| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Cell, Tumor, and Stem Cell Biology |
Departments of 1 Internal Medicine I and 2 Pathology, University of Ulm, Ulm, Germany
Requests for reprints: Andre Menke, Department of Internal Medicine I, University of Ulm, D-89070 Ulm, Germany. Phone: 49-731-500-33705; Fax: 49-731-500-33717; E-mail: andre.menke{at}uni-ulm.de.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
-catenin (1). The dynamic regulation of the E-cadherin complex assembly and its association with the cytoskeleton is essential in many cellular functions such as differentiation, proliferation, or migration (1). In malignant diseases, a complete loss of this adhesion module represents an important step in tumor progression and metastasis (2). However, a complete loss of E-cadherin caused by a deletion in the E-cadherin gene is found only in a subset of carcinomas. There is increasing evidence that alterations in the stability of the E-cadherin complex in malignant diseases contribute to a functional loss of cell-cell adhesion (3, 4). Enhanced phosphorylation of distinct complex proteins, such as ß-catenin, has been shown to play a crucial role in the regulation of E-cadherin complex assembly, and it has been shown in several epithelial tumors (5, 6). Increased phosphorylation of ß-catenin is associated with the activation of different kinases such as Src (7, 8) or Fer (9) and the inhibition of different phosphatases such as SHPTP2 (10), PTEN (11), or LAR (12). Besides the function of ß-catenin as an integral component of the cadherin adhesion complex, it is a crucial mediator in the canonical Wnt signaling pathway (13). Interaction of Wnt with its receptor frizzled leads, via disheveled, to an inactivation of the glycogen synthetase kinase 3ß (GSK-3ß). Inactivated GSK-3ß is no longer able to promote the degradation of cytoplasmic ß-catenin. Stabilized cytoplasmic ß-catenin translocates inside the nucleus and cooperates with transcription factors of the Lef/Tcf-family (13). After interaction with Lef/Tcf transcription factors, ß-catenin-Lef/TCF regulates different target genes such as cyclin D1 (14), c-myc (15), or fibronectin (16), which control proliferation and cellular invasion. ß-Catenin-Lef/Tcfactivated gene expression has been described in various malignancies such as colorectal cancer, hepatocellular carcinoma, or malignant melanoma (17, 18).
Compared with other gastrointestinal tumors, pancreatic cancer is characterized by early invasiveness and metastasis (19). Pancreatic cancer also differs from other epithelial tumors by the production of large amounts of extracellular matrix proteins (ECM; refs. 20, 21). Collagen type I and type III are extensively produced by pancreatic cancer and surrounding stroma cells but not by normal pancreatic tissue (20, 21). Whether these ECM proteins directly contribute to invasiveness or if they reflect a defense mechanism of the organism to prevent tumor cell invasion is still questionable. There is some evidence that the ECM can promote tumor progression. We have previously shown that different components of the ECM, such as collagen type I and type III, contribute to a decreased expression of E-cadherin followed by an increased migration of pancreatic carcinoma cells (4). The importance of ECM proteins in tumor progression was underlined by the work of Brabletz and colleagues, which described a ß-catenindependent tumor progression with increased proliferation and invasiveness into the surrounding stroma in colorectal cancer, specifically at the tumor invasion front (22).
The focal adhesion kinase (FAK) represents a key player in the regulation of cell matrix interaction and in the formation of focal contacts. FAK, a nonreceptor tyrosine kinase of 119 kDa, is able to promote different signaling pathways resulting in increased cellular motility and invasiveness, as well as decreased cellular adhesion (23). It is activated, among others, by integrin-induced Src activity and initiates different signaling effects such as activation of extracellular signal-regulated kinase (24), activation of the p130/Crk/DOCK1 cascade (25), or preventing cells from apoptosis (26).
