St. Louis, MO) supplemented with 15% FBS. Nontransformed murine ovarian surface epithelial (MOSE, p11) cells were culture as described previously (25).

DNA isolation and array comparative genomic hybridization. Genomic DNA was isolated from frozen tumors or cultured cells by overnight digestion, phenol-chloroform extraction, and ethanol precipitation. Bacterial artificial chromosome (BAC) clones were cultured in YT broth containing 12.5 µg/mL chloramphenicol. BAC DNA was extracted using 96-well blocks (REAL Prep kits, Qiagen, Valencia, CA). DNA was then amplified by degenerate oligonucleotide primer-PCR and resuspended to a final concentration of 10 to 15 µg/mL. Arrays were printed on Corning CMT Ultra-Gap slides (Corning, Corning, NY). A minimum of two replicates per clone was printed on each slide. Tumor DNA (1 µg) and reference DNA (1 µg) were labeled with Cy3 or Cy5, respectively (Amersham, Piscataway, NJ) using the BioPrime random-primed labeling kit (Invitrogen). The tumor DNA and reference DNA were labeled with the opposite dye as well to account for difference in dye incorporation and provide additional data for analysis. Labeled tumor and reference DNAs were combined and precipitated with human Cot-1 DNA to reduce nonspecific binding. DNA was resuspended and applied to arrays. Arrays were hybridized for 72 hours at 37°C on a rotating platform. Images were scanned with an Affymetrix 428 Microarray Scanner (Affymetrix, Santa Clara, CA) and analyzed with GenePix software (Axon, Union City, CA). The Cy3/Cy5 (tumor/reference DNA) fluorescent intensity ratio >1.2 or <1.2 was considered as alteration (Fig. 1B ). Analysis of array-based comparative genomic hybridization (aCGH) data and determination of amplifications and losses were done using the software suite CGHAnalyzer (Fig. 1B; ref. 26).


Figure 1
View larger version (59K):
[in this window]
[in a new window]
 
Figure 1. PKC family in human ovarian cancer. A, DNA copy number alterations of PKC gene family in 89 late-stage primary ovarian cancer specimens. Left, aCGH results of nine PKC family genes in 89 primary tumors; right, summary of aCGH results. Blue, DNA copy number losses; yellow, copy number gains. A frequency of alteration >15% was considered significant. PKC{iota} exhibited the most frequent DNA copy number amplification. B, left, genomic profile of chromosome 3 in 89 ovarian cancer specimens. White line, PKC{iota} located on 3q25-q27. Green, DNA copy number gains; red, DNA copy number losses. Right, genomic profile of chromosome 3 in one ovarian cancer specimen. Red line, experiment with tumor DNA labeled with Cy3 and reference DNA with Cy5; yellow line, experiment with the opposite dye labeling. Y axis, intensity ratio of Cy3 to Cy5. Thresholds for copy number gain or loss are 1.2 and 0.8, respectively. C, summary of retrieved expression microarray data of PKC family mRNA expression in ovarian cancer. Right to left, ovarian cancer (n = 28) versus normal ovary (n = 4; ref. 33), ovarian cancer (n = 27) versus other types of cancer (n = 147; ref. 34), ovarian cancer grade 3 (n = 60) versus ovarian cancer grade 1 (n = 20; ref. 35), ovarian cancer stages 3 (n = 62) and 4 (n = 12) versus ovarian cancer stages 1 (n = 27) and 2 (n = 9; ref. 35). D, microarray data of PKC{iota} expression among 11 different human solid cancer types (34).

 
aCGH validation. Real-time PCR was done with the LightCycler (Roche Molecular Biochemicals, Mannheim, Germany). The total volume of reaction was 20 µL, including 4 µL LightCycler FastStart DNA Master Plus Hybridization Probe Master Mix (Roche Molecular Biochemicals), 0.5 µmol/L of each primer, 0.2 µmol/L of each probe, and 100 ng DNA template. PKC{iota}, 5'-CCATGATCTCCCTGCG (forward) and 5'-CCCCGATAATCCCACA (reverse); TBP, 5'-GAAGACGACGTAATGGC (forward) and 5'-ATAGCAGCACGGTATG (reverse); PKC{iota}, 5'-ACTTCTTCTGGGCTACACTATCTAAC-[FITC] (probe1) and 5'-[LC640]-CTGGCTGTTGAGGTGACTAC (probe2); and TBP, 5'-GAAGATGGATGTTGAGTTGCAGGG-[FITC] (probe1) and 5'-[LC705]-TGGCACCAGGTGATGCC (probe2).

Total RNA isolation and quantitative real-time reverse transcription-PCR. Total RNA was isolated from 100 to 500 mg frozen tissue or 1 x 106 cultured cells with Trizol reagent (Invitrogen). After treatment with RNase-free DNase (Invitrogen), total RNA was reverse transcribed using SuperScript First-Strand Synthesis kit for reverse transcription-PCR (RT-PCR; Invitrogen) under conditions defined by the supplier. cDNA was quantified by real-time PCR on the ABI Prism 7900 Sequence Detection System (Applied Biosystems, Foster City, CA). PKC{iota} forward primer, GGACTCTGAAGGCCACATTAAAC, and reverse primer, CCACAGAAAGTGCTGGTTGTATC. PCR was done using SYBR Green PCR Core reagents (Applied Biosystems) according to the manufacturer's instructions. PCR amplification of the housekeeping genes glyceraldehyde-3-phosphate dehydrogenase was done for each sample as control for sample loading and to allow normalization among samples. A standard curve was constructed with pCRII-TOPO cloning vector (Invitrogen) containing the same inserted fragment and amplified by the real-time PCR.

