Cancer Research Meeting Calendar Sign up for Cancer Research eTOC's
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Koenig, A.
Right arrow Articles by Menke, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Koenig, A.
Right arrow Articles by Menke, A.
[Cancer Research 66, 4662-4671, May 1, 2006]
© 2006 American Association for Cancer Research

Cell, Tumor, and Stem Cell Biology

Collagen Type I Induces Disruption of E-Cadherin–Mediated Cell-Cell Contacts and Promotes Proliferation of Pancreatic Carcinoma Cells

Alexander Koenig1, Claudia Mueller1, Cornelia Hasel2, Guido Adler1 and Andre Menke1

Departments of 1 Internal Medicine I and 2 Pathology, University of Ulm, Ulm, Germany

Requests for reprints: Andre Menke, Department of Internal Medicine I, University of Ulm, D-89070 Ulm, Germany. Phone: 49-731-500-33705; Fax: 49-731-500-33717; E-mail: andre.menke{at}uni-ulm.de.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Pancreatic cancer is characterized by its invasiveness, early metastasis, and the production of large amounts of extracellular matrix (ECM). We analyzed the influence of type I collagen and fibronectin on the regulation of cellular adhesion in pancreatic cancer cell lines to characterize the role of ECM proteins in the development of pancreatic cancer. We show that collagen type I is able to initiate a disruption of the E-cadherin adhesion complex in pancreatic carcinoma cells. This is due to the increased tyrosine phosphorylation of the complex protein ß-catenin, which correlates with collagen type I–dependent activation of the focal adhesion kinase and its association with the E-cadherin complex. The activation and recruitment of focal adhesion kinase to the E-cadherin complex depends on the interaction of type I collagen with ß1-containing integrins and an integrin-mediated activation of the cellular kinase Src. The disassembly of the E-cadherin adhesion complex correlates with the nuclear translocation of ß-catenin, which leads to an increasing expression of the ß-catenin-Lef/Tcf target genes, cyclin D1 and c-myc. In addition to that, cells grown on collagen type I show enhanced cell proliferation. We show that components of the ECM, produced by the tumor, contribute to invasiveness and metastasis by reducing E-cadherin–mediated cell-cell adhesion and enhance proliferation in pancreatic tumor cells. (Cancer Res 2006; 66(9): 4662-71)


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Epithelial tissue formation depends on the presence of adherens junctions. These are composed of the transmembrane glycoprotein E-cadherin and different members of the catenin family (1). Inside the cell, E-cadherin is anchored to the actin cytoskeleton via the E-cadherin–binding ß-catenin and {alpha}-catenin (1). The dynamic regulation of the E-cadherin complex assembly and its association with the cytoskeleton is essential in many cellular functions such as differentiation, proliferation, or migration (1). In malignant diseases, a complete loss of this adhesion module represents an important step in tumor progression and metastasis (2). However, a complete loss of E-cadherin caused by a deletion in the E-cadherin gene is found only in a subset of carcinomas. There is increasing evidence that alterations in the stability of the E-cadherin complex in malignant diseases contribute to a functional loss of cell-cell adhesion (3, 4). Enhanced phosphorylation of distinct complex proteins, such as ß-catenin, has been shown to play a crucial role in the regulation of E-cadherin complex assembly, and it has been shown in several epithelial tumors (5, 6). Increased phosphorylation of ß-catenin is associated with the activation of different kinases such as Src (7, 8) or Fer (9) and the inhibition of different phosphatases such as SHPTP2 (10), PTEN (11), or LAR (12).

Besides the function of ß-catenin as an integral component of the cadherin adhesion complex, it is a crucial mediator in the canonical Wnt signaling pathway (13). Interaction of Wnt with its receptor frizzled leads, via disheveled, to an inactivation of the glycogen synthetase kinase 3ß (GSK-3ß). Inactivated GSK-3ß is no longer able to promote the degradation of cytoplasmic ß-catenin. Stabilized cytoplasmic ß-catenin translocates inside the nucleus and cooperates with transcription factors of the Lef/Tcf-family (13). After interaction with Lef/Tcf transcription factors, ß-catenin-Lef/TCF regulates different target genes such as cyclin D1 (14), c-myc (15), or fibronectin (16), which control proliferation and cellular invasion. ß-Catenin-Lef/Tcf–activated gene expression has been described in various malignancies such as colorectal cancer, hepatocellular carcinoma, or malignant melanoma (17, 18).

Compared with other gastrointestinal tumors, pancreatic cancer is characterized by early invasiveness and metastasis (19). Pancreatic cancer also differs from other epithelial tumors by the production of large amounts of extracellular matrix proteins (ECM; refs. 20, 21). Collagen type I and type III are extensively produced by pancreatic cancer and surrounding stroma cells but not by normal pancreatic tissue (20, 21). Whether these ECM proteins directly contribute to invasiveness or if they reflect a defense mechanism of the organism to prevent tumor cell invasion is still questionable. There is some evidence that the ECM can promote tumor progression. We have previously shown that different components of the ECM, such as collagen type I and type III, contribute to a decreased expression of E-cadherin followed by an increased migration of pancreatic carcinoma cells (4). The importance of ECM proteins in tumor progression was underlined by the work of Brabletz and colleagues, which described a ß-catenin–dependent tumor progression with increased proliferation and invasiveness into the surrounding stroma in colorectal cancer, specifically at the tumor invasion front (22).

The focal adhesion kinase (FAK) represents a key player in the regulation of cell matrix interaction and in the formation of focal contacts. FAK, a non–receptor tyrosine kinase of 119 kDa, is able to promote different signaling pathways resulting in increased cellular motility and invasiveness, as well as decreased cellular adhesion (23). It is activated, among others, by integrin-induced Src activity and initiates different signaling effects such as activation of extracellular signal-regulated kinase (24), activation of the p130/Crk/DOCK1 cascade (25), or preventing cells from apoptosis (26).

Here, we show the capability of type I collagen to induce an activation of the tyrosine kinase FAK and recruitment to the E-cadherin/catenin complex leading to enhanced ß-catenin phosphorylation in pancreatic cancer cells. As a consequence, the membranous E-cadherin complex is dissociated. This dissociation is correlated with nuclear translocation of ß-catenin which cooperates with Lef/Tcf transcription factors to enhance the expression of the c-myc and cyclin D1 genes and increased proliferation of pancreatic cancer cells.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Antibodies and vectors. Monoclonal antibodies against {alpha}-catenin (610193), ß-catenin (610153), E-cadherin (610181), and FAK (610087) were purchased from BD Transduction Laboratories (Lexington, KY). An antibody against ß-actin (A-5441) was obtained from Sigma-Aldrich (Taufkirchen, Germany), anti-Src (05-184) from Upstate (Lake Placid, NY), anti-GFP (600-301-215) from Rockland Immunochemicals (Gilbertsville, PA), anti-lamin B (IMG-5133A) from Imgenex (San Diego, CA), and anti-ß1 integrin (MAB1965) from Chemicon (Temecula, CA). A polyclonal antiserum against ß-catenin (C-7207) was purchased from Sigma-Aldrich. Phosphospecific antibodies were used as follows: anti-phospho-FAK Tyr576 (44-652) and Tyr397 (44-656) from BioSource International (Camarillo, CA), anti-phospho-Src Tyr416 (2101) from Cell Signaling Technology (Beverly, MA), anti-phosphotyrosine-specific PY20 antibody (610011) from BD Transduction Laboratories. Cy3-coupled anti-mouse antiserum (111-166-045) was purchased from Rockland Immunochemicals, Alexa 488-coupled anti-rabbit antiserum (A11008) from Molecular Probes (Eugene, OR), and horseradish peroxidase–coupled anti-mouse or anti-rabbit antisera from Pierce (Rockford, IL). The coding sequence of FAK-related non-kinase (FRNK) was kindly provided by Dr. G.v. Wichert (University of Ulm, Germany), isolated by PCR and cloned via EcoRI into the pEGFP C1 vector (BD Clonetech, Heidelberg, Germany). ß-Catenin cDNA was kindly provided by Dr. D. Wedlich (University of Karlsruhe, Germany) subcloned into Topo blunt vector (Invitrogen, Breda, the Netherlands) by PCR and transferred into pEGFP C1 expression vector (BD Clonetech) using the BamH1 restriction site. The expression plasmid encoding an E-cadherin-{alpha}-catenin fusion protein was kindly provided by Dr. A. Nagafuchi (Kumamoto University, Japan). Correct orientation and all reading frames were confirmed by sequencing (GATC Biotech, Konstanz, Germany) and Western blot analyses of expressed proteins.