Here, we show the capability of type I collagen to induce an activation of the tyrosine kinase FAK and recruitment to the E-cadherin/catenin complex leading to enhanced ß-catenin phosphorylation in pancreatic cancer cells. As a consequence, the membranous E-cadherin complex is dissociated. This dissociation is correlated with nuclear translocation of ß-catenin which cooperates with Lef/Tcf transcription factors to enhance the expression of the c-myc and cyclin D1 genes and increased proliferation of pancreatic cancer cells.
| Materials and Methods |
|---|
|
|
|---|
-catenin (610193), ß-catenin (610153), E-cadherin (610181), and FAK (610087) were purchased from BD Transduction Laboratories (Lexington, KY). An antibody against ß-actin (A-5441) was obtained from Sigma-Aldrich (Taufkirchen, Germany), anti-Src (05-184) from Upstate (Lake Placid, NY), anti-GFP (600-301-215) from Rockland Immunochemicals (Gilbertsville, PA), anti-lamin B (IMG-5133A) from Imgenex (San Diego, CA), and anti-ß1 integrin (MAB1965) from Chemicon (Temecula, CA). A polyclonal antiserum against ß-catenin (C-7207) was purchased from Sigma-Aldrich. Phosphospecific antibodies were used as follows: anti-phospho-FAK Tyr576 (44-652) and Tyr397 (44-656) from BioSource International (Camarillo, CA), anti-phospho-Src Tyr416 (2101) from Cell Signaling Technology (Beverly, MA), anti-phosphotyrosine-specific PY20 antibody (610011) from BD Transduction Laboratories. Cy3-coupled anti-mouse antiserum (111-166-045) was purchased from Rockland Immunochemicals, Alexa 488-coupled anti-rabbit antiserum (A11008) from Molecular Probes (Eugene, OR), and horseradish peroxidasecoupled anti-mouse or anti-rabbit antisera from Pierce (Rockford, IL). The coding sequence of FAK-related non-kinase (FRNK) was kindly provided by Dr. G.v. Wichert (University of Ulm, Germany), isolated by PCR and cloned via EcoRI into the pEGFP C1 vector (BD Clonetech, Heidelberg, Germany). ß-Catenin cDNA was kindly provided by Dr. D. Wedlich (University of Karlsruhe, Germany) subcloned into Topo blunt vector (Invitrogen, Breda, the Netherlands) by PCR and transferred into pEGFP C1 expression vector (BD Clonetech) using the BamH1 restriction site. The expression plasmid encoding an E-cadherin-
-catenin fusion protein was kindly provided by Dr. A. Nagafuchi (Kumamoto University, Japan). Correct orientation and all reading frames were confirmed by sequencing (GATC Biotech, Konstanz, Germany) and Western blot analyses of expressed proteins. Cell culture. The pancreatic adenocarcinoma cell lines, Panc-1 and BxPC-3, (American Type Culture Collection, Rockville, MD; CRL-1469 and CRL-1687) were maintained in DMEM complemented with 10% FCS, 1% nonessential amino acids, and 1% L-glutamine (Invitrogen, Karlsruhe, Germany). For analysis of substrate-dependent differences, 1 x 106 cells were cultured in dishes (100 mm diameter) coated with type I collagen (human, 5 µg/cm2), fibronectin (human, 2 µg/cm2), or on tissue culture plastic (TCP; Becton Dickinson, Heidelberg, Germany). The seeding efficiency was 90% or more on all substrates estimated after 12 hours. Cells were cultured until they formed a confluent monolayer for at least 72 hours. The influence of ß1-containing integrins and Src on FAK phosphorylation was analyzed by the incubation of Panc-1 cells with pepsin-treated soluble type I collagen (10 µg/mL, Chemicon) for 12 hours, and with 20 µg/mL of an anti-ß1 integrin antibody for 12 hours or by incubation with the Src-specific inhibitor SU6656 (Calbiochem, San Diego, CA) for 3 hours. Experiments with different concentrations of SU6656 revealed that 0.5 µmol/L exhibited a sufficient reduction of Src activity in Panc-1 cells as measured using an enolase phosphorylation assay as described in ref. (4).
Transient transfection of Panc-1 cells cultured on the indicated substrates was done using DMRIE-C (Invitrogen, Karlsruhe, Germany) as transfection reagent at 70% of cell confluence according to the manufacturer's instructions.
