| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Molecular Biology, Pathobiology, and Genetics |
as a Biomarker and Potential Oncogene in Ovarian Carcinoma
1 Center for Research on Reproduction and Women's Health, 2 Abramson Family Cancer Research Institute, Departments of 3 Obstetrics and Gynecology, 4 Genetics and Cell and Molecular Biology Program, and 5 Biostatistics and Epidemiology, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania; 6 Center for Reproductive Sciences, University of Kansas Medical Center, Kansas City, Kansas; 7 Department of Obstetrics and Gynecology, University of Turin, Turin, Italy; and 8 Departments of Obstetrics and Gynecology, University of Helsinki, Helsinki, Finland
Requests for reprints: George Coukos, Center for Research on Reproduction and Women's Health, University of Pennsylvania, 1331 Biomedical Research Building II/III, 421 Curie Boulevard, Philadelphia, PA 19104. Phone: 215-746-5137; Fax: 215-573-7627; E-mail: gcks{at}mail.med.upenn.edu.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
(43.8%), PKCß1 (37.1%), PKC
(27.6%), PKC
(22.5%), and PKC
(21.3%). None of the PKC genes exhibited copy number loss. The mRNA expression level of PKC genes was analyzed by microarray retrieval approach. Two of the amplified PKC genes, PKC and PKC, were significantly up-regulated in ovarian cancer compared with normal ovary. Increased PKC expression correlated with tumor stage or grade, and PKC overexpression was seen mostly in ovarian carcinoma but not in other solid tumors. The above results were further validated by real-time reverse transcription-PCR with 54 ovarian cancer specimens and 24 cell lines; overexpression of PKC protein was also confirmed by tissue array and Western blot. Interestingly, overexpressed PKC did not affect ovarian cancer cell proliferation or apoptosis in vitro. However, decreased PKC expression significantly reduced anchorage-independent growth of ovarian cancer cells, whereas overexpression of PKC contributed to murine ovarian surface epithelium transformation in cooperation with mutant Ras. We propose that PKC may serve as an oncogene and a biomarker of aggressive disease in human ovarian cancer. (Cancer Res 2006; 66(9): 4627-35) |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The protein kinase C (PKC) family, a serine/threonine kinase family, plays a key regulatory role in a variety of cellular functions, including cell growth, differentiation, survival, apoptosis, signal transduction, gene expression, and hormone action (12–16). PKCs can be subdivided into three major classes based on their structural and functional distinction, including conventional PKC isoforms (cPKC; 
, ßI, ßII, and ), novel PKC isoforms (nPKC; 
, 
, 
, and ), and atypical PKC isoforms (aPKCs; and /
in human/mouse; refs. 12–16). cPKCs are diacylglycerol (DAG) sensitive and Ca2+ responsive. nPKCs are DAG sensitive but Ca2+ insensitive, and their C2-related domains do not retain Ca2+ coordinating residues. aPKCs have altered C1 domains and are not DAG sensitive, and regulation occurs in part through the NH2-terminal PB1 domain (16). Although the PKC family is involved in a wide range of cancer-associated signaling pathways and has been implicated in cancer (17, 18), the genomic alteration, expression, as well as physical/pathologic function of each PKC family isoenzyme in human cancer, including ovarian carcinoma, are still unclear. In this study, we used an integrated genomic approach to study the profile of most known isoenzymes of PKC family in human ovarian cancer and found that PKC may serve as an oncogene and a biomarker of aggressive disease in ovarian cancer.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Cell lines and cell culture. A total of 18 ovarian cell lines were used in this study (19, 20). All cancer cell lines were cultured in DMEM (Invitrogen, Carlsbad, CA) supplemented with 10% fetal bovine serum (FBS; Invitrogen). Human ovarian surface epithelium (HOSE) cells were isolated by our laboratory (21) or provided by Dr. Michael J. Birrer [National Cancer Institute (NCI), Bethesda, MD; ref. 22]. Four immortalized HOSEs [IOSE398 (provided by Dr. Nelly Auersperg, University of British Columbia, Vancouver, British Columbia, Canada; ref. 23), ITOSE4, ITOSE6 (22), and HOSE6-14 (24)] were cultured in Medium 199:MCDB 105 (1:1; Sigma, St. Louis, MO) supplemented with 15% FBS. Nontransformed murine ovarian surface epithelial (MOSE, p11) cells were culture as described previously (25).