Microarray data retrieval and bioinformatic analysis. The public expression microarray data was retrieved from the authors' Web site and further analyzed using the web-based microarray analysis software, Oncomine (http://www.oncomine.org/main/index.jsp; ref. 27) and SOURCE (http://genome-www5.stanford.edu/cgi-bin/source/sourceSearch; ref. 28).

Tissue microarray. The tissue microarray was provided by Dr. Butzow (University of Helsinki, Helsinki, Finland), and constructed as described previously (29, 30). In brief, tumors were embedded in paraffin, and 5-µm sections stained with H&E were obtained to select representative areas for biopsies. Four core tissue biopsies were obtained from each specimen. The presence of tumor tissue on the arrayed samples was verified on H&E-stained section.

Immunohistochemistry and image analysis. Immunohistochemistry was done using the Vectastain avidin-biotin complex method kit as described by the manufacturer (Vector, Burlingame, CA). Primary antibody, mouse anti-human PKC{iota} (1:200 for frozen section and 1:50 for paraffin section; BD PharMingen, San Jose, CA), was incubated on sample sections for 2 hours at room temperature or 4°C overnight. The immunoreaction was visualized with 3,3'-diaminobenzidine (Vector). Staining was quantitated by image analysis. Images were collected through CoolSNAP-Pro Color digital camera (Media Cybernetics, Silver Spring, MD), and staining index was analyzed using Image-Pro Plus 4.1 software (Media Cybernetics).

Plasmid transfection. Human PKC{iota} was cloned from ovarian cancer cell lines by TOPO Cloning kit (Invitrogen), and cDNA sequence was further confirmed without mutation. Cells were seeded in six-well plates at 3 x 105 per well and grown overnight to ~40% confluence before transfection. All plasmids were transfected with Fugene 6 transfection reagent (Roche, Indianapolis, IN) following the manufacturer's instructions. To select neomycin-resistant cells, 400 µg/mL neomycin (Invitrogen) was applied. All transfection experiments were done in triplicate and repeated at least twice with different DNA isolates.

RNA interference/transfection of synthetic small interfering RNA. Synthetic SMARTpool small interfering RNA (siRNA) targeting human PKC{iota} (Dharmacon, Chicago, IL) or appropriate siCONTROL nontargeting siRNAs (Dharmacon) were transfected into cultured cells as described before (31). Transfection was done using LipofectAMINE 2000 (Invitrogen) following the manufacturer's instructions. Ovarian cancer cell lines were cultured in 24-well plate in antibiotics-free 10% FBS plus medium. On 70% to 80% confluency, transfection of siRNAs at 100 nmol/L was done. Triplicate transfection was done for each experiment group, and the experiment was repeated at least twice. Forty-eight hours after transfection, total RNA and protein were extracted to confirm decreased PKC{iota} expression by real-time RT-PCR and Western blot, respectively. For soft agar assay, cells were cultured in six-well plates in antibiotics-free medium supplied with 10% FBS, and transfection was done on 90% confluency.

Protein isolation and Western blot. Cultured cells were lysed in 200 µL lysis buffer containing 50 mmol/L Tris-HCl (pH 7.4), 150 mmol/L NaCl, and 1% Triton X-100. Protein was separated by 7% SDS-PAGE under denaturing conditions and transferred to nitrocellulose membrane. Membranes were incubated with an anti-PKC{iota} monoclonal antibody (1:1,000; BD PharMingen) followed by incubation in rabbit anti-mouse secondary antibody conjugated with horseradish peroxidase (1:5,000; Sigma). Immunoreactive proteins were visualized using enhanced chemiluminescence detection system (Amersham).

In vitro cell transformation assay. Soft agar assay was done using Cell Transformation Detection Assay kit (Chemicon, Temecula, CA) following the manufacturer's instructions.

Apoptosis assays. Annexin V staining was detected by flow cytometry using an apoptosis detection kit (R&D Systems, Minneapolis, MN). Both floating and adherent cells were collected, washed with PBS, and resuspended in binding buffer containing 10 mmol/L HEPES (pH 7.4), 140 mmol/L NaCl, and 2.5 mmol/L CaCl2. After 15-minute incubation with Annexin V-biotin at room temperature, cells were resuspended and incubated in binding buffer containing 4 µg/mL streptavidin Red 670 (Invitrogen) for 15 minutes. The fluorescence emitted by cells was analyzed using a FACScan flow cytometer (Becton Dickinson, Franklin Lakes, NJ).

Statistics. Statistical analysis was done using the Statistical Package for the Social Sciences software (SPSS, Chicago, IL). All results were expressed as mean ± SD, and P < 0.05 was used for significance.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
DNA copy number alterations of the PKC family in human ovarian cancer. To determine the DNA copy number abnormalities in the PKC family in ovarian cancer, high-resolution (~1 Mb) aCGH (32) was used in this study. The genomic loci of nine known human PKC family genes were identified at the University of California at Santa Cruz Genome Bioinformatics Site (http://genome.ucsc.edu/). We analyzed a total of 107 specimens, including 89 late-stage primary tumors and 18 cell lines. DNA copy number alterations observed in >15% tumors were considered significant change. We found five of nine PKC family members with significant DNA copy number gains and none with significant DNA copy number losses (Fig. 1A and B; Supplementary Table S1). Among the five amplified members, PKC{iota} was the most frequently observed with gains in 43.8% (39 in 89) of primary tumors. In addition, DNA copy number gains of PKCß1, PKC{gamma}, PKC{zeta}, and PKC{theta} were detected in 37.1%, 27.6%, 22.5%, and 21.3% of primary tumors, respectively. In established ovarian cancer cell lines, similar results were observed [e.g., PKC{iota} gained DNA copy number in 44.4% (8 of 18) cell lines (Fig. 2C )]. These results indicated that select PKC family members exhibited increased gene copy numbers in ovarian cancer.