Western blotting and immunoprecipitation. Protein analyses were done as previously described by Seidel et al. (27). Briefly, confluent grown cells were lysed with radioimmunoprecipitation assay buffer [1% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS, 150 mmol/L NaCl, 50 mmol/L Tris/HCl (pH 7.2), 10 mmol/L EDTA, 10 mmol/L EGTA] or for coimmunoprecipitation analyses with immunoprecipitation buffer [10 mmol/L Tris/HCl (pH 7.4), 150 mmol/L NaCl, 1% Triton X-100, 1% Nonidet P-40]. Both buffers contained 400 µmol/L aprotinin, 50 µmol/L leupeptin, and 0.5 mmol/L Pefabloc (Roche Diagnostics, Mannheim, Germany) to inhibit proteases. Homogenized lysates (500-2,000 µg) were immunoprecipitated with 4 µL of the indicated antibody and protein G-agarose (Roche Diagnostics). The immunoprecipitates were analyzed by SDS-PAGE and incubated with the indicated antibody for 1 hour. Immunoreactive proteins were visualized using enhanced chemiluminescence detection system (Pierce). Nuclear cell fractions were prepared as described by Nicholson et al. (28).
Triton X-100fractionated cell lysates were prepared as described by Hinck et al. (29) with minor modifications. Cells were rinsed twice with ice-cold PBS and incubated with 400 µL of Triton X-100 buffer per 100 mm dish (0.5% Triton X-100, 0.3 mol/L sucrose, 100 mmol/L NaCl, 3 mmol/L MgCl2, 1 mmol/L Pefabloc, 5 µmol/L aprotinin, and 10 µg/mL leupeptin) for 10 minutes on a rocking platform at 4°C. The cells were harvested with a rubber policeman, 30 µL was removed and homogenized. The remaining lysate was cleared with 10,000 x g for 10 minutes at 4°C. The supernatant containing the Triton X-100soluble fraction was collected and the remaining pellet was resuspended in 400 µL SDS buffer [1% SDS, 2 mmol/L EDTA, 2 mmol/L EGTA, 20 mmol/L Tris (pH 7.5), 1 mmol/L Pefabloc, 5 µmol/L aprotinin, and 1 µg/mL DNase I], and homogenized using a 25-gauge needle. After centrifugation at 10,000 x g for 10 minutes at 4°C, the supernatant contains a Triton X-100insoluble fraction. Equal volumes of both fractions corresponding to 15 µg of the Triton X-100insoluble fraction were analyzed by Western blotting. Densitometric analyses were done using ImageQuant software (Amersham Biosciences, Braunschweig, Germany).
Immunofluorescence microscopy. For protein localization, 2 x 105 cells were seeded on uncoated, type I collagen-, or fibronectin-coated coverslips (Becton Dickinson). After 3 to 5 days of confluence, cultures were fixed with 20°C cold methanol/acetone (1:1) for 10 minutes. Six independent samples from human pancreatic carcinoma and normal pancreas were provided by the Department of Pathology of the University of Ulm in accordance with local ethical regulations. Semi-thin sections of paraffin-embedded samples were incubated with anti-ß-catenin antibody for 1 hour at 37°C. Immunoreactive proteins were visualized with Cy3-coupled anti-mouse- or Alexa 488-coupled anti-rabbit antibody. The staining was examined using a Leica fluorescence microscope (DM TCS4 Leica Microsystems, Wetzlar, Germany) and the Openlab software (Improvision, Inc., Tuebingen, Germany).