DNA isolation and array comparative genomic hybridization. Genomic DNA was isolated from frozen tumors or cultured cells by overnight digestion, phenol-chloroform extraction, and ethanol precipitation. Bacterial artificial chromosome (BAC) clones were cultured in YT broth containing 12.5 µg/mL chloramphenicol. BAC DNA was extracted using 96-well blocks (REAL Prep kits, Qiagen, Valencia, CA). DNA was then amplified by degenerate oligonucleotide primer-PCR and resuspended to a final concentration of 10 to 15 µg/mL. Arrays were printed on Corning CMT Ultra-Gap slides (Corning, Corning, NY). A minimum of two replicates per clone was printed on each slide. Tumor DNA (1 µg) and reference DNA (1 µg) were labeled with Cy3 or Cy5, respectively (Amersham, Piscataway, NJ) using the BioPrime random-primed labeling kit (Invitrogen). The tumor DNA and reference DNA were labeled with the opposite dye as well to account for difference in dye incorporation and provide additional data for analysis. Labeled tumor and reference DNAs were combined and precipitated with human Cot-1 DNA to reduce nonspecific binding. DNA was resuspended and applied to arrays. Arrays were hybridized for 72 hours at 37°C on a rotating platform. Images were scanned with an Affymetrix 428 Microarray Scanner (Affymetrix, Santa Clara, CA) and analyzed with GenePix software (Axon, Union City, CA). The Cy3/Cy5 (tumor/reference DNA) fluorescent intensity ratio >1.2 or <1.2 was considered as alteration (Fig. 1B ). Analysis of array-based comparative genomic hybridization (aCGH) data and determination of amplifications and losses were done using the software suite CGHAnalyzer (Fig. 1B; ref. 26).
|
, 5'-CCATGATCTCCCTGCG (forward) and 5'-CCCCGATAATCCCACA (reverse); TBP, 5'-GAAGACGACGTAATGGC (forward) and 5'-ATAGCAGCACGGTATG (reverse); PKC, 5'-ACTTCTTCTGGGCTACACTATCTAAC-[FITC] (probe1) and 5'-[LC640]-CTGGCTGTTGAGGTGACTAC (probe2); and TBP, 5'-GAAGATGGATGTTGAGTTGCAGGG-[FITC] (probe1) and 5'-[LC705]-TGGCACCAGGTGATGCC (probe2).
Total RNA isolation and quantitative real-time reverse transcription-PCR. Total RNA was isolated from 100 to 500 mg frozen tissue or 1 x 106 cultured cells with Trizol reagent (Invitrogen). After treatment with RNase-free DNase (Invitrogen), total RNA was reverse transcribed using SuperScript First-Strand Synthesis kit for reverse transcription-PCR (RT-PCR; Invitrogen) under conditions defined by the supplier. cDNA was quantified by real-time PCR on the ABI Prism 7900 Sequence Detection System (Applied Biosystems, Foster City, CA). PKC forward primer, GGACTCTGAAGGCCACATTAAAC, and reverse primer, CCACAGAAAGTGCTGGTTGTATC. PCR was done using SYBR Green PCR Core reagents (Applied Biosystems) according to the manufacturer's instructions. PCR amplification of the housekeeping genes glyceraldehyde-3-phosphate dehydrogenase was done for each sample as control for sample loading and to allow normalization among samples. A standard curve was constructed with pCRII-TOPO cloning vector (Invitrogen) containing the same inserted fragment and amplified by the real-time PCR.