Cell culture. The pancreatic adenocarcinoma cell lines, Panc-1 and BxPC-3, (American Type Culture Collection, Rockville, MD; CRL-1469 and CRL-1687) were maintained in DMEM complemented with 10% FCS, 1% nonessential amino acids, and 1% L-glutamine (Invitrogen, Karlsruhe, Germany). For analysis of substrate-dependent differences, 1 x 106 cells were cultured in dishes (100 mm diameter) coated with type I collagen (human, 5 µg/cm2), fibronectin (human, 2 µg/cm2), or on tissue culture plastic (TCP; Becton Dickinson, Heidelberg, Germany). The seeding efficiency was 90% or more on all substrates estimated after 12 hours. Cells were cultured until they formed a confluent monolayer for at least 72 hours. The influence of ß1-containing integrins and Src on FAK phosphorylation was analyzed by the incubation of Panc-1 cells with pepsin-treated soluble type I collagen (10 µg/mL, Chemicon) for 12 hours, and with 20 µg/mL of an anti-ß1 integrin antibody for 12 hours or by incubation with the Src-specific inhibitor SU6656 (Calbiochem, San Diego, CA) for 3 hours. Experiments with different concentrations of SU6656 revealed that 0.5 µmol/L exhibited a sufficient reduction of Src activity in Panc-1 cells as measured using an enolase phosphorylation assay as described in ref. (4).

Transient transfection of Panc-1 cells cultured on the indicated substrates was done using DMRIE-C (Invitrogen, Karlsruhe, Germany) as transfection reagent at 70% of cell confluence according to the manufacturer's instructions.

Western blotting and immunoprecipitation. Protein analyses were done as previously described by Seidel et al. (27). Briefly, confluent grown cells were lysed with radioimmunoprecipitation assay buffer [1% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS, 150 mmol/L NaCl, 50 mmol/L Tris/HCl (pH 7.2), 10 mmol/L EDTA, 10 mmol/L EGTA] or for coimmunoprecipitation analyses with immunoprecipitation buffer [10 mmol/L Tris/HCl (pH 7.4), 150 mmol/L NaCl, 1% Triton X-100, 1% Nonidet P-40]. Both buffers contained 400 µmol/L aprotinin, 50 µmol/L leupeptin, and 0.5 mmol/L Pefabloc (Roche Diagnostics, Mannheim, Germany) to inhibit proteases. Homogenized lysates (500-2,000 µg) were immunoprecipitated with 4 µL of the indicated antibody and protein G-agarose (Roche Diagnostics). The immunoprecipitates were analyzed by SDS-PAGE and incubated with the indicated antibody for 1 hour. Immunoreactive proteins were visualized using enhanced chemiluminescence detection system (Pierce). Nuclear cell fractions were prepared as described by Nicholson et al. (28).

Triton X-100–fractionated cell lysates were prepared as described by Hinck et al. (29) with minor modifications. Cells were rinsed twice with ice-cold PBS and incubated with 400 µL of Triton X-100 buffer per 100 mm dish (0.5% Triton X-100, 0.3 mol/L sucrose, 100 mmol/L NaCl, 3 mmol/L MgCl2, 1 mmol/L Pefabloc, 5 µmol/L aprotinin, and 10 µg/mL leupeptin) for 10 minutes on a rocking platform at 4°C. The cells were harvested with a rubber policeman, 30 µL was removed and homogenized. The remaining lysate was cleared with 10,000 x g for 10 minutes at 4°C. The supernatant containing the Triton X-100–soluble fraction was collected and the remaining pellet was resuspended in 400 µL SDS buffer [1% SDS, 2 mmol/L EDTA, 2 mmol/L EGTA, 20 mmol/L Tris (pH 7.5), 1 mmol/L Pefabloc, 5 µmol/L aprotinin, and 1 µg/mL DNase I], and homogenized using a 25-gauge needle. After centrifugation at 10,000 x g for 10 minutes at 4°C, the supernatant contains a Triton X-100–insoluble fraction. Equal volumes of both fractions corresponding to 15 µg of the Triton X-100–insoluble fraction were analyzed by Western blotting. Densitometric analyses were done using ImageQuant software (Amersham Biosciences, Braunschweig, Germany).

Immunofluorescence microscopy. For protein localization, 2 x 105 cells were seeded on uncoated, type I collagen-, or fibronectin-coated coverslips (Becton Dickinson). After 3 to 5 days of confluence, cultures were fixed with –20°C cold methanol/acetone (1:1) for 10 minutes. Six independent samples from human pancreatic carcinoma and normal pancreas were provided by the Department of Pathology of the University of Ulm in accordance with local ethical regulations. Semi-thin sections of paraffin-embedded samples were incubated with anti-ß-catenin antibody for 1 hour at 37°C. Immunoreactive proteins were visualized with Cy3-coupled anti-mouse- or Alexa 488-coupled anti-rabbit antibody. The staining was examined using a Leica fluorescence microscope (DM TCS4 Leica Microsystems, Wetzlar, Germany) and the Openlab software (Improvision, Inc., Tuebingen, Germany).

Aggregation and proliferation assays. Cell proliferation was quantified by counting mitotic figures or total cell numbers of Panc-1 cells grown on uncoated or coated (fibronectin, type I collagen) coverslips. The cells were fixed at a confluence of 70% with ice-cold methanol/acetone (1:1) and stained with 4,6-diamidino-2-phenylindol (DAPI; 0.1 µg/mL). Mitotic figures were counted from five 120 x 120 µm fields per coverslip from three independent experiments. To verify these data, the total number of Panc-1 cells cultured on different substrates was counted on subsequent days. In 60 mm dishes, 5 x 104 cells were seeded on TCP, type I collagen, or fibronectin in triplicate. On subsequent days, the adherent cells were harvested and resuspended in PBS. The cell number was estimated in a cell counter CASY TTC (Schaerfe System, Reutlingen, Germany) using two different dilutions (30). Cell numbers per 60 mm dish and SD were calculated from three independent experiments. For statistical analysis, Student's t test was used and P < 0.05 was considered significant.

To determine the cell-cell adhesion capacity, cell aggregation was determined as described by Ozawa and Kemler (31). Cells were washed with PBS and carefully detached with 0.01% trypsin in HEPES-buffered saline (37 mmol/L NaCl, 5.4 mmol/L KCl, 0.34 mmol/L NaH2PO4, 5.6 mmol/L glucose, and 10 mmol/L HEPES) containing 2 mmol/L CaCl2, centrifuged, washed twice with HEPES buffer with 2 mmol/L CaCl2 and resuspended in the same buffer. Cells were allowed to re-aggregate by incubation with constant rotation of 70 rpm for 30 minutes. The number of aggregates was determined in an invert phase-contrast microscope (at a 10x magnification; Zeiss, Oberkochen, Germany). The extent of cell aggregation was calculated by the formula A = (No-Ne) / No, with No representing the total particle number at the start and Ne the total particle number after incubation for 30 minutes. To examine the calcium dependency, EDTA and EGTA were added to a final concentration of 5 mmol/L each. Three independent assays were done in duplicate.

Gene reporter assay. Panc-1 cells at 60% confluence were cotransfected with TOPflash or FOPflash promoter construct (Upstate, Charlottesville, VA) and a thymidine kinase promoter-driven renilla-luciferase vector (pRLTK; Promega, Mannheim, Germany). After 36 hours, cells were lysed and processed using the Dual Luciferase Kit (Promega) as described by the manufacturer. Luciferase activity was normalized to renilla firefly activity. The mean values and SD were calculated. For statistical analysis, Student's t test was used and P < 0.05 was considered significant.