Figure 2
View larger version (27K):
[in this window]
[in a new window]
 
Figure 2. Up-regulation of PKC{iota} mRNA in human ovarian cancer. A, validation of aCGH result by quantitative PCR (qPCR) in 73 primary ovarian cancer specimens. B, correlation between PKC{iota} DNA copy number and its mRNA expression in 33 primary ovarian cancer specimens. C, correlation between PKC{iota} DNA copy number and its mRNA expression in human ovarian cancer cell lines. D, PKC{iota} mRNA expression level quantified by real-time RT-PCR in 6 HOSE cell lines and 18 established ovarian cancer (Ov Ca) cell lines. E, PKC{iota} mRNA expression level quantified by real-time RT-PCR in 54 ovarian cancer specimens of 20 early-stage patients and 34 late-stage patients.

 
Transcriptional profile of PKC family in human ovarian cancer. To further study the expression profile of the PKC family in ovarian cancer, three public expression microarray data sets of human cancer were retrieved from the authors' Web site and analyzed by a Web-based microarray bioinformatic tool, Oncomine (http://www.oncomine.org/main/index.jsp). First, we examined the mRNA expression of the PKC family between normal ovary (n = 4) and ovarian carcinoma (n = 28) based on Welsh et al. (33) data set. The expression levels of PKC{iota} and PKC{theta} were significantly up-regulated in ovarian cancer compared with normal ovary (both P < 0.0001; Fig. 1C). Second, the mRNA expression of PKC family was compared in ovarian carcinoma (n = 27) and other cancer types (n = 147) based on Su et al. (34) data set. Two PKC gene family members were expressed at significantly different levels between ovarian and other cancer types, in which PKC{iota} was markedly overexpressed and PKC{zeta} was markedly underexpressed in ovarian carcinoma but not in other cancer types (Fig. 1C). Finally, we studied the mRNA expression of PKC family within different ovarian carcinoma grades (grade 1, n = 20; grade 2, n = 60) and stages (stages I and II, n = 36; stages III and IV, n = 74) based on Schwartz et al. (35) data set. PKC{iota} expression was significantly increased in both late-stage and high-grade ovarian cancer, whereas PKC{gamma} expression was decreased (Fig. 1C). In summary, this expression profile data suggested that PKC{iota} might be a potential biomarker for ovarian cancer because its mRNA expression was increased in ovarian carcinoma compared with normal ovary and in late-stage or high-grade cancer compared with early-phase cancer. Also interestingly, PKC{iota} was most highly expressed in ovarian cancer, although high expression was also found in some lung and prostate cancers (Fig. 1C and D).

Up-regulation of PKC{iota} mRNA in human ovarian cancer. The aCGH result was validated by real-time PCR in 73 ovarian cancer patients (P < 0.001; Fig. 2A). The correlation between PKC{iota} DNA copy number amplification and its mRNA expression was then further confirmed in 33 ovarian cancer patients (P = 0.003; Fig. 2B). Finally, we analyzed the correlation between DNA copy number amplification and mRNA expression in 18 established ovarian cancer cell lines. We found that in 8 of 18 cell lines with PKC{iota} DNA copy number gains, PKC{iota} mRNA expression level was markedly higher than in cell lines with normal DNA copy number (Fig. 2C). This suggested that the alteration in PKC{iota} DNA copy number may affect its mRNA expression in human cancer.

We also examined PKC{iota} mRNA expression in human ovarian cancer cell lines and frozen specimens by real-time RT-PCR. First, we quantified PKC{iota} mRNA expression in 6 HOSE cell lines and 18 established human ovarian cancer cell lines. We found significantly up-regulated PKC{iota} mRNA expression in established cancer cell lines compared with HOSEs (P = 0.031; Fig. 2D). Second, we analyzed PKC{iota} mRNA expression in 54 ovarian cancer specimens and found that its mRNA expression level was significantly higher in late-stage tumors (n = 34) than in early-stage tumors (n = 20; P = 0.028; Fig. 2E). These results further confirmed that PKC{iota} was overexpressed in ovarian cancer and increased in late-stage disease, which validated the results from retrieved expression microarray data.

Overexpression of PKC{iota} protein in human ovarian cancer. We analyzed PKC{iota} protein expression in normal human ovary, early OSE malignant transformation, as well as ovarian carcinoma by immunohistochemistry. In normal human ovary, PKC{iota} was not detectable in the stroma or follicles (Fig. 3A and B ). Very weak PKC{iota} staining could be detected both in the epithelium of normal ovary and in morphologically normal OSE cells adjacent to early malignant transformation sites (Fig. 3C and D). Importantly, PKC{iota} staining was only located at the apical side and was absent from the basal membrane of OSE (Fig. 3D). However, strong up-regulation of PKC{iota} expression was found in adjacent transformed OSE cells, where the above-mentioned polarity of expression pattern was missing (Fig. 3C and E). This result agreed with recent findings in both Drosophila and human ovarian cancer by Eder et al. (36). Strong PKC{iota} expression was found in both primary and metastatic ovarian cancer without polarized localization (Fig. 3F and G). We examined a tissue array containing a large ovarian cancer collection. We observed that strong, medium, and weak PKC{iota} staining in 39%, 39%, and 18% of specimens, respectively. PKC{iota} protein expression, as detected by immunohistochemistry, was missing in only 4% ovarian cancer (Fig. 3H). Finally, we confirmed the immunohistochemical results by Western blot in 3 HOSE cell lines and 13 ovarian cancer cell lines (Fig. 3I). In agreement with the immunohistochemical results, PKC{iota} expression was weak in all three HOSE lines but strong in all established ovarian cancer cell lines.