Microarray data retrieval and bioinformatic analysis. The public expression microarray data was retrieved from the authors' Web site and further analyzed using the web-based microarray analysis software, Oncomine (http://www.oncomine.org/main/index.jsp; ref. 27) and SOURCE (http://genome-www5.stanford.edu/cgi-bin/source/sourceSearch; ref. 28).
Tissue microarray. The tissue microarray was provided by Dr. Butzow (University of Helsinki, Helsinki, Finland), and constructed as described previously (29, 30). In brief, tumors were embedded in paraffin, and 5-µm sections stained with H&E were obtained to select representative areas for biopsies. Four core tissue biopsies were obtained from each specimen. The presence of tumor tissue on the arrayed samples was verified on H&E-stained section.
Immunohistochemistry and image analysis. Immunohistochemistry was done using the Vectastain avidin-biotin complex method kit as described by the manufacturer (Vector, Burlingame, CA). Primary antibody, mouse anti-human PKC (1:200 for frozen section and 1:50 for paraffin section; BD PharMingen, San Jose, CA), was incubated on sample sections for 2 hours at room temperature or 4°C overnight. The immunoreaction was visualized with 3,3'-diaminobenzidine (Vector). Staining was quantitated by image analysis. Images were collected through CoolSNAP-Pro Color digital camera (Media Cybernetics, Silver Spring, MD), and staining index was analyzed using Image-Pro Plus 4.1 software (Media Cybernetics).
Plasmid transfection. Human PKC was cloned from ovarian cancer cell lines by TOPO Cloning kit (Invitrogen), and cDNA sequence was further confirmed without mutation. Cells were seeded in six-well plates at 3 x 105 per well and grown overnight to 
40% confluence before transfection. All plasmids were transfected with Fugene 6 transfection reagent (Roche, Indianapolis, IN) following the manufacturer's instructions. To select neomycin-resistant cells, 400 µg/mL neomycin (Invitrogen) was applied. All transfection experiments were done in triplicate and repeated at least twice with different DNA isolates.
RNA interference/transfection of synthetic small interfering RNA. Synthetic SMARTpool small interfering RNA (siRNA) targeting human PKC (Dharmacon, Chicago, IL) or appropriate siCONTROL nontargeting siRNAs (Dharmacon) were transfected into cultured cells as described before (31). Transfection was done using LipofectAMINE 2000 (Invitrogen) following the manufacturer's instructions. Ovarian cancer cell lines were cultured in 24-well plate in antibiotics-free 10% FBS plus medium. On 70% to 80% confluency, transfection of siRNAs at 100 nmol/L was done. Triplicate transfection was done for each experiment group, and the experiment was repeated at least twice. Forty-eight hours after transfection, total RNA and protein were extracted to confirm decreased PKC expression by real-time RT-PCR and Western blot, respectively. For soft agar assay, cells were cultured in six-well plates in antibiotics-free medium supplied with 10% FBS, and transfection was done on 90% confluency.
Protein isolation and Western blot. Cultured cells were lysed in 200 µL lysis buffer containing 50 mmol/L Tris-HCl (pH 7.4), 150 mmol/L NaCl, and 1% Triton X-100. Protein was separated by 7% SDS-PAGE under denaturing conditions and transferred to nitrocellulose membrane. Membranes were incubated with an anti-PKC monoclonal antibody (1:1,000; BD PharMingen) followed by incubation in rabbit anti-mouse secondary antibody conjugated with horseradish peroxidase (1:5,000; Sigma). Immunoreactive proteins were visualized using enhanced chemiluminescence detection system (Amersham).
In vitro cell transformation assay. Soft agar assay was done using Cell Transformation Detection Assay kit (Chemicon, Temecula, CA) following the manufacturer's instructions.