RT-PCR studies. RNA was extracted using the RNeasy Mini Kit (Qiagen, Hilden, Germany). To produce complementary DNA, 2 µg of total mRNA was processed with the DuraScript RT-PCR Kit (Sigma-Aldrich). The semiquantitative PCR was done with primers for ß-actin (annealing at 60°C and 18 cycles), cyclin D1 (annealing at 54°C and 35 cycles), and c-myc (annealing at 52°C and 35 cycles; ß-actin: sense, GACTACCTCATGAAGATCCT; antisense, GCGGATGTCCACGTCACACT; cyclin D1: sense, ACGGCCGAGAAGCTGTGCAT; antisense TTCCAATCCGCCCTCCATGG; c-myc: sense, GACTCGGTGCAGCCGTATTTCTACT; antisense, CAGCTGGAGATGGTGACCGA).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Collagen type I induces dissociation of the E-cadherin complex. To study the influence of ECM on the assembly of the E-cadherin/catenin adhesion complex as well as on ß-catenin–dependent signaling in pancreatic cancer, we analyzed the localization of ß-catenin in sections of human pancreatic adenocarcinoma (Fig. 1A ). In tumor areas, membranous ß-catenin staining was markedly reduced, especially in cells localized at the boundary between tumor regions and surrounding ECM (Fig. 1A, right). Additionally, in these areas, a nuclear ß-catenin staining was detected, as indicated by costaining of nuclear DNA (Fig. 1A, arrows). In contrast, in normal pancreatic tissue, ß-catenin staining was strictly located at the plasma membrane without detectable nuclear ß-catenin (Fig. 1A, left).


Figure 1
View larger version (40K):
[in this window]
[in a new window]
  		Figure 1. Collagen type I initiates disassembly of the E-cadherin adhesion complex. A, semi-thin sections of normal human pancreas and pancreatic adenocarcinoma were stained with anti-ß-catenin antibody (visualized with Cy3) and costained with DAPI to localize DNA (bar, 10 µm). B, top, 30 µg of total Panc-1 and BxPC-3 lysate of cells cultured on uncoated TCP, collagen type I or fibronectin for 72 hours was analyzed by immunoblotting. Middle, Western blot analysis of total protein lysate of cells cultured for 72 hours on TCP or for the indicated periods of time (6-96 hours) on type I collagen. E-cadherin amounts were visualized using a specific antibody. To document equal amounts of protein in each lane, the blots were re-stained with an anti-ß-actin antibody. Bottom, Triton X-100–fractionated lysates of Panc-1 and BxPC-3 cells grown on TCP, collagen type I, or fibronectin for 12 hours were analyzed regarding their E-cadherin concentrations. Fifteen micrograms of Triton X-100–insoluble proteins, the corresponding amount of soluble protein and 25 µg of total lysate were analyzed by Western blotting. One representative blot out of three independent experiments is shown in each part. C, 30 µg of total protein lysate of cells cultured on uncoated TCP, collagen type I, or fibronectin for 72 hours were analyzed by immunoblotting. Small numbers below the blots give the densitometric intensity of the bands relative to the signal obtained on TCP. D, Triton X-100 fractionation was done to analyze the association of E-cadherin and catenins with the cytoskeleton in Panc-1 and BxPC-3 cells in response to different substrates. Fifteen micrograms of Triton-insoluble and the corresponding volume of soluble proteins were separated by SDS-PAGE. The amounts of E-cadherin, {alpha}-, and ß-catenin were identified by immunoblotting. Use of equal amounts of protein in each lane was documented by re-staining for ß-actin. Small numbers under the blots give the densitometric intensity of the bands relative to the signal obtained on TCP. One representative blot out of three independent experiments. E, the aggregation capacity of Panc-1 and BxPC-3 cells was measured by rotation aggregation assays (70 rpm) using cells which were grown on different substrates and stimulated with soluble collagen type I or fibronectin during the assay as described in Materials and Methods. An aggregation index was calculated from the particle number. An index of 1 means complete aggregation. F, aggregation assays were done with Panc-1 cells transiently transfected with a vector encoding for an E-cadherin-{alpha}-catenin fusion protein. Columns, mean of representative experiments out of three independent assays; bars, ±SD (E and F).

 
Based on these immunohistochemical data, we used pancreatic cancer cell lines to investigate the influence of different ECM proteins on the assembly of the E-cadherin adhesion complex and its association with the actin cytoskeleton in more detail. Therefore, the pancreatic cancer cell lines, Panc-1 and BxPC-3, were cultured on uncoated (TCP), type I collagen-, or fibronectin-coated culture dishes. In line with previously published results (4), the total amount of E-cadherin was reduced in Panc-1 and BxPC-3 cells (Fig. 1B, top) grown on type I collagen for at least 3 days in contrast to cells grown on TCP or fibronectin. We observed a diminished E-cadherin concentration in Panc-1 and BxPC-3 cells cultured for different periods of times on collagen type I. The reduction started 6 to 24 hours after collagen type I stimulation and reached a maximum after 72 hours (Fig. 1B, middle). Because only E-cadherin, which is linked to the actin cytoskeleton, contributes to strong cellular adhesion (29), we determined the amount of E-cadherin associated with the cytoskeleton. Therefore, we analyzed the E-cadherin concentration in Triton X-100–fractionated lysate of Panc-1 and BxPC-3 cells, which were grown for 12 hours on different substrates. Whereas in cells grown on TCP or fibronectin, most of the E-cadherin was present in the Triton-insoluble fraction (Fig. 1B, bottom), most E-cadherin was observed in the Triton-soluble fraction of Panc-1 and BxPC-3 cells cultured on collagen type I. These data suggest that substantial amounts of E-cadherin were dissociated from the cytoskeleton after 12 hours of collagen type I stimulation, although the total E-cadherin concentration was not significantly altered (Fig. 1B, bottom).

Panc-1 and BxPC-3 cells grown on type I collagen for 72 hours contained not only reduced E-cadherin but also reduced {alpha}- and ß-catenin concentrations as compared with cells grown on TCP or fibronectin (Fig. 1C). The relative protein amounts are given as small numbers in the lower part of the blots as determined by densitometric analyses.

In agreement with altered E-cadherin concentration in Triton X-100–fractionated cell lysates, the association of {alpha}-catenin and ß-catenin with the actin cytoskeleton changed after collagen type I treatment in Triton X-100–fractionated cell lysates. As shown in Fig. 1D, E-cadherin, {alpha}-, and ß-catenin were predominantly detected in the Triton-insoluble fractions of cells derived from both cell lines grown on TCP or fibronectin (Fig. 1D). This fraction is known to contain proteins which are connected with the cytoskeleton. In contrast, cells grown on type I collagen showed reduced amounts of E-cadherin as well as reduced {alpha}- and ß-catenin concentrations in the cytoskeleton-associated fraction. These results suggest a disruption of the E-cadherin adhesion complex in pancreatic carcinoma cells cultured on type I collagen. Whereas the reduction of total E-cadherin and catenin concentrations was detectable after 3 days of collagen stimulation (Fig. 1B, middle), the dissociation of the E-cadherin/catenin complex, estimated by Triton X-100 fractionation could be identified even after 12 hours of type I collagen treatment (Fig. 1C). The relative protein amounts are given as small numbers in the lower part of the blots as determined by densitometric analyses.

To test the influence of collagen type I stimulation on cell-cell aggregation, we did a rotation aggregation assay in the presence of pepsin-digested, soluble collagen type I or fibronectin using cells grown for 24 hours on substrate-coated dishes. As shown in Fig. 1E, collagen-stimulated Panc-1 or BxPC-3 cells exhibited a reduced aggregation capacity compared with fibronectin-stimulated or unstimulated cells. In contrast, Panc-1 cells expressing a fusion protein of E-cadherin and {alpha}-catenin, which is insensitive to modifications of catenins, did not show the collagen type I–induced reduction of cell aggregation (Fig. 1F). These data point to a collagen-induced disassembly of the E-cadherin adhesion complex and subsequently to reduced cell-cell aggregation.