Aggregation and proliferation assays. Cell proliferation was quantified by counting mitotic figures or total cell numbers of Panc-1 cells grown on uncoated or coated (fibronectin, type I collagen) coverslips. The cells were fixed at a confluence of 70% with ice-cold methanol/acetone (1:1) and stained with 4,6-diamidino-2-phenylindol (DAPI; 0.1 µg/mL). Mitotic figures were counted from five 120 x 120 µm fields per coverslip from three independent experiments. To verify these data, the total number of Panc-1 cells cultured on different substrates was counted on subsequent days. In 60 mm dishes, 5 x 104 cells were seeded on TCP, type I collagen, or fibronectin in triplicate. On subsequent days, the adherent cells were harvested and resuspended in PBS. The cell number was estimated in a cell counter CASY TTC (Schaerfe System, Reutlingen, Germany) using two different dilutions (30). Cell numbers per 60 mm dish and SD were calculated from three independent experiments. For statistical analysis, Student's t test was used and P < 0.05 was considered significant.
To determine the cell-cell adhesion capacity, cell aggregation was determined as described by Ozawa and Kemler (31). Cells were washed with PBS and carefully detached with 0.01% trypsin in HEPES-buffered saline (37 mmol/L NaCl, 5.4 mmol/L KCl, 0.34 mmol/L NaH2PO4, 5.6 mmol/L glucose, and 10 mmol/L HEPES) containing 2 mmol/L CaCl2, centrifuged, washed twice with HEPES buffer with 2 mmol/L CaCl2 and resuspended in the same buffer. Cells were allowed to re-aggregate by incubation with constant rotation of 70 rpm for 30 minutes. The number of aggregates was determined in an invert phase-contrast microscope (at a 10x magnification; Zeiss, Oberkochen, Germany). The extent of cell aggregation was calculated by the formula A = (No-Ne) / No, with No representing the total particle number at the start and Ne the total particle number after incubation for 30 minutes. To examine the calcium dependency, EDTA and EGTA were added to a final concentration of 5 mmol/L each. Three independent assays were done in duplicate.
Gene reporter assay. Panc-1 cells at 60% confluence were cotransfected with TOPflash or FOPflash promoter construct (Upstate, Charlottesville, VA) and a thymidine kinase promoter-driven renilla-luciferase vector (pRLTK; Promega, Mannheim, Germany). After 36 hours, cells were lysed and processed using the Dual Luciferase Kit (Promega) as described by the manufacturer. Luciferase activity was normalized to renilla firefly activity. The mean values and SD were calculated. For statistical analysis, Student's t test was used and P < 0.05 was considered significant.
RT-PCR studies. RNA was extracted using the RNeasy Mini Kit (Qiagen, Hilden, Germany). To produce complementary DNA, 2 µg of total mRNA was processed with the DuraScript RT-PCR Kit (Sigma-Aldrich). The semiquantitative PCR was done with primers for ß-actin (annealing at 60°C and 18 cycles), cyclin D1 (annealing at 54°C and 35 cycles), and c-myc (annealing at 52°C and 35 cycles; ß-actin: sense, GACTACCTCATGAAGATCCT; antisense, GCGGATGTCCACGTCACACT; cyclin D1: sense, ACGGCCGAGAAGCTGTGCAT; antisense TTCCAATCCGCCCTCCATGG; c-myc: sense, GACTCGGTGCAGCCGTATTTCTACT; antisense, CAGCTGGAGATGGTGACCGA).
| Results |
|---|
|
|
|---|
|
Panc-1 and BxPC-3 cells grown on type I collagen for 72 hours contained not only reduced E-cadherin but also reduced
- and ß-catenin concentrations as compared with cells grown on TCP or fibronectin (Fig. 1C). The relative protein amounts are given as small numbers in the lower part of the blots as determined by densitometric analyses.
In agreement with altered E-cadherin concentration in Triton X-100fractionated cell lysates, the association of
-catenin and ß-catenin with the actin cytoskeleton changed after collagen type I treatment in Triton X-100fractionated cell lysates. As shown in Fig. 1D, E-cadherin,
-, and ß-catenin were predominantly detected in the Triton-insoluble fractions of cells derived from both cell lines grown on TCP or fibronectin (Fig. 1D). This fraction is known to contain proteins which are connected with the cytoskeleton. In contrast, cells grown on type I collagen showed reduced amounts of E-cadherin as well as reduced
- and ß-catenin concentrations in the cytoskeleton-associated fraction. These results suggest a disruption of the E-cadherin adhesion complex in pancreatic carcinoma cells cultured on type I collagen. Whereas the reduction of total E-cadherin and catenin concentrations was detectable after 3 days of collagen stimulation (Fig. 1B, middle), the dissociation of the E-cadherin/catenin complex, estimated by Triton X-100 fractionation could be identified even after 12 hours of type I collagen treatment (Fig. 1C). The relative protein amounts are given as small numbers in the lower part of the blots as determined by densitometric analyses.