Apoptosis assays. Annexin V staining was detected by flow cytometry using an apoptosis detection kit (R&D Systems, Minneapolis, MN). Both floating and adherent cells were collected, washed with PBS, and resuspended in binding buffer containing 10 mmol/L HEPES (pH 7.4), 140 mmol/L NaCl, and 2.5 mmol/L CaCl2. After 15-minute incubation with Annexin V-biotin at room temperature, cells were resuspended and incubated in binding buffer containing 4 µg/mL streptavidin Red 670 (Invitrogen) for 15 minutes. The fluorescence emitted by cells was analyzed using a FACScan flow cytometer (Becton Dickinson, Franklin Lakes, NJ).
Statistics. Statistical analysis was done using the Statistical Package for the Social Sciences software (SPSS, Chicago, IL). All results were expressed as mean ± SD, and P < 0.05 was used for significance.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1 Mb) aCGH (32) was used in this study. The genomic loci of nine known human PKC family genes were identified at the University of California at Santa Cruz Genome Bioinformatics Site (http://genome.ucsc.edu/). We analyzed a total of 107 specimens, including 89 late-stage primary tumors and 18 cell lines. DNA copy number alterations observed in >15% tumors were considered significant change. We found five of nine PKC family members with significant DNA copy number gains and none with significant DNA copy number losses (Fig. 1A and B; Supplementary Table S1). Among the five amplified members, PKC was the most frequently observed with gains in 43.8% (39 in 89) of primary tumors. In addition, DNA copy number gains of PKCß1, PKC, PKC, and PKC were detected in 37.1%, 27.6%, 22.5%, and 21.3% of primary tumors, respectively. In established ovarian cancer cell lines, similar results were observed [e.g., PKC gained DNA copy number in 44.4% (8 of 18) cell lines (Fig. 2C
)]. These results indicated that select PKC family members exhibited increased gene copy numbers in ovarian cancer.
|
and PKC were significantly up-regulated in ovarian cancer compared with normal ovary (both P < 0.0001; Fig. 1C). Second, the mRNA expression of PKC family was compared in ovarian carcinoma (n = 27) and other cancer types (n = 147) based on Su et al. (34) data set. Two PKC gene family members were expressed at significantly different levels between ovarian and other cancer types, in which PKC was markedly overexpressed and PKC was markedly underexpressed in ovarian carcinoma but not in other cancer types (Fig. 1C). Finally, we studied the mRNA expression of PKC family within different ovarian carcinoma grades (grade 1, n = 20; grade 2, n = 60) and stages (stages I and II, n = 36; stages III and IV, n = 74) based on Schwartz et al. (35) data set. PKC expression was significantly increased in both late-stage and high-grade ovarian cancer, whereas PKC expression was decreased (Fig. 1C). In summary, this expression profile data suggested that PKC might be a potential biomarker for ovarian cancer because its mRNA expression was increased in ovarian carcinoma compared with normal ovary and in late-stage or high-grade cancer compared with early-phase cancer. Also interestingly, PKC was most highly expressed in ovarian cancer, although high expression was also found in some lung and prostate cancers (Fig. 1C and D).
Up-regulation of PKC mRNA in human ovarian cancer. The aCGH result was validated by real-time PCR in 73 ovarian cancer patients (P < 0.001; Fig. 2A). The correlation between PKC DNA copy number amplification and its mRNA expression was then further confirmed in 33 ovarian cancer patients (P = 0.003; Fig. 2B). Finally, we analyzed the correlation between DNA copy number amplification and mRNA expression in 18 established ovarian cancer cell lines. We found that in 8 of 18 cell lines with PKC DNA copy number gains, PKC mRNA expression level was markedly higher than in cell lines with normal DNA copy number (Fig. 2C). This suggested that the alteration in PKC DNA copy number may affect its mRNA expression in human cancer.