Figure 3
View larger version (61K):
[in this window]
[in a new window]
 
Figure 3. Overexpression of PKC{iota} protein in human ovarian cancer. A and B, immunohistochemical staining of PKC{iota} in normal human ovary. C to E, immunohistochemical staining of PKC{iota} in OSE of early malignant transformation. C, morphologically normal epithelium to malignant transformation. D and E, higher magnification of (C). Arrows, PKC{iota} predominantly located at the apical membrane of the epithelium. Immunohistochemical staining of PKC{iota} in primary (F) and metastatic (G) ovarian cancers. H, immunohistochemical staining of PKC{iota} in ovarian cancer tissue array. Right to left, expression classified as high, medium, weak, and absent. I, immunoblot of PKC{iota} in HOSEs and established ovarian cancer cell lines.

 
PKC{iota} expression does not directly affect cell proliferation in vitro. In Drosophila, forced expression of PKC{iota} dramatically increased cell proliferation (36). In human ovarian cancer, high PKC{iota} expression was positively correlated with the proliferation marker Ki-67 in vivo (36). In addition, increased PKC{iota} protein level was associated with increased cyclin E expression (36). Therefore, we tested the effect of PKC{iota} expression on cell proliferation in vitro. First, we selected the ovarian cancer cell line A1847, which exhibited normal PKC{iota} DNA copy number and expressed PKC{iota} mRNA and protein at relatively low levels. Human PKC{iota} was stably transfected into A1847 cell line, and forced overexpression of PKC{iota} protein was confirmed by Western blot (Fig. 4A ). Overexpression of PKC{iota} was not found to affect directly cell proliferation or apoptosis (Fig. 4B and C). To rule out the possibility that the phenotype resulting from forced expression of PKC{iota} may have been confounded by already expressed PKC{iota} in this cell line, we selected two other ovarian cancer cell lines, one with PKC{iota} DNA copy number amplification (2008) and the other with normal copy number (OVCAR10), and tested the effect induced by decreased PKC{iota} expression. Using siRNA, we specifically knocked down PKC{iota} expression (Fig. 4D). No significant difference was observed in either proliferation or apoptosis between control and PKC{iota}-siRNA-transfected lines (Fig. 4E and F). In addition, we analyzed the correlation of PKC{iota} expression with the doubling time in 14 ovarian cancer cell lines. In agreement with above data, no significant correlation was found (Fig. 4G). Finally, we tested culture conditions with different serum concentrations (10%, 5%, 0.5%, and 0%). Forced expression or knockdown of PKC{iota} did not directly affect ovarian cancer cell proliferation in vitro under these conditions. These data agree with findings in colon and lung cancer cell lines that expression of exogenous PKC{iota} or negative dominant PKC{iota} caused no change in cell proliferation in vitro (37, 38). Because both Drosophila and human ovarian cancer data (36) were observed in vivo, it is possible that the effect of PKC{iota} on cell proliferation is not a direct function but rather dependent on in vivo growth requirements in cancer.


Figure 4
View larger version (29K):
[in this window]
[in a new window]
 
Figure 4. PKC{iota} expression does not directly affect cell proliferation in vitro. A to C, forced expression of hPKC{iota} in the ovarian cancer cell line A1847, which harbors normal PKC{iota} DNA copy number. A, Western blot confirming PKC{iota} overexpression. B, cell growth curve of WT and transfected cells. C, summary of apoptotic cell number in WT and transfected cells. D to F, apoptosis and survival in ovarian cancer cell lines, 2008 (PKC{iota} amplified) and OVCAR10 (PKC{iota} normal), transfected with siRNA targeting human PKC{iota}. D, Western blot confirming PKC{iota} knockdown in transfected cells. E, cell growth curve of control and PKC{iota}-siRNA-transfected cells. F, summary of apoptotic cell number in control and PKC{iota}-siRNA-transfected cells. G, no correlation observed between PKC{iota} expression and cell proliferation (doubling time) in 14 ovarian cancer cell lines in vitro.

 
PKC{iota} contributes to ovarian epithelium transformation and cooperates with mutant Ras. We tested the role of PKC{iota} in anchorage-independent growth of 2008 ovarian cancer cell line in soft agar. PKC{iota} was overexpressed by transfection with a hPKC{iota} expression plasmid or decreased by specific siRNA transfection. We found that increased PKC{iota} expression slightly increased the colony number, whereas decreased expression significantly reduced colony number (Fig. 5A ). Next, we tested the function of PKC{iota} in OSE transformation and its cooperation with Ras by soft agar assay. Nontransformed primary MOSE was transfected with PKC{iota}, mutant Ras, or PKC{iota} plus mutant Ras. Similar to the results from colon and lung epithelium (3739), PKC{iota} overexpression alone was not sufficient to transform OSE in vivo. However, when coexpressed with mutant Ras, PKC{iota} could increase the colony number significantly (Fig. 5B and C). Most interestingly, we found that coexpression of PKC{iota} with mutant Ras could not only increase the colony number, but also markedly increase colony size (e.g., >10% colonies in the coexpression group were 5- to 8-fold larger than those in the group transfected with mutant Ras alone). These results indicate that PKC{iota} plays critical roles in OSE transformation when cooperating with other oncogenic events, such as Ras mutation.