Because alterations in tyrosine phosphorylation of ß-catenin represent an important mechanism leading to dissociation of the E-cadherin complex (32–34), we studied tyrosine phosphorylation of E-cadherin as well as {alpha}- and ß-catenin in pancreatic cancer cells grown on different ECM proteins. To analyze the phosphorylation state of catenins and, moreover, the kinases which may be involved in the regulation of the E-cadherin complex, we chose a collagen incubation time of 12 hours to ensure that enough amounts of E-cadherin complex was left for immunoprecipitation analyses. As shown in Fig. 2A , the phosphorylation of ß-catenin was exclusively increased in Panc-1 cells cultured on type I collagen compared with ß-catenins isolated from cells grown on TCP or fibronectin. Phosphorylation of {alpha}-catenin was slightly increased in Panc-1 cells cultured on type I collagen. We could not detect altered tyrosine phosphorylation of E-cadherin in the lysates of both cell lines (data not shown). Comparable results were obtained using BxPC-3 cells (data not shown).


Figure 2
View larger version (58K):
[in this window]
[in a new window]
  		Figure 2. Localization and phosphorylation of FAK in Panc-1 cells cultured on different substrates. A, tyrosine phosphorylation of {alpha}- and ß-catenin was examined by immunoprecipitation of {alpha}- or ß-catenin from 500 µg of total lysate from Panc-1 cells cultured on different substrates. Phosphorylated catenins were detected with a phosphotyrosine-specific antibody. Re-staining of the blots with antibodies used for immunoprecipitation documents equal amounts of precipitated protein. B, tyrosine phosphorylation of ß-catenin was analyzed from cells treated with orthovanadate (100 µmol/L) or EDTA/EGTA (5 mmol/L each) for 30 minutes. Immunoprecipitated ß-catenin (from 400 µg of lysate) was analyzed by Western blotting with a phosphotyrosine-specific antibody. The blots were re-stained with anti-ß-catenin antibody to document equal amounts of precipitated protein. C, cell aggregation assays were done in the presence of 100 µmol/L orthovanadate or EDTA/EGTA (5 mmol/L each) and compared with untreated Panc-1 cells. Columns, mean of three independent experiments; bars, ±SE. D, Panc-1 cells cultured on uncoated, type I collagen- or fibronectin-coated coverslips were stained with an anti-FAK antibody. Microscopic pictures of the apical part of the cells (bar, 10 µm). E, the amount of FAK which was associated with the E-cadherin adhesion complex was examined by coimmunoprecipitation. E-Cadherin was precipitated from 1 mg of total lysates of Panc-1 cells cultured on type I collagen, fibronectin, or TCP. Coprecipitated FAK was visualized by Western blotting. The blots were re-stained for E-cadherin to document equal amounts of precipitated E-cadherin. F, the amount of FAK in total lysates was estimated by immunoblotting using 30 µg lysate per lane. G, phosphorylation of FAK, which was associated with the E-cadherin complex, was analyzed by precipitation of E-cadherin from 1 mg of total Panc-1 lysates cultured on TCP, collagen type I, or fibronectin. The blots were stained with anti-FAK antibody and re-stained with anti-E-cadherin antibody to document equal amounts of precipitated protein. Representative blots from three independent experiments.

 
To verify that altered ß-catenin phosphorylation contributes to changes in cellular aggregation, we increased protein phosphorylation at tyrosine residues by incubating Panc-1 cells grown on TCP with the phosphatase inhibitor orthovanadate. This treatment increased tyrosine phosphorylation of ß-catenin as analyzed by Western blotting using a phosphotyrosine-specific antibody (Fig. 2B). In addition, we used orthovanadate-treated cells to perform cell aggregation assays. As shown in Fig. 2C, orthovanadate treatment (100 µmol/L) resulted in a clearly reduced cellular aggregation. The reduction of aggregation is comparable with the decline achieved by the inhibition of E-cadherin–mediated adhesion induced by calcium depletion (EDTA/EGTA).

Collagen type I promotes association of the kinase FAK with the E-cadherin complex. To study the molecular mechanisms resulting in an enhanced phosphorylation of ß-catenin, we analyzed the role of the tyrosine kinases FAK and Src. Immunofluorescence localization of FAK in Panc-1 cells grown on type I collagen showed an enhanced membranous localization in the apical part of Panc-1 cells compared with cells cultured on TCP (Fig. 2D). In cells grown on fibronectin, we could detect only a faint and discontinuous FAK staining at the plasma membrane (Fig. 2D). Focusing on the apical part of cells ensures that altered FAK localization at cell-cell adhesion points could be visualized, whereas altered FAK concentrations in basal focal adhesion contacts were not recorded.

Using immunoprecipitation experiments, we analyzed the altered FAK localization in more detail. As shown in Fig. 2E, we could show that a high amount of FAK was associated with the E-cadherin adhesion complex in Panc-1 cells cultured on type I collagen. In contrast, Panc-1 cells grown on TCP or fibronectin showed only small amounts of FAK coprecipitated with E-cadherin. The total amount of cellular FAK remains unchanged, irrespective of the different substrates (Fig. 2F).

In addition to changes in the localization of the FAK, we investigated whether the collagen-induced translocation of FAK to the E-cadherin complex is associated with changes in its kinase activity. Because phosphorylation of FAK at Tyr576 has been associated with increased FAK kinase activity (35), we analyzed the phosphorylation at Tyr576 of FAK proteins. To analyze only that part of the FAK pool, which is associated with the E-cadherin complex, we used coimmunoprecipitation experiments. The studies revealed an increased phosphorylation of Tyr576 of E-cadherin–associated FAK only in lysates of type I collagen–stimulated cells (Fig. 2G). Panc-1 cells grown on fibronectin or TCP did not exhibit an increased FAK phosphorylation (Fig. 2G). Similar results were obtained from experiments with BxPC-3 cells (data not shown). Moreover, we could show that phosphorylation of Tyr397, an autophosphorylation site of FAK, was also increased in type I collagen–stimulated Panc-1 cells (data not shown).

We have previously shown that activation of the cellular kinase Src is correlated with the disruption of the E-cadherin complex (4). In the present study, we asked whether Src is directly associated with the E-cadherin complex. Using coimmunoprecipitation experiments, E-cadherin was precipitated from up to 4 mg of Panc-1 or BxPC-3 cell lysate, but we could not detect Src associated with E-cadherin (data not shown).

Collagen-induced activation of FAK is mediated by integrins and Src. To analyze the signaling cascade leading to FAK phosphorylation induced by type I collagen, we examined the role of integrins, which represent the best-known cellular collagen receptors (36). ß1-containing integrins have been described to activate the kinases Src and FAK after binding to collagen (37). We have previously shown that collagen type I activates Src kinase activity in pancreatic carcinoma cells using an enolase phosphorylation assay (4). In particular, we analyzed whether the observed activation of FAK depends on ß1-containing integrins and whether the kinase Src is involved in FAK activation. The addition of a neutralizing antibody which blocks the binding of integrins to type I collagen was used to study the effects of ß1 integrin inhibition on Src and FAK activity. The Src activity was investigated by analyzing phosphorylation of Tyr416, which has been shown to be critical for its kinase activity (38). As shown in Fig. 3A , inhibition of ß1-containing integrins resulted in reduced Src phosphorylation. Additionally, inhibition of the interaction between ß1-integrins and collagen prevents the phosphorylation of E-cadherin–associated FAK at Tyr576 (Fig. 3B), indicating a reduced kinase activity of FAK which is linked to the E-cadherin complex. The addition of an antibody directed against N-cadherin, which is not present in Panc-1 cells, did not influence the phosphorylation of Src at Tyr416 or FAK at Tyr576.


Figure 3
View larger version (27K):
[in this window]
[in a new window]
  		Figure 3. Integrin ß1-dependent Src and FAK activation. A, the influence of ß1 integrin on activating Src phosphorylation at Tyr416 was investigated in total cell lysates after inhibition of ß1-integrin using a neutralizing antibody. Phosphorylation of Src at Tyr416 was determined after immunoprecipitation from 1 mg of lysates from Panc-1 cells grown on type I collagen (anti-ß1 integrin and an unspecific antibody) and on TCP (control). The blot was re-stained with anti-Src antibody to document equal amounts of protein. B, the influence of ß1-integrin on activating FAK phosphorylation, which was associated with the E-cadherin complex, was analyzed using the same experimental approach as described in (A). The phosphorylation of FAK at Tyr576 was determined using a phospho-FAK-specific antibody after precipitation of E-cadherin from 1 mg of lysates. The blot was re-stained with anti-E-cadherin antibody to document equal amounts of precipitated protein. C, the influence of Src activity on FAK phosphorylation was analyzed after the addition of the Src-specific inhibitor SU6656 (0.5 µmol/L) to cells grown on TCP or type I collagen for 3 hours. Phosphorylation of FAK at Tyr576 that was coprecipitated with E-cadherin from 1 mg of total lysate was estimated using a phospho-FAK-specific antibody. Re-staining with E-cadherin shows equal amounts of precipitated protein. One representative blot out of three independent experiments.