We also examined PKC mRNA expression in human ovarian cancer cell lines and frozen specimens by real-time RT-PCR. First, we quantified PKC mRNA expression in 6 HOSE cell lines and 18 established human ovarian cancer cell lines. We found significantly up-regulated PKC mRNA expression in established cancer cell lines compared with HOSEs (P = 0.031; Fig. 2D). Second, we analyzed PKC mRNA expression in 54 ovarian cancer specimens and found that its mRNA expression level was significantly higher in late-stage tumors (n = 34) than in early-stage tumors (n = 20; P = 0.028; Fig. 2E). These results further confirmed that PKC was overexpressed in ovarian cancer and increased in late-stage disease, which validated the results from retrieved expression microarray data.
Overexpression of PKC protein in human ovarian cancer. We analyzed PKC protein expression in normal human ovary, early OSE malignant transformation, as well as ovarian carcinoma by immunohistochemistry. In normal human ovary, PKC was not detectable in the stroma or follicles (Fig. 3A and B
). Very weak PKC staining could be detected both in the epithelium of normal ovary and in morphologically normal OSE cells adjacent to early malignant transformation sites (Fig. 3C and D). Importantly, PKC staining was only located at the apical side and was absent from the basal membrane of OSE (Fig. 3D). However, strong up-regulation of PKC expression was found in adjacent transformed OSE cells, where the above-mentioned polarity of expression pattern was missing (Fig. 3C and E). This result agreed with recent findings in both Drosophila and human ovarian cancer by Eder et al. (36). Strong PKC expression was found in both primary and metastatic ovarian cancer without polarized localization (Fig. 3F and G). We examined a tissue array containing a large ovarian cancer collection. We observed that strong, medium, and weak PKC staining in 39%, 39%, and 18% of specimens, respectively. PKC protein expression, as detected by immunohistochemistry, was missing in only 4% ovarian cancer (Fig. 3H). Finally, we confirmed the immunohistochemical results by Western blot in 3 HOSE cell lines and 13 ovarian cancer cell lines (Fig. 3I). In agreement with the immunohistochemical results, PKC expression was weak in all three HOSE lines but strong in all established ovarian cancer cell lines.
|
expression does not directly affect cell proliferation in vitro. In Drosophila, forced expression of PKC dramatically increased cell proliferation (36). In human ovarian cancer, high PKC expression was positively correlated with the proliferation marker Ki-67 in vivo (36). In addition, increased PKC protein level was associated with increased cyclin E expression (36). Therefore, we tested the effect of PKC expression on cell proliferation in vitro. First, we selected the ovarian cancer cell line A1847, which exhibited normal PKC DNA copy number and expressed PKC mRNA and protein at relatively low levels. Human PKC was stably transfected into A1847 cell line, and forced overexpression of PKC protein was confirmed by Western blot (Fig. 4A
). Overexpression of PKC was not found to affect directly cell proliferation or apoptosis (Fig. 4B and C). To rule out the possibility that the phenotype resulting from forced expression of PKC may have been confounded by already expressed PKC in this cell line, we selected two other ovarian cancer cell lines, one with PKC DNA copy number amplification (2008) and the other with normal copy number (OVCAR10), and tested the effect induced by decreased PKC expression. Using siRNA, we specifically knocked down PKC expression (Fig. 4D). No significant difference was observed in either proliferation or apoptosis between control and PKC-siRNA-transfected lines (Fig. 4E and F). In addition, we analyzed the correlation of PKC expression with the doubling time in 14 ovarian cancer cell lines. In agreement with above data, no significant correlation was found (Fig. 4G). Finally, we tested culture conditions with different serum concentrations (10%, 5%, 0.5%, and 0%). Forced expression or knockdown of PKC did not directly affect ovarian cancer cell proliferation in vitro under these conditions. These data agree with findings in colon and lung cancer cell lines that expression of exogenous PKC or negative dominant PKC caused no change in cell proliferation in vitro (37, 38). Because both Drosophila and human ovarian cancer data (36) were observed in vivo, it is possible that the effect of PKC on cell proliferation is not a direct function but rather dependent on in vivo growth requirements in cancer.