Figure 5
View larger version (38K):
[in this window]
[in a new window]
 
Figure 5. PKC{iota} contributes to ovarian epithelium transformation and cooperates with mutant Ras. A, summary of soft agar assay of human ovarian cancer cell line 2008 with overexpressed PKC{iota} (left) or reduced PKC{iota} by siRNA (right). B, summary of soft agar assay of MOSE, which was transfected with PKC{iota}, mutant Ras, or PKC{iota} plus mutant Ras. C, PKC{iota} cooperating with mutant Ras significantly increased colony number and size in soft agar.

 
PKC{iota} does not affect ovarian cancer cell response to chemotherapy. It was reported that PKC{iota} protects human leukemia cells against drug-induced apoptosis (40, 41). To test the role of PKC{iota} in ovarian cancer chemotherapy, 14 ovarian cancer cell lines with detailed chemotherapy response information (19) were used in this study. The PKC{iota} mRNA of those 14 ovarian cancer lines was analyzed by real-time RT-PCR. No significant correlation was found between PKC{iota} expression and chemotherapy resistance (IC50) to cisplatin, carboplatin, oxaliplatin, and AMD473 as characterized previously by Roberts et al. (Fig. 6A ; ref. 19). Next, we tested a set of ovarian cancer cell lines with different sensitivities to cisplatin (42). There was no significant correlation between resistance to cisplatin and PKC{iota} expression (Fig. 6E). Finally, we compared the sensitivity with cisplatin of wild-type (WT) A1847 and A1847 cells transfected with PKC{iota}. Cisplatin treatment at 5-fold of IC50 induced similar amount of apoptosis in WT and transfected cells after 24 hours. In conclusion, PKC{iota} overexpression did not seem to affect ovarian cancer cell response to chemotherapy.


Figure 6
View larger version (23K):
[in this window]
[in a new window]
 
Figure 6. PKC{iota} does not affect the ovarian cancer cell response to chemotherapy. A to D, correlation between response to chemotherapy and PKC{iota} mRNA expression in 14 ovarian cancer cell lines. Left to right, 14 ovarian cancer cell lines with increasing drug resistance (increasing IC50). E, correlation between resistance to cisplatin and PKC{iota} mRNA expression in a set of ovarian cancer cell lines (A2780 and chemoresistant strains, A2780/CP70, A2780/C30, and A2780/C200). Left to right, four cell lines with increasing cisplatin resistance (increasing IC50). F, WT and PKC{iota}-transfected A1847 cells treated with cisplatin (22.5 µmol/L) for 24 and 48 hours. Apoptotic cells were quantified by fluorescence-activated cell sorting analysis.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In the present study, we investigated genomic alterations of most known PKC family members in human ovarian cancer by an integrated genomic approach, including aCGH, expression microarray, and tissue arrays. Five PKC family members were found to be significantly amplified in ovarian cancer, and none of them exhibited copy number loss. Two of the PKC genes, PKC{iota} and PKC{theta}, exhibited significantly up-regulated mRNA expression in ovarian carcinoma compared with normal ovary. Importantly, the DNA copy number of both these PKC genes was frequently amplified in ovarian cancer. Genomic amplification correlated with increased mRNA expression of PKC{iota}. Therefore, it is likely that the DNA copy number amplification contributes to overexpression of PKC genes in ovarian cancer. Most interestingly, PKC{iota} mRNA expression was significantly increased with advanced clinical stage and grade. In addition, PKC{iota} was most highly expressed in ovarian carcinoma among human solid tumors, although higher expression of PKC{iota} was also found in some lung and prostate cancers. Taken together, these results suggest that PKC{iota} is a biomarker for aggressive disease in ovarian carcinoma.

Importantly, two other independent groups reported recently that PKC{iota} serves critical functions in human ovarian (36) and lung cancers (38, 39). Eder et al. (36) showed that increased PKC{iota} DNA copy number was associated with decreased progression-free survival in ovarian cancer, whereas high expression of PKC{iota} increased cyclin E expression and proliferation in vivo. Regala et al. (38, 39) found that PKC{iota} was amplified in lung cancer, and overexpression of PKC{iota} was required for transformation of lung cancer cells that harbor PKC{iota} gene amplification. Taken together with our findings, these data confirm that our integrated genomic approach could successfully identify novel oncogenic member(s) from the PKC family and indicate that PKC{iota} is a potential oncogene in human cancer.

The precise mechanism of oncogenic transformation by PKC{iota} in human cancer is still largely unknown. Eder et al. (36) shown that, in Drosophila, forced expression of PKC{iota} dramatically increased cell proliferation. In human ovarian cancer, high PKC{iota} expression was positively correlated with the proliferation marker Ki-67 (36). Our results suggest that overexpressed PKC{iota} did not directly affect ovarian cancer cell proliferation in vitro as also confirmed by specific knockdown of PKC{iota} expression by siRNAs. Similar studies in colon (37) and lung (38) cancers are consistent with these results in ovarian cancer. Because the positive correlation between PKC{iota} and cell proliferation in Drosophila and ovarian cancer were observed in vivo (36), it is possible that the effect of PKC{iota} on cell proliferation is not a direct function but rather dependent on in vivo growth requirements in cancer. Eder et al. (36) reported that PKC{iota} overexpression is associated with mislocalization of its protein product and loss of apical-basal polarity in ovarian cancer. Our results of apical localization in normal OSE and mislocalization in adjacent transformed OSE agree with these observations.