 
With regard to the collagen-induced Src activation, we asked if Src contributes to FAK phosphorylation in Panc-1 cells cultured on type I collagen. Therefore, we added the Src-specific inhibitor, SU6656 (0.5 µmol/L) to cultured cells. The inhibition of Src activity dramatically reduced E-cadherin–associated FAK phosphorylation at Tyr576 in type I collagen-stimulated Panc-1 cells compared with cells treated with solvent only (Fig. 3C).

FAK induces ß-catenin phosphorylation in response to collagen type I. To investigate whether the activated FAK contributes to enhanced phosphorylation of ß-catenin, we expressed a dominant-negative FAK mutant FRNK as EGFP-tagged protein in Panc-1 cells and analyzed its influence on ß-catenin phosphorylation in response to different substrates. To analyze only ß-catenin of cells, which were successfully transfected, we cotransfected EGFP-FRNK and EGFP-ß-catenin. Subsequently, we immunoprecipitated EGFP-ß-catenin using a GFP antibody. As shown in Fig. 4A , the expression of EGFP-FRNK and EGFP-ß-catenin in Panc-1 cells on type I collagen (lane 4) decreased the tyrosine phosphorylation of cotransfected EGFP-ß-catenin compared with cells which expressed EGFP-ß-catenin alone (lane 2). In Panc-1 cells cultured on TCP, the transfection of either EGFP-ß-catenin or EGFP-ß-catenin and EGFP-FRNK did not result in alterations of ß-catenin tyrosine phosphorylation (lanes 1 and 3). The expression of similar amounts of EGFP-FRNK and EGFP-ß-catenin was verified by immunoblotting and staining with anti-GFP antiserum (Fig. 4B).


Figure 4
View larger version (20K):
[in this window]
[in a new window]
  		Figure 4. FAK-dependent phosphorylation of ß-catenin. A, the influence of FAK on tyrosine phosphorylation of ß-catenin was investigated by expression of the EGFP-tagged kinase-deficient FAK mutant FRNK. EGFP-ß-catenin (lanes 1 and 2) or EGFP-ß-catenin and EGFP-FRNK (lanes 3 and 4) were transfected into Panc-1 cells cultivated on TCP (lanes 1 and 3) or type I collagen (lanes 2 and 4). Immunoprecipitation of EGFP-tagged transfected proteins was done with anti-GFP antibody from 0.5 mg of total lysate. Tyrosine phosphorylation of the precipitates were analyzed by immunoblotting with a phosphotyrosine-specific antibody. EGFP-tagged ß-catenin was identified by its apparent molecular weight (protein plus EGFP-tag) and verified by re-staining with anti-ß-catenin antibody. B, to verify proper expression of transfected proteins, 50 µg of cell lysates from Panc-1 cells transfected with EGFP-ß-catenin (lanes 1 and 2) or EGFP-ß-catenin and EGFP-FRNK were immunoblotted using an anti-GFP antibody.

 
Collagen type I stimulation correlates with nuclear ß-catenin localization. Immunofluorescence analyses (Fig. 5A ) of Panc-1 cells stimulated with type I collagen revealed a nuclear localization of ß-catenin (red) as indicated by DNA costaining with DAPI (blue). Membranous ß-catenin staining was strongly reduced in these cells. In contrast, ß-catenin was exclusively localized at the cell membrane of Panc-1 cells grown on TCP or fibronectin (Fig. 5A). In agreement with these results, we observed a significant increase of ß-catenin in the nuclear fraction of Panc-1 and BxPC-3 cells which were cultured on type I collagen. Nuclear fractions of cells grown on fibronectin or TCP contained only minimal amounts of ß-catenin (Fig. 5B). Interestingly, the increase of nuclear ß-catenin is not associated with canonical Wnt-signaling because the activity of the GSK-3ß remains unchanged in Panc-1 cells cultured on type I collagen analyzed by GSK-3ß phosphorylation of Ser21 and Ser9 (data not shown).


Figure 5
View larger version (39K):
[in this window]
[in a new window]
  		Figure 5. Nuclear localization of ß-catenin in Panc-1 cells grown on collagen type I. A, Panc-1 cells grown on the indicated substrates were costained with an anti-ß catenin antibody (Cy3) and DAPI (bar, 10 µm). B, 50 µg of nuclear extracts of Panc-1 (top) and BxPc-3 (bottom) cells grown on different substrates were analyzed by Western blotting using a monoclonal anti-ß-catenin antibody. The concentration of lamin B was determined by re-staining of the blots with an antibody against lamin B. Immunoblots analyzing 20 µg of total protein lysate of both cell lines cultured on the indicated substrates are shown to document that altered nuclear ß-catenin is not due to a general change in ß-catenin concentration. One representative blot out of three independent experiments.

 
Collagen type I activates ß-catenin-Lef/Tcf–regulated gene expression. Because of the increased nuclear localization of ß-catenin as well as the increased concentration of ß-catenin in the Triton X-100–soluble fraction of Panc-1 cells grown on type I collagen (Fig. 1C), we asked if the increased cytosolic ß-catenin amount could induce ß-catenin-Lef/TCF–dependent gene expression. The results of gene reporter assays (Fig. 6A ), using a specific ß-catenin-Lef/Tcf–sensitive luciferase reporter construct (TOPflash), exhibited enhanced promoter activity (2.5-fold) in Panc-1 cells grown on type I collagen compared with controls on TCP (Fig. 6A). The activity of the FOPflash promoter construct, which contains a mutated Lef/Tcf-binding site, was not affected by collagen stimulation. To determine whether this translocation of ß-catenin also influences physiological Lef/Tcf target genes, we analyzed the amount of c-myc and cyclin D1 mRNA by semiquantitative RT-PCR. In agreement with the data obtained by the reporter assay, the mRNA concentrations of c-myc and cyclin D1 were increased in cells cultured on type I collagen but not in cells grown on TCP or fibronectin (Fig. 6B). Densitometric quantification and normalization to ß-actin mRNA concentration revealed a 2.1-fold increase of c-myc mRNA and a 2.3-fold increase of cyclin D1 mRNA concentration in Panc-1 cells grown on type I collagen compared with mRNA amounts in cells cultured on TCP. Panc-1 cells stimulated with fibronectin showed no increase of c-myc mRNA (1.2-fold) and only a slight increase of cyclin D1 mRNA (1.5-fold).


Figure 6
View larger version (34K):
[in this window]
[in a new window]
  		Figure 6. Nuclear ß-catenin induces expression of Lef/Tcf target genes and cell proliferation. A, the transcriptional activity of nuclear ß-catenin was assessed by a gene reporter assay. Panc-1 cells cultured on different substrates were transiently transfected with TOPflash or FOPflash reporter construct, which contains wild-type or mutant Lef/Tcf binding sites. Transfection efficiency was normalized by cotransfection of a renilla-luciferase construct. Columns, mean of three independent experiments; bars, ± SE; *, P < 0.05, statistically significant differences (Student's t test). B, expression of the ß-catenin-Lef/Tcf target genes c-myc and cyclin D1 was examined by semiquantitative RT-PCR. RT-PCR with ß-actin–specific primers was used to document equal amounts of cDNA. C, the proliferation rate of Panc-1 cells was estimated by estimating mitotic figures of DAPI-stained Panc-1 cells grown on uncoated, type I collagen, or fibronectin-coated coverslips. Mitotic figures of five visual fields from three independent experiments were counted. Columns, mean of four independent experiments; bars, ±SE; *, P < 0.01, statistically significant differences (Student's t test). D, analysis of cell counts estimated on subsequent days. Cells cultured in triplicate on the indicated substrates were detached by trypsin treatment and the cell numbers were measured using a cell counter. A representative assay out of three independent experiments.