To test the influence of collagen type I stimulation on cell-cell aggregation, we did a rotation aggregation assay in the presence of pepsin-digested, soluble collagen type I or fibronectin using cells grown for 24 hours on substrate-coated dishes. As shown in Fig. 1E, collagen-stimulated Panc-1 or BxPC-3 cells exhibited a reduced aggregation capacity compared with fibronectin-stimulated or unstimulated cells. In contrast, Panc-1 cells expressing a fusion protein of E-cadherin and
-catenin, which is insensitive to modifications of catenins, did not show the collagen type Iinduced reduction of cell aggregation (Fig. 1F). These data point to a collagen-induced disassembly of the E-cadherin adhesion complex and subsequently to reduced cell-cell aggregation.
Because alterations in tyrosine phosphorylation of ß-catenin represent an important mechanism leading to dissociation of the E-cadherin complex (3234), we studied tyrosine phosphorylation of E-cadherin as well as
- and ß-catenin in pancreatic cancer cells grown on different ECM proteins. To analyze the phosphorylation state of catenins and, moreover, the kinases which may be involved in the regulation of the E-cadherin complex, we chose a collagen incubation time of 12 hours to ensure that enough amounts of E-cadherin complex was left for immunoprecipitation analyses. As shown in Fig. 2A
, the phosphorylation of ß-catenin was exclusively increased in Panc-1 cells cultured on type I collagen compared with ß-catenins isolated from cells grown on TCP or fibronectin. Phosphorylation of
-catenin was slightly increased in Panc-1 cells cultured on type I collagen. We could not detect altered tyrosine phosphorylation of E-cadherin in the lysates of both cell lines (data not shown). Comparable results were obtained using BxPC-3 cells (data not shown).
|
Collagen type I promotes association of the kinase FAK with the E-cadherin complex. To study the molecular mechanisms resulting in an enhanced phosphorylation of ß-catenin, we analyzed the role of the tyrosine kinases FAK and Src. Immunofluorescence localization of FAK in Panc-1 cells grown on type I collagen showed an enhanced membranous localization in the apical part of Panc-1 cells compared with cells cultured on TCP (Fig. 2D). In cells grown on fibronectin, we could detect only a faint and discontinuous FAK staining at the plasma membrane (Fig. 2D). Focusing on the apical part of cells ensures that altered FAK localization at cell-cell adhesion points could be visualized, whereas altered FAK concentrations in basal focal adhesion contacts were not recorded.
Using immunoprecipitation experiments, we analyzed the altered FAK localization in more detail. As shown in Fig. 2E, we could show that a high amount of FAK was associated with the E-cadherin adhesion complex in Panc-1 cells cultured on type I collagen. In contrast, Panc-1 cells grown on TCP or fibronectin showed only small amounts of FAK coprecipitated with E-cadherin. The total amount of cellular FAK remains unchanged, irrespective of the different substrates (Fig. 2F).
In addition to changes in the localization of the FAK, we investigated whether the collagen-induced translocation of FAK to the E-cadherin complex is associated with changes in its kinase activity. Because phosphorylation of FAK at Tyr576 has been associated with increased FAK kinase activity (35), we analyzed the phosphorylation at Tyr576 of FAK proteins. To analyze only that part of the FAK pool, which is associated with the E-cadherin complex, we used coimmunoprecipitation experiments. The studies revealed an increased phosphorylation of Tyr576 of E-cadherinassociated FAK only in lysates of type I collagenstimulated cells (Fig. 2G). Panc-1 cells grown on fibronectin or TCP did not exhibit an increased FAK phosphorylation (Fig. 2G). Similar results were obtained from experiments with BxPC-3 cells (data not shown). Moreover, we could show that phosphorylation of Tyr397, an autophosphorylation site of FAK, was also increased in type I collagenstimulated Panc-1 cells (data not shown).
