Cancer Research Cell Death Mechanisms and Cancer Therapy  Telomeres
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fukuyama, T.
Right arrow Articles by Yasumoto, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fukuyama, T.
Right arrow Articles by Yasumoto, K.
[Cancer Research 66, 4922-4928, May 1, 2006]
© 2006 American Association for Cancer Research


Immunology

Identification of a New Cancer/Germline Gene, KK-LC-1, Encoding an Antigen Recognized by Autologous CTL Induced on Human Lung Adenocarcinoma

Takashi Fukuyama, Takeshi Hanagiri, Mitsuhiro Takenoyama, Yoshinobu Ichiki, Makiko Mizukami, Tetsuya So, Masakazu Sugaya, Tomoko So, Kenji Sugio and Kosei Yasumoto

Second Department of Surgery, School of Medicine, University of Occupational and Environmental Health, Kitakyushu, Japan

Requests for reprints: Kosei Yasumoto, Second Department of Surgery, School of Medicine, University of Occupational and Environmental Health, 1-1 Iseigaoka, Yahatanishi-ku, Kitakyushu 807-8555, Japan. Phone: 81-93-603-1611; Fax: 81-93-692-4004; E-mail: k-yasumo{at}med.uoeh-u.ac.jp.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The purpose of our present study is to identify a tumor-specific antigen capable of inducing a specific cellular immune response in lung cancer patients. We established a lung adenocarcinoma cell line, designated as F1121L, and induced tumor-specific CTL clone H1 from regional lymph node lymphocytes of patient F1121. CTL clone H1 lysed autologous tumor cells in an HLA-B*1507-restricted manner, but not autologous EBV-B, phytohemagglutinin-blast cells, and K562. The CTL clone also recognized allogeneic HLA-B*1501- or 1507-positive lung cancer cell lines in the HLA-restricted manner. Using the CTL clone, we identified an antigen-coding gene by cDNA expression cloning technique. The gene consisted of 556 bp, including an open reading frame consisted of 113 amino acids, designated as Kita-kyushu lung cancer antigen 1 (KK-LC-1). A 9-mer peptide (KK-LC-176-84; RQKRILVNL) was identified as an epitope peptide. The genomic DNA of this antigen was located in chromosome Xq22. A reverse transcription-PCR analysis revealed that the mRNA of this gene was only expressed in the testis among normal tissues. It was expressed in 9 of 18 (50%) allogeneic non–small-cell lung cancer cell lines and in 40 of 100 (40%) non–small-cell lung cancer tissues. We thus identified a new tumor antigen–coding gene categorized as a cancer/germline gene by an autologous lung cancer and CTL system. The new cancer/germline gene was located in Xq22, which is apparently different from the locations of previously reported cancer/germline genes. (Cancer Res 2006; 66(9): 4922-8)


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Lung cancer is the leading cause of cancer deaths in the developed countries, accounting for ~30% of all cancer deaths. The long-term prognosis of patients with lung cancer is poor and the overall survival rate has been reported to be as low as 11% to 14% (1). Although surgical treatment can sometimes be a curative option for lung cancer, the poor prognosis of lung cancer patients depends, in part, on the relative low sensitivity of lung cancers to both radiotherapy and chemotherapy (2). Moreover, two thirds of lung cancer patients tend to present at an advanced stage at the time of diagnosis. The results of combined modality therapy, such as a surgical resection, chemotherapy, and radiotherapy, are still not satisfactory for patients in advanced stage. As a result, the development and application of new therapeutic strategies are essential for improving the prognosis of this disease.

Since the discovery of the first human tumor-specific antigen in 1991 (3), a large number of targets for tumor-specific CTLs have been identified (4, 5). Some of these antigens have been applied for cancer vaccination, and clinical effectiveness was induced in a certain population of melanoma patients (6, 7). However, the candidates for vaccine trials are limited because they must express a particular HLA molecule and their tumors must also express a corresponding tumor-associated antigen. Therefore, it is very important to identify a number of antigens capable of binding to a variety of HLA molecules. The development of effective vaccine-based immunotherapy for lung cancer patients depends on (a) the identification of appropriate antigens expressed selectively in lung cancers; (b) the presence of T-cell precursors that recognize tumor cells expressing relevant antigens; (c) the ability to deliver activated effector cells to tumor site; and (d) the overcoming of immunosuppressive circumstance around the tumor site.

We previously established 15 lung cancer cell lines from surgical specimens (8). We reported that tumor-specific CTL clones could be induced from regional lymph node lymphocytes in lung cancer patients (913). In this study, we identified a new cancer/germline antigen recognized by CTL using cDNA expression cloning method. The new antigen, designated as Kita-kyushu lung cancer antigen 1 (KK-LC-1), should be a promising target for a specific immunotherapy because they are expressed in a substantial proportion of allogeneic lung cancer tissues, but not in normal tissues except for the testis.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The study protocol was approved by the Human and Animal Ethics Review Committee of University of Occupational and Environmental Health, Japan and a signed consent form was obtained from each subject before taking the tissue samples used in this study.

Culture medium. Culture medium consisted of RPMI 1640 (Life Technologies, Inc., Grand Island, NY) supplemented with 10% heat-inactivated FCS (Equitech-bio, Ingram, TX), 10 mmol/L HEPES, 100 units/mL of penicillin G, and 100 mg/mL of streptomycin sulfate (11).