In both lung (38, 39) and colon (37) cancer, PKC{iota} was shown to contribute to malignant transformation, which required Ras cooperation (37). Our data also show that, in ovarian cancer, PKC{iota} can cooperate with mutant Ras to transform MOSE in vitro. Interestingly, we also found the cooperation of PKC{iota} and mutant Ras caused significantly larger colonies than Ras alone. This suggests that PKC{iota} promotes anchorage-independent growth during Ras-induced transformation. aPKC has been implicated in Ras-mediated signaling pathway (37, 4345). Murray et al. (37) showed that PKC{iota} is a critical downstream effector of oncogenic Ras in colonic epithelium transformation. Blocking of PKC{iota} function in Ras-transformed epithelium inhibits the oncogenic Ras-mediated activation of Rac1, cellular invasion, and anchorage-independent growth (37). In addition, most recently work showed that the location and function of K-Ras were directly regulated by PKC (46). Phosphorylation by PKC of S181 within polybasic region promoted rapid dissociation of K-Ras from plasma membrane and association without membrane of mitochondria, where phosphorylated K-Ras interacts with Bcl-xL (46). Finally, overexpression of PKC{iota} might affect other genes/pathways, such as cyclin D1 (45), which interact and/or enhance Ras-mediated transformation.

Finally, PKC{iota} may play a prerequisite role in Bcr-Abl-mediated resistance to chemotherapy-induced apoptosis in leukemia (40, 41). Our data indicate that PKC{iota} does not affect chemotherapy resistance in ovarian carcinoma. Future work is needed to understand how PKC{iota} functions in human cancer with regard to cancer type, tissue and cellular context, as well as downstream effectors.


    Acknowledgments
 
Grant support: Ovarian Cancer Research Fund and Pennsylvania Department of Health grants (G. Coukos), NCI Ovarian Specialized Program of Research Excellence grant P01-CA83638 and Ovarian Cancer Research Fund (L. Zhang), and Italian Association for Cancer Research (D. Katsaros).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Drs. Steven Johnson and Kang-Shen Yao (University of Pennsylvania) for the human ovarian cancer cells, Dr. Michael J. Birrer (NCI) for HOSEs, and Dr. Nelly Auersperg (University of British Columbia) for HOSEs and access to the Canadian Ovarian Tissue Bank.


    Footnotes
 
Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/).

L. Zhang and J. Huang contributed equally to this work. B.L. Weber is currently at the Translational Medicine and Genetics at GlaxoSmithKline, King of Prussia, PA 19406.