We have previously shown that activation of the cellular kinase Src is correlated with the disruption of the E-cadherin complex (4). In the present study, we asked whether Src is directly associated with the E-cadherin complex. Using coimmunoprecipitation experiments, E-cadherin was precipitated from up to 4 mg of Panc-1 or BxPC-3 cell lysate, but we could not detect Src associated with E-cadherin (data not shown).
Collagen-induced activation of FAK is mediated by integrins and Src. To analyze the signaling cascade leading to FAK phosphorylation induced by type I collagen, we examined the role of integrins, which represent the best-known cellular collagen receptors (36). ß1-containing integrins have been described to activate the kinases Src and FAK after binding to collagen (37). We have previously shown that collagen type I activates Src kinase activity in pancreatic carcinoma cells using an enolase phosphorylation assay (4). In particular, we analyzed whether the observed activation of FAK depends on ß1-containing integrins and whether the kinase Src is involved in FAK activation. The addition of a neutralizing antibody which blocks the binding of integrins to type I collagen was used to study the effects of ß1 integrin inhibition on Src and FAK activity. The Src activity was investigated by analyzing phosphorylation of Tyr416, which has been shown to be critical for its kinase activity (38). As shown in Fig. 3A , inhibition of ß1-containing integrins resulted in reduced Src phosphorylation. Additionally, inhibition of the interaction between ß1-integrins and collagen prevents the phosphorylation of E-cadherinassociated FAK at Tyr576 (Fig. 3B), indicating a reduced kinase activity of FAK which is linked to the E-cadherin complex. The addition of an antibody directed against N-cadherin, which is not present in Panc-1 cells, did not influence the phosphorylation of Src at Tyr416 or FAK at Tyr576.
|
FAK induces ß-catenin phosphorylation in response to collagen type I. To investigate whether the activated FAK contributes to enhanced phosphorylation of ß-catenin, we expressed a dominant-negative FAK mutant FRNK as EGFP-tagged protein in Panc-1 cells and analyzed its influence on ß-catenin phosphorylation in response to different substrates. To analyze only ß-catenin of cells, which were successfully transfected, we cotransfected EGFP-FRNK and EGFP-ß-catenin. Subsequently, we immunoprecipitated EGFP-ß-catenin using a GFP antibody. As shown in Fig. 4A , the expression of EGFP-FRNK and EGFP-ß-catenin in Panc-1 cells on type I collagen (lane 4) decreased the tyrosine phosphorylation of cotransfected EGFP-ß-catenin compared with cells which expressed EGFP-ß-catenin alone (lane 2). In Panc-1 cells cultured on TCP, the transfection of either EGFP-ß-catenin or EGFP-ß-catenin and EGFP-FRNK did not result in alterations of ß-catenin tyrosine phosphorylation (lanes 1 and 3). The expression of similar amounts of EGFP-FRNK and EGFP-ß-catenin was verified by immunoblotting and staining with anti-GFP antiserum (Fig. 4B).
|
|
|
| Discussion |
|---|
|
|
|---|
In this study, we show for the first time that collagen Iactivated FAK is recruited to the E-cadherin complex. FAK contributes directly or indirectly to enhanced tyrosine phosphorylation of ß-catenin, leading to a disruption of the E-cadherin adhesion complex.