Establishment of the tumor cell line. F1121L (HLA-A*0201/2402, B*1507/4006, Cw*0303/0801), a lung adenocarcinoma cell line, was established from the surgical specimen obtained from a 69-year-old patient (F1121). The method used to establish the lung cancer cell line has previously been described (13). Briefly, fresh tumor tissue was excised from surgical specimen and then was minced into small pieces with scissors. The minced tissue specimens were shaken with a mixture of 0.1 mg/mL of DNase type I, 1 mg/mL of collagenase type IV, and 0.5 mg/mL of hyaluronidase type V (Sigma, St. Louis, MO) in culture medium at 150 rpm at 37°C for 1 hour. Thereafter, the cells were placed in a flask and have been maintained as a monolayer culture by serial passages in RPMI 1640 with 10% FCS.

The histologic types of other lung cancer cell lines used are adenocarcinoma (A110L, A129L, A925L, B203L, B901L, C422L, D611L, E522L, G821L, and H1224L), squamous cell carcinoma (B1203L and H1215L), large cell carcinoma (A904L and C831L), adenosquamous carcinoma (A529L), large cell neuroendocrine carcinoma (J206L), and pleomorphic carcinoma (G603L). F1121 EBV transformed B cells (EBV-B; HLA-A*0201/2402, B*1507/4006, Cw*0303/0801) were produced from this patient's (F1121) peripheral blood mononuclear cells by infection with supernatant from EBV producer line B95.8. F1121 phytohemagglutinin-blast cells were induced by stimulating the peripheral blood mononuclear cells with 1 µg/mL of phytohemagglutinin-P (Difco Laboratories, Detroit, MI) and 200 units/mL of recombinant interleukin (IL)-2 (Takeda Chemical Industries, Osaka, Japan) for 48 hours. Rosi EBV-B (HLA-A*2402/3201, B*3503/44031, Cw*0401/0401), tumor necrosis factor (TNF)–sensitive WEHI-164cl3 cells, and 293-EBNA cells were kindly donated by Dr. P.G. Coulie (Cellular Genetics Unit, Université Catholique de Louvain, Brussels, Belgium). WEHI-164cl3 cells were maintained in culture medium with 5% FCS; 293-EBNA cells were maintained in DMEM (Life Technologies, Gaithersburg, MO) with 5% FCS; and the other cell lines were maintained in culture medium with 10% FCS.

Preparation of regional lymph node lymphocytes and induction of CTL. The regional lymph nodes from F1121 patient were obtained at the time of surgery. Each lymph node was divided into two parts for the histologic diagnosis and for this study. The latter part of each lymph node was mixed and prepared for regional lymph node lymphocytes as previously described (11). Regional lymph node lymphocytes were frozen in a deep freezer at –130°C until use.

Regional lymph node lymphocyte obtained as described above were rapidly thawed, washed twice, and stimulated weekly with irradiated (100 Gy) F1121L at tumor cell-to-lymphocyte ratio of 1:10 in culture medium with 20 units/mL of IL-2 (kindly donated by Takeda Chemical) for 4 weeks in 24-well plates (Iwaki Glass, Tokyo, Japan) at 37°C in a 5% CO2 atmosphere as previously reported (11). The CTL activity was assessed at 7 days after the fourth stimulation.

To generate T-cell clones, limiting dilution was done from the bulk CTL line 7 days after the last stimulation as previously described (14). The cells were seeded at 0.1, 0.3, 1, or 3 per well in 96-well round-bottomed plates and stimulated under the following culture condition: culture medium with irradiated F1121L cells and Rosi EBV-B cells as a feeder in the presence of IL-2 (100 units/mL), IL-4 (5 ng/mL), and IL-7 (5 ng/mL). Thereafter, the irradiated stimulator cells and feeder cells were added to each well for restimulation of the lymphocytes once a week with culture medium containing IL-2, IL-4, and IL-7.

Cytotoxic activity of the CTL clone. The cytotoxic activity of CTL was assessed by a standard 51Cr release assay. Briefly, the target cells were labeled for 90 minutes with 100 µCi of 51Cr at 37°C. The labeled target cells were washed twice and seeded at 1,000 per well in 96-well round-bottomed plates. The CTLs were cocultured at an indicated effector/target ratio (ratio, 1:1, 3:1, 10:1, and 30:1) for 4 hours at 37°C. The supernatant (100 µL) was collected and then counted for 1 minute in a gamma counter. The percent specific lysis was calculated with the following formula: % lysis = (observed cpm of test sample – spontaneous cpm of target cells with medium) / (maximum cpm of target cells with 0.5% Triton X-100 – spontaneous cpm of target cells with medium) x 100.

Measurement of cytokine production by the CTL clone. To assess the activity of CTL clone in response to target tumor cells, both TNF and IFN-{gamma} were measured. The TNF production of the CTL clone was measured by the WEHI assay using TNF-sensitive WEHI cells (15). Briefly, CTLs (6 x 104/mL) were added to 96-well flat-bottomed plates and incubated with tumor cell lines (6 x 105/mL). After 6 hours, the supernatant was collected and WEHI cells (6 x 105/mL) were added for evaluation of the cytotoxic effect (16). IFN-{gamma} production in the supernatant was measured using a Human IFN {gamma} ELISA Test Kit (BioSource, Camarillo, CA) according to the instruction manual.

Monoclonal antibody used for blocking assay. Hybridomas (HB-145, HB-95, and HB-82) were purchased from American Type Culture Collection (Rockville, MD). C7709.A2.6 (anti-HLA-A24) and B1.23.2 (anti-HLA-B, C) were kindly donated by Dr. P.G. Coulie. The culture supernatants of ATCC HB-145 (IVA12; anti-HLA-DR, DP, DQ), HB-95 (W6/32; anti-HLA-A, B, C), HB-82 (BB7.2; anti-HLA-A2), C7709.A2.6, and B1.23.2 were used for the analysis of the HLA restriction of T-cell clones.