|
contributes to ovarian epithelium transformation and cooperates with mutant Ras. We tested the role of PKC in anchorage-independent growth of 2008 ovarian cancer cell line in soft agar. PKC was overexpressed by transfection with a hPKC expression plasmid or decreased by specific siRNA transfection. We found that increased PKC expression slightly increased the colony number, whereas decreased expression significantly reduced colony number (Fig. 5A
). Next, we tested the function of PKC in OSE transformation and its cooperation with Ras by soft agar assay. Nontransformed primary MOSE was transfected with PKC, mutant Ras, or PKC plus mutant Ras. Similar to the results from colon and lung epithelium (37–39), PKC overexpression alone was not sufficient to transform OSE in vivo. However, when coexpressed with mutant Ras, PKC could increase the colony number significantly (Fig. 5B and C). Most interestingly, we found that coexpression of PKC with mutant Ras could not only increase the colony number, but also markedly increase colony size (e.g., >10% colonies in the coexpression group were 5- to 8-fold larger than those in the group transfected with mutant Ras alone). These results indicate that PKC plays critical roles in OSE transformation when cooperating with other oncogenic events, such as Ras mutation.
|
does not affect ovarian cancer cell response to chemotherapy. It was reported that PKC protects human leukemia cells against drug-induced apoptosis (40, 41). To test the role of PKC in ovarian cancer chemotherapy, 14 ovarian cancer cell lines with detailed chemotherapy response information (19) were used in this study. The PKC mRNA of those 14 ovarian cancer lines was analyzed by real-time RT-PCR. No significant correlation was found between PKC expression and chemotherapy resistance (IC50) to cisplatin, carboplatin, oxaliplatin, and AMD473 as characterized previously by Roberts et al. (Fig. 6A
; ref. 19). Next, we tested a set of ovarian cancer cell lines with different sensitivities to cisplatin (42). There was no significant correlation between resistance to cisplatin and PKC expression (Fig. 6E). Finally, we compared the sensitivity with cisplatin of wild-type (WT) A1847 and A1847 cells transfected with PKC. Cisplatin treatment at 5-fold of IC50 induced similar amount of apoptosis in WT and transfected cells after 24 hours. In conclusion, PKC overexpression did not seem to affect ovarian cancer cell response to chemotherapy.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and PKC, exhibited significantly up-regulated mRNA expression in ovarian carcinoma compared with normal ovary. Importantly, the DNA copy number of both these PKC genes was frequently amplified in ovarian cancer. Genomic amplification correlated with increased mRNA expression of PKC. Therefore, it is likely that the DNA copy number amplification contributes to overexpression of PKC genes in ovarian cancer. Most interestingly, PKC mRNA expression was significantly increased with advanced clinical stage and grade. In addition, PKC was most highly expressed in ovarian carcinoma among human solid tumors, although higher expression of PKC was also found in some lung and prostate cancers. Taken together, these results suggest that PKC is a biomarker for aggressive disease in ovarian carcinoma.
Importantly, two other independent groups reported recently that PKC serves critical functions in human ovarian (36) and lung cancers (38, 39). Eder et al. (36) showed that increased PKC DNA copy number was associated with decreased progression-free survival in ovarian cancer, whereas high expression of PKC increased cyclin E expression and proliferation in vivo. Regala et al. (38, 39) found that PKC was amplified in lung cancer, and overexpression of PKC was required for transformation of lung cancer cells that harbor PKC gene amplification. Taken together with our findings, these data confirm that our integrated genomic approach could successfully identify novel oncogenic member(s) from the PKC family and indicate that PKC is a potential oncogene in human cancer.