 
Because c-myc as well as cyclin D1 represents important cell cycle proteins, we investigated whether enhanced expression of c-myc and cyclin D1 correlates with altered cell proliferation. After DNA staining with DAPI, the number of mitotic figures was counted in cells grown on different substrates (Fig. 6C). Collagen type I–stimulated Panc-1 cells exhibited 15.5 (SD, 2.2) mitotic figures per 100 cells. This is a significantly higher number than in cells grown on TCP or fibronectin, in which 5.2 (SD, 1.3) or 7.6 (SD, 1.6) mitotic figures per 100 cells could be identified (P < 0.05, Student's t test). These data were verified by determining the cell number after different culture intervals. As shown in Fig. 6D, we started with the same numbers of Panc-1 cells. Cell grown on type I collagen exhibited a significantly higher increase in cell number as compared with cells grown on fibronectin or TCP.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The interaction of tumor cells with their microenvironment, especially with proteins of the ECM, has been suggested to play a pivotal role in tumor progression (39). In the present report, we show that the tumor stroma, especially type I collagen, induces the disassembly of E-cadherin adhesion complexes and contributes to tumor progression in pancreatic cancer. Although several reports say that collagens influence cadherin-mediated cellular adhesion (4, 40, 41), the molecular details remain widely unclear.

In this study, we show for the first time that collagen I–activated FAK is recruited to the E-cadherin complex. FAK contributes directly or indirectly to enhanced tyrosine phosphorylation of ß-catenin, leading to a disruption of the E-cadherin adhesion complex.

There is growing evidence pointing towards a role of FAK in the regulation of cadherin-dependent cell-cell adhesion beside its function in cell-matrix adhesion. In addition to the influence of FAK on deregulation of N-cadherin–mediated adhesion (42), recent data shows that FAK plays a role in the assembly of the E-cadherin complex in colon cancer (37, 43). Our results show that activated FAK is directly associated with the E-cadherin complex. They are in line with the data of Avizienyte and colleagues who said that the expression of FAK mutants, which could not be phosphorylated by Src kinase, resulted in increased E-cadherin–mediated cell-cell adhesion (37). Furthermore, it has been shown that the expression of the dominant-negative FAK mutant, FRNK, specifically suppressed invasion and metastasis, but it did not interfere with enhanced cell motility (44). The interpretation that increased FAK activity is involved in the promotion of cell invasion is further supported by experiments using FAK–/– fibroblasts. Expression of v-Src in FAK–/– fibroblasts resulted in the restoration of cell motility, but it did not induce an invasive phenotype (45).

The molecular mechanisms which lead to FAK activation is not entirely clear. It has been convincingly shown that FAK acts downstream of ß1-intregins (46, 47). Together with the reduced FAK phosphorylation after inhibition of integrin ß1, as shown in this study, we suggest that collagen-ligated ß1-integrins initiate the signaling cascade, leading to disassembly of the E-cadherin adhesion complex. Moreover, we show that activation of Src kinase in response to collagen type I is necessary to obtain FAK activity in pancreatic cancer cell lines. There are several reports in the literature saying that the Src kinase could act as an activator of FAK. Experiments from Salazar and Rozengurt showed that Src could induce FAK activity by tyrosine phosphorylation at Tyr397 (48). Recently, Hauck et al. showed that expression of activated Src resulted in a stable v-Src-FAK signaling complex, which correlated with enhanced invasion in vitro (49). Altogether, these results imply that Src acts upstream of FAK but downstream of integrins in collagen-induced FAK activation in pancreatic cancer cells.

For the first time, we could show in this study, an association of activated FAK with the E-cadherin complex which is increased in response to collagen type I stimulation. Although we have not shown the direct phosphorylation of ß-catenin by FAK, we could show a subsequently enhanced tyrosine phosphorylation of ß-catenin and the dissociation of E-cadherin from the actin cytoskeleton. Furthermore, our data shows that FAK activity was necessary to achieve the collagen-induced ß-catenin phosphorylation (Figs. 3 and 4). We cannot exclude that the ß-catenin modulation induced by activated FAK may be facilitated indirectly by an intermediate kinase.

Several reports support that enhanced tyrosine phosphorylation of ß-catenin leads to an inhibition of E-cadherin–mediated cellular aggregation (32–34). Recently, the phosphorylation of tyrosine residues Y142, Y489, and Y654 of human ß-catenin has been described to be involved in the regulation of ß-catenin-E-cadherin or {alpha}-catenin/ß-catenin binding [reviewed recently by Lilien and Balsamo (34)]. It remains to be established which tyrosine residue in ß-catenin is phosphorylated in response to FAK activation in pancreatic carcinoma cells. Some studies suggest that Src or another member of the Src family, i.e., Yes, may be able to phosphorylate ß-catenin. Especially Tyr654 of ß-catenin, which has been identified as a target of the activated epidermal growth factor receptor or v-Src (6, 7, 34). In comparison, we could not detect Src associated with the E-cadherin complex using coimmunoprecipitation experiments in collagen-stimulated pancreatic cancer cells.

An alternative hypothesis, which may explain the reduced cellular adhesion, has been suggested by Sander and colleagues. They show that activation or relocalization of the GTPase Rac1, induced by collagen type I, decreased E-cadherin–mediated cellular adhesion by inhibition of actin filament polymerization at sites of E-cadherin/catenin complexes (41). Here, we could show that the expression of an E-cadherin-{alpha}-catenin fusion protein in collagen-stimulated Panc-1 cells prevented the loss of cell-cell adhesion. This fusion protein has been shown to be resistant to destabilizing modulations of the E-cadherin/catenin adhesion complex, such as phosphorylation of catenins or E-cadherin, but it needs an association with the actin cytoskeleton to achieve strong cell-cell adhesion (50). These data suggest that the regulation of the E-cadherin/catenin complex stability play a pivotal role in the collagen-induced reduction of cell-cell adhesion and that the reduced cellular adhesion is not only induced by alteration of the actin cytoskeleton assembly. Although, we do not exclude that regulation of the actin cytoskeleton induced by GTPases provides an additional decrease of cell-cell adhesion in pancreatic carcinoma cells.

In addition, we show in this study a collagen type I–induced nuclear localization of ß-catenin in pancreatic carcinoma cells. This aberrant localization correlates with enhanced expression of the ß-catenin target genes c-myc and cyclin D1, and an increased cellular proliferation rate. The influence of ß-catenin-Lef/Tcf–induced gene expression for the progression of colon cancer has been recently established by Brabletz et al. (51). The authors showed that ß-catenin was removed from cell-cell adhesion and was localized in the nucleus, especially in tumor cells located near the invasive front (51). Activated ß-catenin-Lef/Tcf transcription factors have been identified to increase not only the proliferation but also the migration of epithelial cells (13, 52). Several clinical studies underline the importance of ß-catenin in the development of pancreatic cancer. Reduced membranous and increased cytoplasmic localization of ß-catenin correlates negatively with tumor stage and survival of patients suffering from pancreatic adenocarcinoma (53, 54). A recent study elucidated a significant reduction of membranous E-cadherin and aberrant nuclear localization of ß-catenin in high-grade pancreatic intraepithelial neoplasia lesions or adenocarcinoma compared with low-grade pancreatic intraepithelial neoplasia lesions or normal ducts (55).

In conclusion, we could show that components of the ECM, i.e., collagen type I, produced by the tumor in large quantities reduce cellular adhesion and support proliferation in pancreatic cancer. The dissociation of the E-cadherin adhesion complex is mediated by translocation of activated FAK to the E-cadherin adhesion complex. This is correlated with increased nuclear amounts of ß-catenin which cooperate with Lef/Tcf transcription factors to enhance expression of the cell cycle proteins and promotes proliferation of pancreatic cancer cells.


   Acknowledgments
 
Grant support: Deutsche Forschungsgemeinschaft (SFB 518, B7) to A. Koenig and A. Menke.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank S. Braeg and C. Laengle for excellent technical assistance, and Drs. Y. Imamichi, K. Giehl, and U. Dreissigacker for helpful discussions.


   Footnotes
 
Note: A. Koenig and C. Mueller contributed equally to this work.