Flow cytometry for expression of HLA class I antigens. For evaluation of expression of HLA class I on the cell surface, the tumor cells (2 x 105) were incubated with either fluorescein-conjugated HLA-A, B, and C monoclonal antibody (mAb) or control immunoglobulin G for 30 minutes at 4°C. Thereafter, they were washed and assessed using a flow cytometer (EPICS XL, Coulter International, Fullerton, CA) as previously described (17).

Assessment of HLA class I restriction of the CTL. The cDNA derived from F1121-EBV-B cell was served as a template for PCR amplification with Pfu DNA polymerase (Stratagene, Alameda, CA) using each HLA-B, C specific primers (HLA-B, CGGGATCCGCCGAGATGCGGGTCA and ACTGCCCGAATTCTCTCAGTCCCTCCACAAAGGCAGCTGTC; HLA-Cw, CGGGATCCGCCGAGATGCGGGTCA and CGGAATTCTCAGGCTTTACAAGCGATGAGA). The PCR products were cloned and ligated into the pcDNA3 by a TA Expression Kit (Invitrogen, Carlsbad, CA).

To determine the HLA restriction of the CTL clone, 100 ng of each HLA molecule possessed by F1121L were separately transfected into B1203L using a Lipofectamine reagent (Invitrogen, Carlsbad, CA) according to instruction manual. CTL and these HLA transfectants were cocultured overnight at 37°C in 5% CO2 atmosphere. Supernatant was applied for measurement of TNF as described above.

Construction and screening of the cDNA library. The CTL clone also recognized B203L; therefore, cDNA library was constituted from mRNA of B203L, an allogeneic lung cancer cell line. Approximately 5 µg of polyadenylated RNA extracted from B203L with the FastTrack kit (Invitrogen, Carlsbad, CA) were converted to cDNA with Superscript Choice System (Life Technologies, Grand Island, NY) using an oligo(dT) primer [5'-ATAAGAATGCGGCCGCTAAACTA(T)18VZ-3'; V = G, A, or C; Z = G, A, T or C] containing a NotI site at its 5' end. The cDNA was ligated to HindIII-EcoRI adaptors (Stratagene, Heidelberg, Germany), phosphorylated, digested with NotI, and inserted at the HindIII and NotI sites of expression vector pCEP4 (Invitrogen, Carlsbad, CA). This plasmid contains the EBV origin of replication, resulting in episomal multiplication of transfected with EBV EBNA-1 gene. Escherichia coli TOP10 (Invitrogen, Carlsbad, CA) was transformed by electroporation with the recombinant plasmids and selected with ampicilin (50 µg/mL). The library was divided into 1,544 bacteria pools, each containing 100 clones. Each pool was amplified for 4 hours and plasmid DNA was extracted using QIA prep 8 plasmid Kit (Qiagen, Hilden, Germany). 293 EBNA cells, plated in flat-bottomed 96-well plates (3.0 x 104 per well) 24 hours before transfection, were duplicate microcultures cotransfected with 1.1 µL of Lipofectamine reagent (Invitrogen, San Diego, CA), plasmid DNA (100 ng) of each pool in cDNA library, and 50 ng of HLA cDNA. After 24 hours, CTLs (3.0 x 103 per well) were cocultured with these transfectants for 24 hours at 37°C in 5% CO2 atmosphere. The supernatant was collected to measure the TNF as described above.

Identification of antigenic peptide. To determine the antigenic peptide, the affinity of the peptide to the HLA was predicted by using peptide anchor motif for HLA-B*1501 and a computer algorithm from the Bioinformatics and Molecular Analysis Section of NIH (BIMAS; ref. 18), which ranks the potential MHC-binding peptides according to the predictive one-half-time dissociation of peptide/MHC complexes. The critical motifs for binding with HLA-B15 are glutamine at position 2, isoleucine (hydrophobic residue) at position 5, and phenylalanine or tyrosine at position 9. We selected two nonapeptides (LSRDILNNF: KK-LC-162-70 and RQKRILVNL: KK-LC-176-84) for candidate on the basis of anchor motif for HLA-B15. According to the prediction score by BIMAS, binding prediction scores for HLA-B15 of KK-LC-162-70 and KK-LC-176-84 were 6.6 and 28.8, respectively. On the basis of these data, one nonapeptide (RQKRILVNL: KK-LC-176-84) was synthesized. The autologous EBV-B was loaded with the nonapeptide and cytolytic activity of CTL clone against the peptide loaded EBV-B was determined by 51Cr release assay.

RNA isolation and reverse transcription-PCR analysis of antigen-coding gene. The total RNA from the cell lines, specimens of lung cancer, and normal tissues was isolated by using RNeasy Mini Kit (Qiagen), and it was converted to cDNA using an oligo(dT) primer. Screening of the identified antigen and ß-actin was done by PCR. PCR amplification was done in 20 µL of PCR mixture containing 1 µL cDNA template, deoxynucleotide triphosphate (Takara, Shiga, Japan), and 500 nmol/L of primers described below. The PCR mixture was initially incubated at 94°C for 5 minutes, followed by a cycle of denaturation at 94°C for 30 seconds, annealing for 30 seconds, and extension at 72°C for 1 minute. The cycles of PCR, annealing temperature, and size of PCR product are described below. Reverse transcription-PCR (RT-PCR) for ß-actin was done with GGCATCGTGATGGACTCCG and GCTGGAAGGTGGACAGCGA as primers at an annealing temperature of 68°C and 24 cycles, yielding a 615-bp product. For RT-PCR of KK-LC-1, ATGAACTTCTATTTACTCCTAGCGAGC and TTAGGTGGATTTCCGGTGAGG were used as specific primers at an annealing temperature of 67°C and 35 cycles.