There is growing evidence pointing towards a role of FAK in the regulation of cadherin-dependent cell-cell adhesion beside its function in cell-matrix adhesion. In addition to the influence of FAK on deregulation of N-cadherinmediated adhesion (42), recent data shows that FAK plays a role in the assembly of the E-cadherin complex in colon cancer (37, 43). Our results show that activated FAK is directly associated with the E-cadherin complex. They are in line with the data of Avizienyte and colleagues who said that the expression of FAK mutants, which could not be phosphorylated by Src kinase, resulted in increased E-cadherinmediated cell-cell adhesion (37). Furthermore, it has been shown that the expression of the dominant-negative FAK mutant, FRNK, specifically suppressed invasion and metastasis, but it did not interfere with enhanced cell motility (44). The interpretation that increased FAK activity is involved in the promotion of cell invasion is further supported by experiments using FAK/ fibroblasts. Expression of v-Src in FAK/ fibroblasts resulted in the restoration of cell motility, but it did not induce an invasive phenotype (45).
The molecular mechanisms which lead to FAK activation is not entirely clear. It has been convincingly shown that FAK acts downstream of ß1-intregins (46, 47). Together with the reduced FAK phosphorylation after inhibition of integrin ß1, as shown in this study, we suggest that collagen-ligated ß1-integrins initiate the signaling cascade, leading to disassembly of the E-cadherin adhesion complex. Moreover, we show that activation of Src kinase in response to collagen type I is necessary to obtain FAK activity in pancreatic cancer cell lines. There are several reports in the literature saying that the Src kinase could act as an activator of FAK. Experiments from Salazar and Rozengurt showed that Src could induce FAK activity by tyrosine phosphorylation at Tyr397 (48). Recently, Hauck et al. showed that expression of activated Src resulted in a stable v-Src-FAK signaling complex, which correlated with enhanced invasion in vitro (49). Altogether, these results imply that Src acts upstream of FAK but downstream of integrins in collagen-induced FAK activation in pancreatic cancer cells.
For the first time, we could show in this study, an association of activated FAK with the E-cadherin complex which is increased in response to collagen type I stimulation. Although we have not shown the direct phosphorylation of ß-catenin by FAK, we could show a subsequently enhanced tyrosine phosphorylation of ß-catenin and the dissociation of E-cadherin from the actin cytoskeleton. Furthermore, our data shows that FAK activity was necessary to achieve the collagen-induced ß-catenin phosphorylation (Figs. 3 and 4). We cannot exclude that the ß-catenin modulation induced by activated FAK may be facilitated indirectly by an intermediate kinase.
Several reports support that enhanced tyrosine phosphorylation of ß-catenin leads to an inhibition of E-cadherinmediated cellular aggregation (3234). Recently, the phosphorylation of tyrosine residues Y142, Y489, and Y654 of human ß-catenin has been described to be involved in the regulation of ß-catenin-E-cadherin or
-catenin/ß-catenin binding [reviewed recently by Lilien and Balsamo (34)]. It remains to be established which tyrosine residue in ß-catenin is phosphorylated in response to FAK activation in pancreatic carcinoma cells. Some studies suggest that Src or another member of the Src family, i.e., Yes, may be able to phosphorylate ß-catenin. Especially Tyr654 of ß-catenin, which has been identified as a target of the activated epidermal growth factor receptor or v-Src (6, 7, 34). In comparison, we could not detect Src associated with the E-cadherin complex using coimmunoprecipitation experiments in collagen-stimulated pancreatic cancer cells.
An alternative hypothesis, which may explain the reduced cellular adhesion, has been suggested by Sander and colleagues. They show that activation or relocalization of the GTPase Rac1, induced by collagen type I, decreased E-cadherinmediated cellular adhesion by inhibition of actin filament polymerization at sites of E-cadherin/catenin complexes (41). Here, we could show that the expression of an E-cadherin-
-catenin fusion protein in collagen-stimulated Panc-1 cells prevented the loss of cell-cell adhesion. This fusion protein has been shown to be resistant to destabilizing modulations of the E-cadherin/catenin adhesion complex, such as phosphorylation of catenins or E-cadherin, but it needs an association with the actin cytoskeleton to achieve strong cell-cell adhesion (50). These data suggest that the regulation of the E-cadherin/catenin complex stability play a pivotal role in the collagen-induced reduction of cell-cell adhesion and that the reduced cellular adhesion is not only induced by alteration of the actin cytoskeleton assembly. Although, we do not exclude that regulation of the actin cytoskeleton induced by GTPases provides an additional decrease of cell-cell adhesion in pancreatic carcinoma cells.