Received 8/ 8/05. Revised 1/24/06. Accepted 2/24/06.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Adams CL, Nelson WJ. Cytomechanics of cadherin-mediated cell-cell adhesion. Curr Opin Cell Biol 1998;10:572–7.[CrossRef][Medline]
  2. Perl AK, Wilgenbus P, Dahl U, Semb H, Christofori G. A causal role for E-cadherin in the transition from adenoma to carcinoma. Nature 1998;392:190–3.[CrossRef][Medline]
  3. Cavallaro U, Christofori G. Cell adhesion in tumor invasion and metastasis: loss of the glue is not enough. Biochim Biophys Acta 2001;1552:39–45.[Medline]
  4. Menke A, Philippi C, Vogelmann R, et al. Down-regulation of E-cadherin gene expression by collagen type I and type III in pancreatic cancer cell lines. Cancer Res 2001;61:3508–17.[Abstract/Free Full Text]
  5. Zhurinsky J, Shtutman M, Ben Ze'ev A. Plakoglobin and ß-catenin: protein interactions, regulation and biological roles. J Cell Sci 2000;113:3127–39.[Abstract]
  6. Daniel JM, Reynolds AB. Tyrosine phosphorylation and cadherin/catenin function. Bioessays 1997;19:883–91.[CrossRef][Medline]
  7. Roura S, Miravet S, Piedra J, de Herreros AG, Dunach M. Regulation of E-cadherin/catenin association by tyrosine phosphorylation. J Biol Chem 1999;274:36734–40.[Abstract/Free Full Text]
  8. Piedra J, Martinez D, Castano J, Miravet S, Dunach M, de Herreros AG. Regulation of ß-catenin structure and activity by tyrosine phosphorylation. J Biol Chem 2001;276:20436–43.[Abstract/Free Full Text]
  9. Xu G, Craig AWB, Greer P, et al. Continuous association of cadherin with ß-catenin requires the non-receptor tyrosine-kinase Fer. J Cell Sci 2004;117:3207–19.[Abstract/Free Full Text]
  10. Ukropec JA, Hollinger MK, Salva SM, Woolkalis MJ. SHP2 association with VE-cadherin complexes in human endothelial cells is regulated by thrombin. J Biol Chem 2000;275:5983–6.[Abstract/Free Full Text]
  11. Vogelmann R, Nguyen-tat MD, Giehl K, Adler G, Wedlich D, Menke A. TGFß-induced downregulation of E-cadherin-based cell-cell adhesion depends on PI3-kinase and PTEN. J Cell Sci 2005;118:4901–12.[Abstract/Free Full Text]
  12. Müller T, Choidas A, Reichmann E, Ullrich A. Phosphorylation and free pool of ß-catenin are regulated by tyrosine kinases and tyrosine phosphatases during epithelial cell migration. J Biol Chem 1999;274:10173–83.[Abstract/Free Full Text]
  13. van Es JH, Barker N, Clevers H. You Wnt some, you lose some: oncogenes in the Wnt signaling pathway. Curr Opin Genet Dev 2003;13:28–33.[CrossRef][Medline]
  14. Tetsu O, McCormick F. ß-Catenin regulates expression of cyclin D1 in colon carcinoma cells. Nature 1999;398:422–6.[CrossRef][Medline]
  15. He TC, Sparks AB, Rago C, et al. Identification of c-MYC as a target of the APC pathway. Science 1998;281:1509–12.[Abstract/Free Full Text]
  16. Gradl D, Kühl M, Wedlich D. The Wnt/Wg signal transducer ß-catenin controls fibronectin expression. Mol Cell Biol 1999;19:5576–87.[Abstract/Free Full Text]
  17. Wong NA, Pignatelli M. ß-Catenin—a linchpin in colorectal carcinogenesis? Am J Pathol 2002;160:389–401.[Abstract/Free Full Text]
  18. Morin PJ. ß-Catenin signaling and cancer. Bioessays 1999;21:1021–30.[CrossRef][Medline]
  19. Kern S, Hruban R, Hollingsworth MA, et al. A white paper: the product of a pancreas cancer think tank. Cancer Res 2001;61:4923–32.[Free Full Text]
  20. Linder S, Castanos-Velez E, von Rosen A, Biberfeld P. Immunohistochemical expression of extracellular matrix proteins and adhesion molecules in pancreatic carcinoma. Hepatogastroenterology 2001;48:1321–7.[Medline]
  21. Gress TM, Müller-Pillasch F, Lerch MM, Friess H, Büchler M, Adler G. Expression and in situ localization of genes coding for extracellular matrix proteins and extracellular matrix degrading proteases in pancreatic cancer. Int J Cancer 1995;62:407–13.[Medline]
  22. Brabletz T, Jung A, Reu S, et al. Variable ß-catenin expression in colorectal cancers indicates tumor progression driven by the tumor environment. Proc Natl Acad Sci U S A 2001;98:10356–61.[Abstract/Free Full Text]
  23. Schlaepfer DD, Mitra SK. Multiple connections link FAK to cell motility and invasion. Curr Opin Genet Dev 2004;14:92–101.[CrossRef][Medline]
  24. Igishi T, Fukuhara S, Patel V, Katz B-Z, Yamada KM, Gutkind JS. Divergent signaling pathways link focal adhesion kinase to mitogen-activated protein kinase cascades. J Biol Chem 1999;274:30738–46.[Abstract/Free Full Text]
  25. Playford MP, Schaller MD. The interplay between Src and integrins in normal and tumor biology. Oncogene 2004;23:7928–46.[CrossRef][Medline]
  26. Xu LH, Yang X, Bradham CA, et al. The focal adhesion kinase suppresses transformation-associated, anchorage-independent apoptosis in human breast cancer cells. Involvement of death receptor-related signaling pathways. J Biol Chem 2000;275:30597–604.[Abstract/Free Full Text]
  27. Seidel B, Braeg S, Adler G, Wedlich D, Menke A. E- and N-cadherin differ with respect to their associated p120(ctn) isoforms and their ability to suppress invasive growth in pancreatic cancer cells. Oncogene 2004;23:5532–42.[CrossRef][Medline]
  28. Nicholson RC, Mader S, Nagpal S, Leid M, Rochette-Egly C, Chambon P. Negative regulation of the rat stromelysin gene promoter by retinoic acid is mediated by an AP1 binding site. EMBO J 1990;9:4443–54.[Medline]
  29. Hinck L, Näthke IS, Papkoff J, Nelson WJ. Dynamics of cadherin/catenin complex formation: novel protein interactions and pathways of complex assembly. J Cell Biol 1994;125:1327–40.[Abstract/Free Full Text]
  30. Voisard R, Gecguner L, Baur R, Herter T, Hombach V. Antiproliferative profile of sirolimus and mycophenolate mofetil: impact of the SI/MPL ratio. Int J Cardiol 2005;102:435–42.[CrossRef][Medline]
  31. Ozawa M, Kemler R. Correct proteolytic cleavage is required for the cell adhesive function of uvomorulin. J Cell Biol 1990;111:1645–50.[Abstract/Free Full Text]
  32. Ozawa M, Kemler R. Altered cell adhesion activity by pervanadate due to the dissociation of {alpha}-catenin from the E-cadherin.catenin complex. J Biol Chem 1998;273:6166–70.[Abstract/Free Full Text]
  33. Nelson WJ, Nusse R. Convergence of Wnt, ß-catenin, and cadherin pathways. Science 2004;303:1483–7.[Abstract/Free Full Text]
  34. Lilien J, Balsamo J. The regulation of cadherin-mediated adhesion by tyrosine phosphorylation/dephosphorylation of ß-catenin. Curr Opin Cell Biol 2005;17:459–65.[CrossRef][Medline]
  35. Maa MC, Leu TH. Vanadate-dependent FAK activation is accomplished by the sustained FAK Tyr-576/577 phosphorylation. Biochem Biophys Res Commun 1998;251:344–9.[CrossRef][Medline]
  36. Hynes RO. Integrins: versatility, modulation, and signaling in cell adhesion. Cell 1992;69:11–25.[CrossRef][Medline]
  37. Avizienyte E, Wyke AW, Jones RJ, et al. Src-induced de-regulation of E-cadherin in colon cancer cells requires integrin signalling. Nat Cell Biol 2002;4:632–8.[Medline]
  38. Porter M, Schindler T, Kuriyan J, Miller WT. Reciprocal regulation of Hck activity by phosphorylation of Tyr(527) and Tyr(416). Effect of introducing a high affinity intramolecular SH2 ligand. J Biol Chem 2000;275:2721–6.[Abstract/Free Full Text]
  39. Liotta LA, Kohn EC. The microenvironment of the tumour-host interface. Nature 2001;411:375–9.[CrossRef][Medline]
  40. Gimond C, van Der FA, van Delft S, et al. Induction of cell scattering by expression of ß1 integrins in ß1-deficient epithelial cells requires activation of members of the rho family of GTPases and downregulation of cadherin and catenin function. J Cell Biol 1999;147:1325–40.[Abstract/Free Full Text]
  41. Sander EE, van DS, ten KJ, et al. Matrix-dependent Tiam1/Rac signaling in epithelial cells promotes either cell-cell adhesion or cell migration and is regulated by phosphatidylinositol 3-kinase. J Cell Biol 1998;143:1385–98.[Abstract/Free Full Text]
  42. Yano H, Mazaki Y, Kurokawa K, Hanks SK, Matsuda M, Sabe H. Roles played by a subset of integrin signaling molecules in cadherin-based cell-cell adhesion. J Cell Biol 2004;166:283–95.[Abstract/Free Full Text]
  43. Irby RB, Yeatman TJ. Increased Src activity disrupts cadherin/catenin-mediated homotypic adhesion in human colon cancer and transformed rodent cells. Cancer Res 2002;62:2669–74.[Abstract/Free Full Text]
  44. Hauck CR, Hsia DA, Puente XS, Cheresh DA, Schlaepfer DD. FRNK blocks v-Src-stimulated invasion and experimental metastases without effects on cell motility or growth. EMBO J 2002;21:6289–302.[CrossRef][Medline]
  45. Hsia DA, Mitra SK, Hauck CR, et al. Differential regulation of cell motility and invasion by FAK. J Cell Biol 2003;160:753–67.[Abstract/Free Full Text]
  46. Giancotti FG. Complexity and specificity of integrin signalling. Nat Cell Biol 2000;2:E13–4.[CrossRef][Medline]
  47. Lewis JM, Schwartz MA. Mapping in vivo associations of cytoplasmic proteins with integrin ß1 cytoplasmic domain mutants. Mol Biol Cell 1995;6:151–60.[Abstract]
  48. Salazar EP, Rozengurt E. Src family kinases are required for integrin-mediated but not for G protein-coupled receptor stimulation of focal adhesion kinase autophosphorylation at Tyr-397. J Biol Chem 2001;276:17788–95.[Abstract/Free Full Text]
  49. Hauck CR, Hsia DA, Ilic D, Schlaepfer DD. v-Src SH3-enhanced interaction with focal adhesion kinase at ß1 integrin-containing invadopodia promotes cell invasion. J Biol Chem 2002;277:12487–90.[Abstract/Free Full Text]
  50. Nagafuchi A, Ishihara S, Tsukita S. The roles of catenins in the cadherin-mediated cell adhesion: functional analysis of E-cadherin-{alpha} catenin fusion molecules. J Cell Biol 1994;127:235–45.[Abstract/Free Full Text]
  51. Brabletz T, Jung A, Kirchner T. ß-Catenin and the morphogenesis of colorectal cancer. Virchows Arch 2002;441:1–11.[CrossRef][Medline]
  52. Rivat C, Le Floch N, Sabbah M, et al. Synergistic cooperation between the AP-1 and LEF-1 transcription factors in activation of the matrilysin promoter by the src oncogene: implications in cellular invasion. FASEB J 2003;17:1721–3.[Abstract/Free Full Text]
  53. Qiao Q, Ramadani M, Gansauge S, Gansauge F, Leder G, Beger HG. Reduced membranous and ectopic cytoplasmic expression of ß-catenin correlate with cyclin D1 overexpression and poor prognosis in pancreatic cancer. Int J Cancer 2001;95:194–7.[CrossRef][Medline]
  54. Watanabe I, Hasebe T, Sasaki S, et al. Advanced pancreatic ductal cancer: fibrotic focus and ß-catenin expression correlate with outcome. Pancreas 2003;26:326–33.[CrossRef][Medline]
  55. Al-Aynati MM, Radulovich N, Riddell RH, Tsao MS. Epithelial-cadherin and ß-catenin expression changes in pancreatic intraepithelial neoplasia. Clin Cancer Res 2004;10:1235–40.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 FASEB J.Home page
G. Benton, E. Crooke, and J. George
Laminin-1 induces E-cadherin expression in 3-dimensional cultured breast cancer cells by inhibiting DNA methyltransferase 1 and reversing promoter methylation status
FASEB J, November 1, 2009; 23(11): 3884 - 3895.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
F. E.M. Froeling, T. A. Mirza, R. M. Feakins, A. Seedhar, G. Elia, I. R. Hart, and H. M. Kocher
Organotypic Culture Model of Pancreatic Cancer Demonstrates that Stromal Cells Modulate E-Cadherin, {beta}-Catenin, and Ezrin Expression in Tumor Cells
Am. J. Pathol., August 1, 2009; 175(2): 636 - 648.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Biol. CellHome page
X.-Q. Wang, H. Li, V. Van Putten, R. A. Winn, L. E. Heasley, and R. A. Nemenoff
Oncogenic K-Ras Regulates Proliferation and Cell Junctions in Lung Epithelial Cells through Induction of Cyclooxygenase-2 and Activation of Metalloproteinase-9
Mol. Biol. Cell, February 1, 2009; 20(3): 791 - 800.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
M. L. Yeung, J.-i. Yasunaga, Y. Bennasser, N. Dusetti, D. Harris, N. Ahmad, M. Matsuoka, and K.-T. Jeang
Roles for MicroRNAs, miR-93 and miR-130b, and Tumor Protein 53-Induced Nuclear Protein 1 Tumor Suppressor in Cell Growth Dysregulation by Human T-Cell Lymphotrophic Virus 1
Cancer Res., November 1, 2008; 68(21): 8976 - 8985.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
K. M. Bailey and J. Liu
Caveolin-1 Up-regulation during Epithelial to Mesenchymal Transition Is Mediated by Focal Adhesion Kinase
J. Biol. Chem., May 16, 2008; 283(20): 13714 - 13724.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
S. Sengupta, J. A. den Boon, I-H. Chen, M. A. Newton, S. A. Stanhope, Y.-J. Cheng, C.-J. Chen, A. Hildesheim, B. Sugden, and P. Ahlquist
MicroRNA 29c is down-regulated in nasopharyngeal carcinomas, up-regulating mRNAs encoding extracellular matrix proteins
PNAS, April 15, 2008; 105(15): 5874 - 5878.
[Abstract] [Full Text] [PDF]