Quantitative RT-PCR was carried out in ABI PRISM 7000 (Applied Biosystems, Foster, CA). The relative amount of KK-LC-1 mRNA was measured by means of detection of intercalated SYBR green. PCR was done with 25 µL of SYBR Green PCR Master Mix (Applied Biosystems), either 1 µL of cDNA or 1 µL of water and each primer set described below in a total volume of 50 µL. The PCR cycles were 95°C for 10 minutes, followed by 45 cycles of 95°C for 15 seconds and 67°C for 1 minute. The primer sequences of KK-LC-1 for quantitative RT-PCR were ATGAACTTCTATTTACTCCTAGCGAGC and CTACAATATTGAGTGTGGGAAATTATTTAA. The quantitative PCR primer sequences of ß-actin were same ones as those used in the screening of ß-actin. The concentration of each primer set was 200 and 100 nmol/L for the identified gene and ß-actin. The threshold cycle number (CT) was defined as a fractional cycle number at which the amount of amplified target product reaches a fixed threshold. {Delta}CT was obtained by comparing CT of KK-LC-1 with CT of ß-actin in same amount of templates. Relative quantification was achieved by comparisons with {Delta}CT of F1121L. The relative expression was calculated by the following formula: relative expression = 2–({Delta}CT sample{Delta}CT F1121L).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Generation of the CTL clone recognizing the autologous adenocarcinoma cell line. Regional lymph node lymphocytes (4 x 107) were stimulated with irradiated F1121L (tumor-to-lymphocyte ratio, 1:10) in the presence of IL-2 (20 units/mL). After four weekly tumor stimulations, the bulk CTL line was induced from the regional lymph node lymphocyte. The bulk CTL was cloned by a limiting dilution, and then CTL clone H1 was finally established. CTL clone H1 responded to the autologous tumor cell line F1121L, but not to F1121 EBV-B, F1121 phytohemagglutinin-blast, or K562 (Fig. 1A ).


Figure 1
View larger version (10K):
[in this window]
[in a new window]
 
Figure 1. Characteristics of the autologous tumor-specific CTL clone H1. A, the cytotoxic activities of CTL clone H1 were assessed by a standard 4-hour 51Cr release assay. The CTL clone H1 recognized autologous tumor cell line (F1121L) but not F1121 EBV-B cells, F1121 phytohemagglutinin-blast cells (PHA-blast), or K562. B, HLA restriction of CTL clone H1 was assessed by IFN-{gamma} production. IFN-{gamma} production was partially suppressed by the addition of anti–HLA class I or anti-HLA B/C mAb. C, CTL clone H1 was cocultured with the allogeneic tumor (B1203L) after transfection with each HLA, which was expressed in F1121L. TNF was produced when the CTL was cocultured with B1203L transfected with HLA-B*1507.

 
Determination of HLA class I restriction. IFN-{gamma} production of CTL clone H1 in response to F1121L was inhibited by the addition of anti-MHC class I mAb or anti HLA-B/C mAb (Fig. 1B). To determine HLA class I restriction of CTL clone H1, HLA-B*1507, B*4006, Cw*0303, and Cw*0801 were cloned from F1121 L, and each of them was transfected into the allogeneic tumor cell line B1203L. CTL clone H1 produced TNF in response to the allogeneic B1203L after HLA-B*1507 transfection (Fig. 1C). These results suggested that the target antigen was shared by the allogeneic tumor (B1203L), except for the autologous one, and that CTL clone H1 was restricted by HLA-B*1507.

Identification of the cDNA clone encoding specific antigen. A cDNA library prepared from mRNA of B203L, to which CTL clone H1 could respond as shown in Table 1 , was cloned into expression vector pCEP4. The screening of the cDNA library was done by measuring the TNF production of CTL clone H1 in response to 293 EBNA cells cotransfected with HLA-B*1507 and each cDNA fraction. One positive pool of cDNA was obtained. The cDNA pool was subcloned from 100 to 12 clones, and finally a single cDNA clone (cDNA clone 2B35) was isolated. The isolated cDNA clone was proved to be 556 bp with polyadenylate tail by direct sequence. CTL clone H1 showed TNF production in response to 293 EBNA cells cotransfected with cDNA clone 2B35 and HLA-B*1507, but not with any of other cDNA (Fig. 2A ). The identified cDNA has been reported to be a function of an unknown gene expressed in testis according to databank (BLAST accession no. BC062223; ref. 19). This gene was designated as KK-LC-1.


View this table:
[in this window]
[in a new window]
 
Table 1. Effect of IFN-{gamma} treatment and/or transfection of HLA-B*1507 for allogeneic tumor cell lines on CTL reactivity

 

Figure 2
View larger version (7K):
[in this window]
[in a new window]
 
Figure 2. Identification of the antigen-coding gene and antigenic peptide recognized by the CTL clone H1. A, 293 cells were transfected with cDNA plasmid of HLA-B*1507 and/or cDNA clone 2B35. The cDNA clone 1 as irrelevant cDNA (one of the B203L cDNA clones used in cDNA expression cloning method) was also transfected with HLA-B*1507. A high level of TNF production of CTL clone H1 was observed against 293 cells cotransfected with cDNA clone 2B35 and HLA-B*1507. B, 51Cr-labeled F1121 EBV-B cells were incubated for 1 hour at room temperature with indicated concentrations of the peptide. CTL clone H1 recognized the EBV-B pulsed with the peptide KK-LC-176-84 in a dose-dependent manner. Mutated p53 peptide (TRVLAMAIY) was used as an irrelevant peptide.