The precise mechanism of oncogenic transformation by PKC in human cancer is still largely unknown. Eder et al. (36) shown that, in Drosophila, forced expression of PKC dramatically increased cell proliferation. In human ovarian cancer, high PKC expression was positively correlated with the proliferation marker Ki-67 (36). Our results suggest that overexpressed PKC did not directly affect ovarian cancer cell proliferation in vitro as also confirmed by specific knockdown of PKC expression by siRNAs. Similar studies in colon (37) and lung (38) cancers are consistent with these results in ovarian cancer. Because the positive correlation between PKC and cell proliferation in Drosophila and ovarian cancer were observed in vivo (36), it is possible that the effect of PKC on cell proliferation is not a direct function but rather dependent on in vivo growth requirements in cancer. Eder et al. (36) reported that PKC overexpression is associated with mislocalization of its protein product and loss of apical-basal polarity in ovarian cancer. Our results of apical localization in normal OSE and mislocalization in adjacent transformed OSE agree with these observations.
In both lung (38, 39) and colon (37) cancer, PKC was shown to contribute to malignant transformation, which required Ras cooperation (37). Our data also show that, in ovarian cancer, PKC can cooperate with mutant Ras to transform MOSE in vitro. Interestingly, we also found the cooperation of PKC and mutant Ras caused significantly larger colonies than Ras alone. This suggests that PKC promotes anchorage-independent growth during Ras-induced transformation. aPKC has been implicated in Ras-mediated signaling pathway (37, 43–45). Murray et al. (37) showed that PKC is a critical downstream effector of oncogenic Ras in colonic epithelium transformation. Blocking of PKC function in Ras-transformed epithelium inhibits the oncogenic Ras-mediated activation of Rac1, cellular invasion, and anchorage-independent growth (37). In addition, most recently work showed that the location and function of K-Ras were directly regulated by PKC (46). Phosphorylation by PKC of S181 within polybasic region promoted rapid dissociation of K-Ras from plasma membrane and association without membrane of mitochondria, where phosphorylated K-Ras interacts with Bcl-xL (46). Finally, overexpression of PKC might affect other genes/pathways, such as cyclin D1 (45), which interact and/or enhance Ras-mediated transformation.
Finally, PKC may play a prerequisite role in Bcr-Abl-mediated resistance to chemotherapy-induced apoptosis in leukemia (40, 41). Our data indicate that PKC does not affect chemotherapy resistance in ovarian carcinoma. Future work is needed to understand how PKC functions in human cancer with regard to cancer type, tissue and cellular context, as well as downstream effectors.
|
Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Drs. Steven Johnson and Kang-Shen Yao (University of Pennsylvania) for the human ovarian cancer cells, Dr. Michael J. Birrer (NCI) for HOSEs, and Dr. Nelly Auersperg (University of British Columbia) for HOSEs and access to the Canadian Ovarian Tissue Bank.
|
Footnotes |
|---|
L. Zhang and J. Huang contributed equally to this work. B.L. Weber is currently at the Translational Medicine and Genetics at GlaxoSmithKline, King of Prussia, PA 19406.