Received 12/20/05. Revised 2/21/06. Accepted 3/ 2/06.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Jemal A, Tiwari RC, Murray T, et al. Cancer statistics, 2004. CA Cancer J Clin 2004;54:8–29.[Abstract/Free Full Text]
  2. Urban N, McIntosh MW, Andersen M, Karlan BY. Ovarian cancer screening. Hematol Oncol Clin North Am 2003;17:989–1005, ix.[CrossRef][Medline]
  3. Ozols RF. Management of advanced ovarian cancer consensus summary. Advanced ovarian cancer consensus faculty. Semin Oncol 2000;27:47–9.[Medline]
  4. Berchuck A, Brewer M, Rodriguez G, Campbell I. Discussion: ovarian cancer prevention. Gynecol Oncol 2003;88:S67–70.[CrossRef]
  5. Ozols RF, Bookman MA, Connolly DC, et al. Focus on epithelial ovarian cancer. Cancer Cell 2004;5:19–24.[CrossRef][Medline]
  6. Agarwal R, Kaye SB. Ovarian cancer: strategies for overcoming resistance to chemotherapy. Nat Rev Cancer 2003;3:502–16.[CrossRef][Medline]
  7. Farley JH, Birrer MJ. Biologic directed therapies in gynecologic oncology. Curr Oncol Rep 2003;5:459–67.[Medline]
  8. Wooster R, Weber BL. Breast and ovarian cancer. N Engl J Med 2003;348:2339–47.[Free Full Text]
  9. Gray JW, Suzuki S, Kuo WL, et al. Specific keynote: genome copy number abnormalities in ovarian cancer. Gynecol Oncol 2003;88:S16–21; discussion S2–4.[CrossRef][Medline]
  10. Zhang L, Yang N, Huang J, et al. Transcriptional coactivator Drosophila eyes absent homologue 2 is up-regulated in epithelial ovarian cancer and promotes tumor growth. Cancer Res 2005;65:925–32.[Abstract/Free Full Text]
  11. Zhang L, Yang N, Katsaros D, et al. The oncogene phosphatidylinositol 3'-kinase catalytic subunit {alpha} promotes angiogenesis via vascular endothelial growth factor in ovarian carcinoma. Cancer Res 2003;63:4225–31.[Abstract/Free Full Text]
  12. Dempsey EC, Newton AC, Mochly-Rosen D, et al. Protein kinase C isozymes and the regulation of diverse cell responses. Am J Physiol Lung Cell Mol Physiol 2000;279:L429–38.[Abstract/Free Full Text]
  13. Jaken S, Parker PJ. Protein kinase C binding partners. Bioessays 2000;22:245–54.[CrossRef][Medline]
  14. Spitaler M, Cantrell DA. Protein kinase C and beyond. Nat Immunol 2004;5:785–90.[CrossRef][Medline]
  15. Poole AW, Pula G, Hers I, Crosby D, Jones ML. PKC-interacting proteins: from function to pharmacology. Trends Pharmacol Sci 2004;25:528–35.[CrossRef][Medline]
  16. Parker PJ, Murray-Rust J. PKC at a glance. J Cell Sci 2004;117:131–2.[Free Full Text]
  17. Mackay HJ, Twelves CJ. Protein kinase C: a target for anticancer drugs? Endocr Relat Cancer 2003;10:389–96.[Abstract]
  18. Fields AP, Gustafson WC. Protein kinase C in disease: cancer. Methods Mol Biol 2003;233:519–37.[Medline]
  19. Roberts D, Schick J, Conway S, et al. Identification of genes associated with platinum drug sensitivity and resistance in human ovarian cancer cells. Br J Cancer 2005;92:1149–58.[CrossRef][Medline]
  20. Zhang L, Yang N, Park JW, et al. Tumor-derived vascular endothelial growth factor up-regulates angiopoietin-2 in host endothelium and destabilizes host vasculature, supporting angiogenesis in ovarian cancer. Cancer Res 2003;63:3403–12.[Abstract/Free Full Text]
  21. Zhang L, Yang N, Conejo-Garcia JR, et al. Expression of endocrine gland-derived vascular endothelial growth factor in ovarian carcinoma. Clin Cancer Res 2003;9:264–72.[Abstract/Free Full Text]
  22. Zorn KK, Jazaeri AA, Awtrey CS, et al. Choice of normal ovarian control influences determination of differentially expressed genes in ovarian cancer expression profiling studies. Clin Cancer Res 2003;9:4811–8.[Abstract/Free Full Text]
  23. Maines-Bandiera SL, Kruk PA, Auersperg N. Simian virus 40-transformed human ovarian surface epithelial cells escape normal growth controls but retain morphogenetic responses to extracellular matrix. Am J Obstet Gynecol 1992;167:729–35.[Medline]
  24. Tsao SW, Mok SC, Fey EG, et al. Characterization of human ovarian surface epithelial cells immortalized by human papilloma viral oncogenes (HPV-E6E7 ORFs). Exp Cell Res 1995;218:499–507.[CrossRef][Medline]
  25. Roby KF, Taylor CC, Sweetwood JP, et al. Development of a syngeneic mouse model for events related to ovarian cancer. Carcinogenesis 2000;21:585–91.[Abstract/Free Full Text]
  26. Margolin AA, Greshock J, Naylor TL, et al. CGHAnalyzer: a stand-alone software package for cancer genome analysis using array-based DNA copy number data. Bioinformatics 2005;21:3308–11.[Abstract/Free Full Text]
  27. Rhodes DR, Yu J, Shanker K, et al. ONCOMINE: a cancer microarray database and integrated data-mining platform. Neoplasia 2004;6:1–6.[Medline]
  28. Diehn M, Sherlock G, Binkley G, et al. SOURCE: a unified genomic resource of functional annotations, ontologies, and gene expression data. Nucleic Acids Res 2003;31:219–23.[Abstract/Free Full Text]
  29. Kononen J, Bubendorf L, Kallioniemi A, et al. Tissue microarrays for high-throughput molecular profiling of tumor specimens. Nat Med 1998;4:844–7.[CrossRef][Medline]
  30. Lassus H, Leminen A, Lundin J, Lehtovirta P, Butzow R. Distinct subtypes of serous ovarian carcinoma identified by p53 determination. Gynecol Oncol 2003;91:504–12.[CrossRef][Medline]
  31. Zhang L, Yang N, Liang S, et al. RNA interference: a potential strategy for isoform-specific phosphatidylinositol 3-kinase targeted therapy in ovarian cancer. Cancer Biol Ther 2004;3:1283–9.[Medline]
  32. Greshock J, Naylor TL, Margolin A, et al. 1-Mb resolution array-based comparative genomic hybridization using a BAC clone set optimized for cancer gene analysis. Genome Res 2004;14:179–87.[Abstract/Free Full Text]
  33. Welsh JB, Zarrinkar PP, Sapinoso LM, et al. Analysis of gene expression profiles in normal and neoplastic ovarian tissue samples identifies candidate molecular markers of epithelial ovarian cancer. Proc Natl Acad Sci U S A 2001;98:1176–81.[Abstract/Free Full Text]
  34. Su AI, Welsh JB, Sapinoso LM, et al. Molecular classification of human carcinomas by use of gene expression signatures. Cancer Res 2001;61:7388–93.[Abstract/Free Full Text]
  35. Schwartz DR, Kardia SL, Shedden KA, et al. Gene expression in ovarian cancer reflects both morphology and biological behavior, distinguishing clear cell from other poor-prognosis ovarian carcinomas. Cancer Res 2002;62:4722–9.[Abstract/Free Full Text]
  36. Eder AM, Sui X, Rosen DG, et al. Atypical PKC{iota} contributes to poor prognosis through loss of apical-basal polarity and cyclin E overexpression in ovarian cancer. Proc Natl Acad Sci U S A 2005;102:12519–24.[Abstract/Free Full Text]
  37. Murray NR, Jamieson L, Yu W, et al. Protein kinase C{iota} is required for Ras transformation and colon carcinogenesis in vivo. J Cell Biol 2004;164:797–802.[Abstract/Free Full Text]
  38. Regala RP, Weems C, Jamieson L, Copland JA, Thompson EA, Fields AP. Atypical protein kinase C{iota} plays a critical role in human lung cancer cell growth and tumorigenicity. J Biol Chem 2005;280:31109–15.[Abstract/Free Full Text]
  39. Regala RP, Weems C, Jamieson L, et al. Atypical protein kinase C{iota} is an oncogene in human non-small cell lung cancer. Cancer Res 2005;65:8905–11.[Abstract/Free Full Text]
  40. Murray NR, Fields AP. Atypical protein kinase C{iota} protects human leukemia cells against drug-induced apoptosis. J Biol Chem 1997;272:27521–4.[Abstract/Free Full Text]
  41. Jamieson L, Carpenter L, Biden TJ, Fields AP. Protein kinase C{iota} activity is necessary for Bcr-Abl-mediated resistance to drug-induced apoptosis. J Biol Chem 1999;274:3927–30.[Abstract/Free Full Text]
  42. Louie KG, Behrens BC, Kinsella TJ, et al. Radiation survival parameters of antineoplastic drug-sensitive and -resistant human ovarian cancer cell lines and their modification by buthionine sulfoximine. Cancer Res 1985;45:2110–5.[Abstract/Free Full Text]
  43. Uberall F, Hellbert K, Kampfer S, et al. Evidence that atypical protein kinase C-{lambda} and atypical protein kinase C-{zeta} participate in Ras-mediated reorganization of the F-actin cytoskeleton. J Cell Biol 1999;144:413–25.[Abstract/Free Full Text]
  44. Coghlan MP, Chou MM, Carpenter CL. Atypical protein kinases C{lambda} and -{zeta} associate with the GTP-binding protein Cdc42 and mediate stress fiber loss. Mol Cell Biol 2000;20:2880–9.[Abstract/Free Full Text]
  45. Kampfer S, Windegger M, Hochholdinger F, et al. Protein kinase C isoforms involved in the transcriptional activation of cyclin D1 by transforming Ha-Ras. J Biol Chem 2001;276:42834–42.[Abstract/Free Full Text]
  46. Bivona TG, Quatela SE, Bodemann BO, et al. PKC regulates a farnesyl-electrostatic switch on K-Ras that promotes its association with Bcl-Xl on mitochondria and induces apoptosis. Mol Cell 2006;21:481–93.[CrossRef][Medline]