 
Identification of the antigenic peptide recognized by the CTL clone. To identify epitope peptide, two minigenes of different lengths (KK-LC-11-252 and KK-LC-11-81) were amplified by PCR. The TNF production of CTL clone H1 was assessed against 293 EBNA cells cotransfected with each minigene and HLA-B*1507. CTL H1 responded to KK-LC-11-252 but not to KK-LC-11-81. Therefore, the portion of cDNA encoding the antigen epitope was narrowed down to a 171-bp sequence (KK-LC-182-252). Based on an HLA-B*1507 binding motif search by a computer analysis (BIMAS, NIH) and peptide anchor motif of HLA-B15, the peptide (RQKRILVNL: KK-LC-176-84) was synthesized as mentioned in Materials and Methods. CTL clone H1 recognized the EBV-B pulsed with KK-LC-176-84 in a dose-dependent manner. One half of maximal lysis was obtained at 10 ng/mL (Fig. 2B). The mutated p53 peptide (TRVLAMAIY), which has been identified as a tumor antigen restricted by HLA-Cw*0702 (14), was used as a negative control.

Expression of KK-LC-1 in non–small-cell lung cancer and recognition of the CTL against allogeneic lung cancer cell lines. We evaluated the mRNA expression of KK-LC-1 coding gene in allogeneic non–small-cell lung cancer cell lines and tumor tissues by RT-PCR method. KK-LC-1 was expressed in autologous F1121L but not in F1121 EBV-B (Fig. 3A ). The expression of the mRNA was detected in 9 of 18 allogeneic non–small-cell lung cancer cell lines (Fig. 3B). Among KK-LC-1-positive lung cancer cell lines, relative expression levels were determined by quantitative RT-PCR. G821L was used for negative control. The expression levels were evaluated by calculating relative ratio on the basis of the antigen expression in the F1121L. The relative expression levels of KK-LC-1 in two cell lines (B1203L and G603L) were higher than in F1121L (Table 1). In the tumor tissue specimens, 40 of 100 (40%) non–small-cell lung cancer tissues were positive for KK-LC-1 gene expression. According to histologic types, 23 of 60 (38%) adencarcinomas and 14 of 31 (45%) squamous cell carcinomas were positive for KK-LC-1 expression. However, it could not be detected in all normal lung tissue specimens. In a panel of normal tissues, the gene was not expressed in any normal organs except for the testis (Fig. 3C).


Figure 3
View larger version (9K):
[in this window]
[in a new window]
 
Figure 3. Expression of KK-LC-1 coding gene. Expression of mRNA level was investigated by RT-PCR. PCR amplification was programmed at 35 cycles. M, DNA size marker. The PCR product of KK-LC-1 was detected between 300 and 400 bp. A, KK-LC-1 expression of an autologous tumor cell line and autologous EBV-B. B, KK-LC-1 expression of non–small-cell lung cancer cell lines. Left, expression of KK-LC-1 in adenocarcinoma cell lines. Right, KK-LC-1 expression of squamous cell carcinoma (B1203L and H1215L), large cell carcinoma (A904L and C831L), pleomorphic carcinoma (G603L), adenosquamous carcinoma (A529L) and large cell neuroendocrine carcinoma (J206L) cell lines. C, KK-LC-1 expression in the panel of normal tissue specimens. Lane 1, thymus; lane 2, salivary gland; lane 3, liver; lane 4, fetal brain; lane 5, adrenal gland; lane 6, thyroid; lane 7, skeletal muscle; lane 8, lung; lane 9, fetal liver; lane 10, bone marrow; lane 11, trachea; lane 12, spleen; lane 13, placenta; lane 14, heart; lane 15, brain cerebellum; lane 16, uterus; lane 17, testis; lane 18, prostate; lane 19, kidney; lane 20, whole brain.

 
The CTL clone H1 also recognized allogeneic tumor cell lines expressing HLA-B*1501 or 1507. The CTL clone H1 produced IFN-{gamma} in response to B203L, which was HLA-B*1501 positive (Table 1). This result means that the antigenic peptide recognized by CTL clone H1 could also be presented on HLA-B*1501. This may be due to the difference of only one amino acid between HLA-B*1501 and 1507 (20). On the other hand, the CTL clone H1 did not produce IFN-{gamma} at all in response to another HLA-B*1501-positive cell line, G603L, without IFN-{gamma} treatment, although it expressed the highest level of KK-LC-1. However, the transfection of HLA-B*1507 rendered G603L to be sensitive to CTL clone H1. The relative expression levels of KK-LC-1 among lung cancer cell lines were not likely to affect magnitude of response of the CTL (Table 1).

These findings suggested that KK-LC-176-84 is not sufficiently expressed on the cell surface of G603L in the context of HLA-B*1501. IFN-{gamma} treatment (100 units/mL for 48 hours) was done in four cell lines that express the KK-LC-1 gene and in G821L as a negative control. After IFN-{gamma} treatment, the HLA class I expression on the cell surface was enhanced in all lung cancer cell lines tested. The magnitude of augmentation of HLA expression was different among lung cancer cell lines as shown in Table 2 . The CTL response was also augmented by IFN-{gamma} treatment of target cells. The augmentation of HLA expression and IFN-{gamma} production by CTL clone H1 was approximately correlative against B203L (11.8- and 13.2-fold, respectively). However, in G603L, the augmentation rate of IFN-{gamma} production (14.0-fold) was more than that of HLA expression (at most 2.1-fold for HLA-B*1501 but none for transfected HLA-B*1507; Table 2).


View this table:
[in this window]
[in a new window]
 
Table 2. Elevation of HLA expression of tumor cell lines by IFN-{gamma} treatment

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We previously reported that regional lymph node lymphocyte was a potential source of precursor CTL because regional lymph node lymphocyte of lung cancer was more activated than peripheral blood lymphocyte and it also included higher frequency of autologous tumor reactive lymphocytes (17). CTL clone H1 was induced by the weekly stimulation of autologous regional lymph node lymphocyte with autologous F1121L. The establishment of the CTL clone showed that precursor CTL resided in regional lymph node lymphocyte and it was activated by a sufficient quantity of peptide-HLA complex as previously reported (11).