Home page
 JCBHome page
Y. Shintani, Y. Fukumoto, N. Chaika, R. Svoboda, M. J. Wheelock, and K. R. Johnson
Collagen I-mediated up-regulation of N-cadherin requires cooperative signals from integrins and discoidin domain receptor 1
J. Cell Biol., March 24, 2008; 180(6): 1277 - 1289.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Respir. Cell Mol. Bio.Home page
Y. Shintani, M. Maeda, N. Chaika, K. R. Johnson, and M. J. Wheelock
Collagen I Promotes Epithelial-to-Mesenchymal Transition in Lung Cancer Cells via Transforming Growth Factor Signaling
Am. J. Respir. Cell Mol. Biol., January 1, 2008; 38(1): 95 - 104.
[Abstract] [Full Text] [PDF]

Home page
 Br J OphthalmolHome page
S. Kase, M. Osaki, I. Sato, S. Takahashi, K. Nakanishi, K. Yoshida, H. Ito, and S. Ohno
Immunolocalisation of E-cadherin and {beta}-catenin in human pterygium
Br J Ophthalmol, September 1, 2007; 91(9): 1209 - 1212.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
Y. Shintani, M. A. Hollingsworth, M. J. Wheelock, and K. R. Johnson
Collagen I Promotes Metastasis in Pancreatic Cancer by Activating c-Jun NH2-Terminal Kinase 1 and Up-regulating N-Cadherin Expression
Cancer Res., December 15, 2006; 66(24): 11745 - 11753.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Koenig, A.
Right arrow Articles by Menke, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Koenig, A.
Right arrow Articles by Menke, A.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online