This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
H. Ishiguro, K. Akimoto, Y. Nagashima, Y. Kojima, T. Sasaki, Y. Ishiguro-Imagawa, N. Nakaigawa, S. Ohno, Y. Kubota, and H. Uemura
aPKC{lambda}/{iota} promotes growth of prostate cancer cells in an autocrine manner through transcriptional activation of interleukin-6
PNAS, September 22, 2009; 106(38): 16369 - 16374.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
R. P. Regala, E. A. Thompson, and A. P. Fields
Atypical Protein Kinase C{iota} Expression and Aurothiomalate Sensitivity in Human Lung Cancer Cells
Cancer Res., July 15, 2008; 68(14): 5888 - 5895.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
M. Lee and V. Vasioukhin
Cell polarity and cancer - cell and tissue polarity as a non-canonical tumor suppressor
J. Cell Sci., April 15, 2008; 121(8): 1141 - 1150.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Ghosh, T. Marquardt, J. P. Thaler, N. Carter, S. E. Andrews, S. L. Pfaff, and T. Hunter
Instructive role of aPKC{zeta} subcellular localization in the assembly of adherens junctions in neural progenitors
PNAS, January 8, 2008; 105(1): 335 - 340.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
L. Zhang, J. Huang, N. Yang, J. Greshock, S. Liang, K. Hasegawa, A. Giannakakis, N. Poulos, A. O'Brien-Jenkins, D. Katsaros, et al.
Integrative Genomic Analysis of Phosphatidylinositol 3'-Kinase Family Identifies PIK3R3 as a Potential Therapeutic Target in Epithelial Ovarian Cancer
Clin. Cancer Res., September 15, 2007; 13(18): 5314 - 5321.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
I. Nazarenko, R. Schafer, and C. Sers
Mechanisms of the HRSL3 tumor suppressor function in ovarian carcinoma cells
J. Cell Sci., April 15, 2007; 120(8): 1393 - 1404.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Nanjundan, Y. Nakayama, K. W. Cheng, J. Lahad, J. Liu, K. Lu, W.-L. Kuo, K. Smith-McCune, D. Fishman, J. W. Gray, et al.
Amplification of MDS1/EVI1 and EVI1, Located in the 3q26.2 Amplicon, Is Associated with Favorable Patient Prognosis in Ovarian Cancer
Cancer Res., April 1, 2007; 67(7): 3074 - 3084.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
P. S. Linsley, J. Schelter, J. Burchard, M. Kibukawa, M. M. Martin, S. R. Bartz, J. M. Johnson, J. M. Cummins, C. K. Raymond, H. Dai, et al.
Transcripts Targeted by the MicroRNA-16 Family Cooperatively Regulate Cell Cycle Progression
Mol. Cell. Biol., March 15, 2007; 27(6): 2240 - 2252.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Pu, M. L. Peach, S. H. Garfield, S. Wincovitch, V. E. Marquez, and P. M. Blumberg
Effects on Ligand Interaction and Membrane Translocation of the Positively Charged Arginine Residues Situated along the C1 Domain Binding Cleft in the Atypical Protein Kinase C Isoforms
J. Biol. Chem., November 3, 2006; 281(44): 33773 - 33788.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Erdogan, T. Lamark, M. Stallings-Mann, Lee Jamieson, M. Pellechia, E. A. Thompson, T. Johansen, and A. P. Fields
Aurothiomalate Inhibits Transformed Growth by Targeting the PB1 Domain of Protein Kinase C{iota}
J. Biol. Chem., September 22, 2006; 281(38): 28450 - 28459.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, L.
Right arrow Articles by Coukos, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, L.
Right arrow Articles by Coukos, G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online