An analysis of immune responses to autologous tumor cells in clinical cancer patients has allowed the identification of various tumor-associated antigens (3, 2126). However, there have been several reports about the tumor antigens identified by using CTL from lung cancer patients (2731). Three of such reports were about tumor-specific mutated antigens, which was unique to the individual patient. On the other hand, the shared tumor-associated antigens, as recognized by CTLs, have also been mainly identified in melanoma. Among these shared tumor-associated antigens, cancer/germline antigens may be a suitable target for tumor immunotherapy. They are expressed in tumor cells but not in most somatic normal tissues, except for the testis which does not express MHC genes (32). The tumor-restricted expression of antigen thus seems to be important for the immunotherapy of cancer to prevent autoimmune disease. During the last decade, 44 cancer/germline genes have been identified (33). According to the mRNA expression of each cancer/germline gene in a panel of normal tissues, Scanlan et al. categorized cancer/germline genes to four groups: (I) testis-restricted transcripts (BAGE, MAGE-B2, SSX-2, etc.); (II) tissue-restricted cancer/germline genes expressed in two or fewer of nongametogenic tissues (MAGE-A1, MAGE-C1, NY-ESO-1, etc.); (III) differentially expressed cancer/germline genes expressed in three to six of the nongametogenic tissues (XAGE-1, etc.); and (IV) ubiquitously expressed cancer/germline genes (OY-TES-1, etc.). The most favorable candidate for specific immunotherapy may be the antigen shared with various cancers and the expression of normal organs should be restricted in testis such as group I. An evaluation of mRNA expression showed that the antigen (KK-LC-1) coding gene was not expressed at all in normal lung tissues, but only selectively expressed in tumor cell lines, lung cancer tissues, and the testis. Most of cancer/germline genes such as MAGE gene family were located on the X chromosome (34). A cluster of 12 MAGE-A genes is located in the q28 region of the X chromosome. MAGE-B and MAGE-C genes were reported to be located in Xp21 and Xq26 region, respectively (34). NY-ESO-1 maps to chromosome Xq28 near MAGE-A subfamily (25). Five BAGE genes have been reported to map to the juxtacentromeric regions of human chromosomes 13 and 21; nine BAGE gene fragments map to the juxtacentromeric regions of chromosomes 9, 13, 18, and 21 (21); and OY-TES-1 maps to 12p12-13 (35). The KK-LC-1 coding gene is located on chromosome Xq22 and consists of 113 amino acids. However, the function of this gene has not yet been clarified.

Scanlan et al. (33) reported the expression of the cancer/germline genes in non–small-cell lung cancer tissues to be 49% for MAGE-A1, 47% for MAGE-A3, 4% for BAGE, 16% for SSX-2, and 17% for NY-ESO-1. These cancer/germline antigens may be able to elicit a cellular immune response against lung cancer cells (33). Regarding KK-LC-1 coding gene, the frequency of a positive expression in lung cancer tissues was 40% (adenocarcinoma, 38%; squamous cell carcinoma, 45%) and was 50% in our lung cancer cell lines. This high expression rate in lung cancer indicates that the gene coding KK-LC-1 might have the similar advantages in cellular immunotherapy as the other cancer/germline antigens in lung cancer patients.

B203L, which did not express HLA-B*1507 but did express HLA-B*1501, was recognized by CTL clone H1. The finding implied that CTL clone H1 recognized KK-LC-176-84 in the context of HLA-B*1507 and/or HLA-B*1501 because only one amino acid is different between HLA-B*1501 and HLA-B*1507. The 121st amino acid in HLA-B*1507 changes from arginine to serine as compared with HLA-B*1501 (20). Percentage of HLA-B*1501- or 1507-positive population is ~15% among Japanese (36) and 12% among Caucasians (37).

Some of these cancer/germline antigens have been applied for peptide-based immunotherapy (7, 38, 39). These studies showed not only the safety of peptide vaccination but also its clinical efficacy. Some investigators reported ~10% to 20% efficacy of vaccine therapy, which included complete, partial, and minor responses (40, 41). Several clinical trials have been also conducted using immature or mature dendritic cells pulsed with peptides derived from such cancer/germline antigens as MAGE (42). The CTL response by dendritic cell vaccination seemed to be better than those observed by peptide or ALVAC vaccination (43). As a significant feature, polyclonal CTL responses were often observed after dendritic cell vaccination (43).

CTL clone H1 responded to allogeneic lung cancer cell lines expressing the gene encoding KK-LC-1 after transfection of HLA-B*1507 and IFN-{gamma} treatment, as shown in Table 1. Among HLA-B*1501-positive cancer cell lines, CTL clone H1 produced the highest amount of IFN-{gamma} in response to B203L but not to G603L. The mRNA expression of KK-LC-1 coding gene in G603L exhibited the highest amount among all cell lines tested (Table 1). However, in terms of the HLA expression on cell surface, G603L was the lowest among the lung cancer cell lines tested (Table 2). The down-regulation of MHC class I expression in G603L may be one of the immune escape mechanisms. The IFN-{gamma} treatment of G603L augmented HLA expression and rendered them minimally sensitive to the CTL (Table 1). After IFN-{gamma} treatment of lung cancer cell lines, the HLA expression increased 11.8-fold in B203L and 2.1-fold in G603L (Table 2). CTL clone H1 increased the IFN-{gamma} production in proportion to the augmentation of the HLA expression against B203L. Although HLA expression increased 2.1-fold at most for HLA-B*1501 but none for transfected HLA-B*1507, CTL clone H1 showed a 14.0-fold augmentation of IFN-{gamma} production to IFN-{gamma}-treated-G603L (Table 1). This enhancement of CTL recognition might be mainly due to an increased antigen expression by means of the change of antigen processing machinery by IFN-{gamma} treatment from standard proteasome to immunoproteasome (44) and also partially due to the up-regulation of HLA expression. In terms of KK-LC-1 gene expression, G603L was 100-fold more than B203L. However, our results indicated that B203L was a far more suitable stimulator for CTL clone H1 as shown in Table 1. This may be ascribed to difference of transcriptional and posttranslational modification or alterations in the processing of the protein (45), in addition to difference of expression levels of HLA.