In addition, we show in this study a collagen type Iinduced nuclear localization of ß-catenin in pancreatic carcinoma cells. This aberrant localization correlates with enhanced expression of the ß-catenin target genes c-myc and cyclin D1, and an increased cellular proliferation rate. The influence of ß-catenin-Lef/Tcfinduced gene expression for the progression of colon cancer has been recently established by Brabletz et al. (51). The authors showed that ß-catenin was removed from cell-cell adhesion and was localized in the nucleus, especially in tumor cells located near the invasive front (51). Activated ß-catenin-Lef/Tcf transcription factors have been identified to increase not only the proliferation but also the migration of epithelial cells (13, 52). Several clinical studies underline the importance of ß-catenin in the development of pancreatic cancer. Reduced membranous and increased cytoplasmic localization of ß-catenin correlates negatively with tumor stage and survival of patients suffering from pancreatic adenocarcinoma (53, 54). A recent study elucidated a significant reduction of membranous E-cadherin and aberrant nuclear localization of ß-catenin in high-grade pancreatic intraepithelial neoplasia lesions or adenocarcinoma compared with low-grade pancreatic intraepithelial neoplasia lesions or normal ducts (55).
In conclusion, we could show that components of the ECM, i.e., collagen type I, produced by the tumor in large quantities reduce cellular adhesion and support proliferation in pancreatic cancer. The dissociation of the E-cadherin adhesion complex is mediated by translocation of activated FAK to the E-cadherin adhesion complex. This is correlated with increased nuclear amounts of ß-catenin which cooperate with Lef/Tcf transcription factors to enhance expression of the cell cycle proteins and promotes proliferation of pancreatic cancer cells.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank S. Braeg and C. Laengle for excellent technical assistance, and Drs. Y. Imamichi, K. Giehl, and U. Dreissigacker for helpful discussions.
| Footnotes |
|---|
Received 8/ 8/05. Revised 1/24/06. Accepted 2/24/06.
| References |
|---|
|
|
|---|
-catenin from the E-cadherin.catenin complex. J Biol Chem 1998;273:616670.
catenin fusion molecules. J Cell Biol 1994;127:23545.This article has been cited by other articles:
![]() |
K. M. Bailey and J. Liu Caveolin-1 Up-regulation during Epithelial to Mesenchymal Transition Is Mediated by Focal Adhesion Kinase J. Biol. Chem., May 16, 2008; 283(20): 13714 - 13724. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sengupta, J. A. den Boon, I-H. Chen, M. A. Newton, S. A. Stanhope, Y.-J. Cheng, C.-J. Chen, A. Hildesheim, B. Sugden, and P. Ahlquist MicroRNA 29c is down-regulated in nasopharyngeal carcinomas, up-regulating mRNAs encoding extracellular matrix proteins PNAS, April 15, 2008; 105(15): 5874 - 5878. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Shintani, Y. Fukumoto, N. Chaika, R. Svoboda, M. J. Wheelock, and K. R. Johnson Collagen I-mediated up-regulation of N-cadherin requires cooperative signals from integrins and discoidin domain receptor 1 J. Cell Biol., March 24, 2008; 180(6): 1277 - 1289. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Shintani, M. Maeda, N. Chaika, K. R. Johnson, and M. J. Wheelock Collagen I Promotes Epithelial-to-Mesenchymal Transition in Lung Cancer Cells via Transforming Growth Factor Signaling Am. J. Respir. Cell Mol. Biol., January 1, 2008; 38(1): 95 - 104. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kase, M. Osaki, I. Sato, S. Takahashi, K. Nakanishi, K. Yoshida, H. Ito, and S. Ohno Immunolocalisation of E-cadherin and {beta}-catenin in human pterygium Br. J. Ophthalmol., September 1, 2007; 91(9): 1209 - 1212. [Abstract] [Full Text] [PDF] |