Received 12/20/05. Revised 2/21/06. Accepted 3/ 2/06.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
promotes angiogenesis via vascular endothelial growth factor in ovarian carcinoma. Cancer Res 2003;63:4225–31. contributes to poor prognosis through loss of apical-basal polarity and cyclin E overexpression in ovarian cancer. Proc Natl Acad Sci U S A 2005;102:12519–24. is required for Ras transformation and colon carcinogenesis in vivo. J Cell Biol 2004;164:797–802. plays a critical role in human lung cancer cell growth and tumorigenicity. J Biol Chem 2005;280:31109–15. is an oncogene in human non-small cell lung cancer. Cancer Res 2005;65:8905–11. protects human leukemia cells against drug-induced apoptosis. J Biol Chem 1997;272:27521–4. activity is necessary for Bcr-Abl-mediated resistance to drug-induced apoptosis. J Biol Chem 1999;274:3927–30. and atypical protein kinase C- participate in Ras-mediated reorganization of the F-actin cytoskeleton. J Cell Biol 1999;144:413–25. and - associate with the GTP-binding protein Cdc42 and mediate stress fiber loss. Mol Cell Biol 2000;20:2880–9.This article has been cited by other articles:
|
|
 |
|
  H. Ishiguro, K. Akimoto, Y. Nagashima, Y. Kojima, T. Sasaki, Y. Ishiguro-Imagawa, N. Nakaigawa, S. Ohno, Y. Kubota, and H. Uemura aPKC{lambda}/{iota} promotes growth of prostate cancer cells in an autocrine manner through transcriptional activation of interleukin-6 PNAS, September 22, 2009; 106(38): 16369 - 16374. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. P. Regala, E. A. Thompson, and A. P. Fields Atypical Protein Kinase C{iota} Expression and Aurothiomalate Sensitivity in Human Lung Cancer Cells Cancer Res., July 15, 2008; 68(14): 5888 - 5895. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Lee and V. Vasioukhin Cell polarity and cancer - cell and tissue polarity as a non-canonical tumor suppressor J. Cell Sci., April 15, 2008; 121(8): 1141 - 1150. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Ghosh, T. Marquardt, J. P. Thaler, N. Carter, S. E. Andrews, S. L. Pfaff, and T. Hunter Instructive role of aPKC{zeta} subcellular localization in the assembly of adherens junctions in neural progenitors PNAS, January 8, 2008; 105(1): 335 - 340. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Zhang, J. Huang, N. Yang, J. Greshock, S. Liang, K. Hasegawa, A. Giannakakis, N. Poulos, A. O'Brien-Jenkins, D. Katsaros, et al. Integrative Genomic Analysis of Phosphatidylinositol 3'-Kinase Family Identifies PIK3R3 as a Potential Therapeutic Target in Epithelial Ovarian Cancer Clin. Cancer Res., September 15, 2007; 13(18): 5314 - 5321. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Nazarenko, R. Schafer, and C. Sers Mechanisms of the HRSL3 tumor suppressor function in ovarian carcinoma cells J. Cell Sci., April 15, 2007; 120(8): 1393 - 1404. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Nanjundan, Y. Nakayama, K. W. Cheng, J. Lahad, J. Liu, K. Lu, W.-L. Kuo, K. Smith-McCune, D. Fishman, J. W. Gray, et al. Amplification of MDS1/EVI1 and EVI1, Located in the 3q26.2 Amplicon, Is Associated with Favorable Patient Prognosis in Ovarian Cancer Cancer Res., April 1, 2007; 67(7): 3074 - 3084. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. S. Linsley, J. Schelter, J. Burchard, M. Kibukawa, M. M. Martin, S. R. Bartz, J. M. Johnson, J. M. Cummins, C. K. Raymond, H. Dai, et al. Transcripts Targeted by the MicroRNA-16 Family Cooperatively Regulate Cell Cycle Progression Mol. Cell. Biol., March 15, 2007; 27(6): 2240 - 2252. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Pu, M. L. Peach, S. H. Garfield, S. Wincovitch, V. E. Marquez, and P. M. Blumberg Effects on Ligand Interaction and Membrane Translocation of the Positively Charged Arginine Residues Situated along the C1 Domain Binding Cleft in the Atypical Protein Kinase C Isoforms J. Biol. Chem., November 3, 2006; 281(44): 33773 - 33788. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Erdogan, T. Lamark, M. Stallings-Mann, Lee Jamieson, M. Pellechia, E. A. Thompson, T. Johansen, and A. P. Fields Aurothiomalate Inhibits Transformed Growth by Targeting the PB1 Domain of Protein Kinase C{iota} J. Biol. Chem., September 22, 2006; 281(38): 28450 - 28459. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