We identified a new antigen recognized by the tumor-specific CTL clone from a lung cancer patient. The CTL clone recognized several tumor cell lines and the antigen was expressed in 40% of lung cancers but not in any normal tissues except for the testis. The new tumor antigen encoded by cancer/germline gene KK-LC-1 may thus be a promising target for tumor-specific immunotherapy.


    Acknowledgments
 
Grant support: Grant-in-Aid from the Ministry of Health, Labour and Welfare, Japan and by a Grant-in-Aid from the Ministry of Education, Culture, Sports, Science and Technology, Japan.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Dr. Yoshika Nagata, Dr. Tetsuro Baba, Dr. Yoshiki Shigematsu, Kahoru Noda, Yukari Oshibuchi, Yuki Goto, Ayako Yamasaki, Aya Katayama, and Miki Shimada for their technical assistance.

Received 10/23/05. Revised 2/16/06. Accepted 3/ 3/06.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Parkin DM, Bray F, Ferlay J, Pisani P. Global cancer statistics, 2002. CA Cancer J Clin 2005;55:74–108.[Abstract/Free Full Text]
  2. Schiller JH, Harrington D, Belani CP, et al. Comparison of four chemotherapy regimens for advanced non-small-cell lung cancer. N Engl J Med 2002;346:92–8.[Abstract/Free Full Text]
  3. van der Bruggen P, Traversari C, Chomez P, et al. A gene encoding an antigen recognized by cytolytic T lymphocytes on a human melanoma. Science 1991;254:1643–7.[Abstract/Free Full Text]
  4. Boon T, Coulie PG, Van den Eynde B. Tumor antigens recognized by T cells. Immunol Today 1997;18:267–8.[Medline]
  5. Rosenberg SA. A new era of cancer immunotherapy: converting theory to performance. CA Cancer J Clin 1999;49:70–3.[Abstract]
  6. Rosenberg SA. Development of cancer immunotherapies based on identification of the genes encoding cancer regression antigens. J Natl Cancer Inst 1996;88:1635–44.[Abstract/Free Full Text]
  7. Marchand M, van Baren N, Weynants P, et al. Tumor regressions observed in patients with metastatic melanoma treated with an antigenic peptide encoded by gene MAGE-3 and presented by HLA-A1. Int J Cancer 1999;80:219–30.[CrossRef][Medline]
  8. Sugaya M, Takenoyama M, Osaki T, et al. Establishment of 15 cancer cell lines from patients with lung cancer and the potential tools for immunotherapy. Chest 2002;122:282–8.[Medline]
  9. Yoshino I, Takenoyama M, Fujie H, et al. The induction of cytotoxic T lymphocytes against HLA-A locus-matched lung adenocarcinoma in patients with non-small cell lung cancer. Jpn J Cancer Res 1997;88:743–9.[CrossRef]
  10. Takenoyama M, Yoshino I, Fujie H, et al. Autologous tumor-specific cytotoxic T lymphocytes in a patient with lung adenocarcinoma: implications of the shared antigens expressed in HLA-A24 lung cancer cells. Jpn J Cancer Res 1998;89:60–6.[CrossRef]
  11. Takenoyama M, Yoshino I, Eifuku R, et al. Successful induction of tumor-specific cytotoxic T lymphocytes from patients with non-small cell lung cancer using CD80-transfected autologous tumor cells. Jpn J Cancer Res 2001;92:309–15.[CrossRef]
  12. So T, Takenoyama M, Sugaya M, et al. Generation of autologous tumor-specific T cell clones from a patient with adenosquamous carcinoma of the lung. Jpn J Clin Oncol 2001;31:311–5.[Abstract/Free Full Text]
  13. So T, Takenoyama M, Ichiki Y, et al. A different pattern of cytotoxic T lymphocyte recognition against primary and metastatic tumor cells in a patient with nonsmall cell lung carcinoma. Cancer 2005;103:200–8.[CrossRef][Medline]
  14. Ichiki Y, Takenoyama M, Mizukami M, et al. Simultaneous cellular and humoral immune response against mutated p53 in a patient with lung cancer. J Immunol 2004;172:4844–50.[Abstract/Free Full Text]
  15. Espevik T, Nissen-Meyer J. A highly sensitive cell line, WEHI 164 clone 13, for measuring cytotoxic factor/tumor necrosis factor from human monocytes. J Immunol Methods 1986;95:99–105.[CrossRef][Medline]
  16. Hansen MB, Nielsen SE, Berg K. Re-examination and further development of a precise and rapid dye method for measuring cell growth/cell kill. J Immunol Methods 1989;119:203–10.[CrossRef][Medline]
  17. Takenoyama M, Yasumoto K, Harada M, et al. Expression of activation-related molecules on regional lymph node lymphocytes in human lung cancer. Immunobiology 1996;195:140–51.[Medline]
  18. Parker KC, Bednarek MA, Coligan JE. Scheme for ranking potential HLA-A2 binding peptides based on independent binding of individual peptide side chains. J Immunol 1994;152:163–75.[Abstract]
  19. Strausberg RL, Feingold EA, Grouse LH, et al. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci U S A 2002;99:16899–903.[Abstract/Free Full Text]
  20. Choo SY, Fan LA, Hansen JA. Allelic variations clustered in the antigen binding sites of HLA-Bw62 molecules. Immunogenetics 1993;37:108–13.[Medline]
  21. Boel P, Wildmann C, Sensi ML, et al. BAGE: a new gene encoding an antigen recognized on human melanomas by cytolytic T lymphocytes. Immunity 1995;2:167–75.[CrossRef][Medline]
  22. Ottaviani S, Zhang Y, Boon T, van der Bruggen P. A MAGE-1 antigenic peptide recognized by human cytolytic T lymphocytes on HLA-A2 tumor cells. Cancer Immunol Immunother 2005;54:1214–20.[CrossRef][Medline]
  23. Ayyoub M, Rimoldi D, Guillaume P, et al. Tumor-reactive, SSX-2-specific CD8+ T cells are selectively expanded during immune responses to antigen-expressing tumors in melanoma patients. Cancer Res 2003;63:5601–6.[Abstract/Free Full Text]
  24. Mizukami M, Hanagiri T, Baba T, et al. Identification of tumor associated antigens recognized by IgG from tumor-infiltrating B cells of lung cancer: correlation between Ab titer of the patient's sera and the clinical course. Cancer Sci 2005;96:882–8.[CrossRef][Medline]
  25. Chen YT, Scanlan MJ, Sahin U, et al. A testicular antigen aberrantly expressed in human cancers detected by autologous antibody screening. Proc Natl Acad Sci U S A 1997;94:1914–8.[Abstract/Free Full Text]
  26. Fossa A, Alsoe L, Crameri R, Funderud S, Gaudernack G, Smeland EB. Serological cloning of cancer/testis antigens expressed in prostate cancer using cDNA phage surface display. Cancer Immunol Immunother 2004;53:431–8.[CrossRef][Medline]
  27. Hogan KT, Eisinger DP, Cupp SB III, et al. The peptide recognized by HLA-A68.2-restricted, squamous cell carcinoma of the lung-specific cytotoxic T lymphocytes is derived from a mutated elongation factor 2 gene. Cancer Res 1998;58:5144–50.[Abstract/Free Full Text]
  28. Echchakir H, Mami-Chouaib F, Vergnon I, et al. A point mutation in the {alpha}-actinin-4 gene generates an antigenic peptide recognized by autologous cytolytic T lymphocytes on a human lung carcinoma. Cancer Res 2001;61:4078–83.[Abstract/Free Full Text]
  29. Nagata Y, Hanagiri T, Takenoyama M, et al. Identification of the HLA-Cw*0702-restricted tumor-associated antigen recognized by a CTL clone from a lung cancer patient. Clin Cancer Res 2005;11:5265–72.[Abstract/Free Full Text]
  30. So T, Takenoyama M, Mizukami M, et al. Haplotype loss of HLA class I antigen as an escape mechanism from immune attack in lung cancer. Cancer Res 2005;65:5945–52.[Abstract/Free Full Text]
  31. Takenoyama M, Baurain JF, Yasuda M, et al. A point mutation in the NFYC gene generates an antigenic peptide recognized by autologous cytolytyic T lymphocytes on a human squamous cell lung carcinoma. Int J Cancer. Epub 2005 Nov 14.
  32. Jassim A, Ollier W, Payne A, Biro A, Oliver RT, Festenstein H. Analysis of HLA antigens on germ cells in human semen. Eur J Immunol 1989;19:1215–20.[Medline]
  33. Scanlan MJ, Simpson AJ, Old LJ. The cancer/testis genes: standardization, and commentary. Cancer Immun 2004;4:1.[Medline]
  34. Chomez P, De Backer O, Bertrand M, De Plaen E, Boon T, Lucas S. An overview of the MAGE gene family with the identification of all human members of the family. Cancer Res 2001;61:5544–51.[Abstract/Free Full Text]
  35. Ono T, Kurashige T, Harada N, et al. Identification of proacrosin binding protein sp32 precursor as a human cancer/testis antigen. Proc Natl Acad Sci U S A 2001;98:3282–7.[Abstract/Free Full Text]
  36. Tanaka H, Akaza T, Juji T. Report of the Japanese Central Bone Marrow Data Center. Clin Transplant 1996:139–44.
  37. Mori M, Beatty PG, Graves M, Boucher KM, Milford EL. HLA gene and haplotype frequencies in the North American population: the National Marrow Donor Program Donor Registry. Transplantation 1997;64:1017–27.[Medline]
  38. Chen Q, Jackson H, Shackleton M, et al. Characterization of antigen-specific CD8+ T lymphocyte responses in skin and peripheral blood following intradermal peptide vaccination. Cancer Immun 2005;5:5.[Medline]
  39. Valmori D, Dutoit V, Ayyoub M, et al. Simultaneous CD8+ T cell responses to multiple tumor antigen epitopes in a multipeptide melanoma vaccine. Cancer Immun 2003;3:15.[Medline]
  40. Rosenberg SA, Yang JC, Schwartzentruber DJ, et al. Immunologic and therapeutic evaluation of a synthetic peptide vaccine for the treatment of patients with metastatic melanoma. Nat Med 1998;3:321–7.
  41. Jäger E, Gnjatic S, Nagata Y, et al. Induction of primary NY-ESO-1 immunity: CD8+ T lymphocyte and antibody responses in peptide-vaccinated patients with NY-ESO-1+ cancers. Proc Natl Acad Sci U S A 2000;97:12198–203.[Abstract/Free Full Text]
  42. Schuler-Thurner B, Schultz ES, Berger TG, et al. Rapid induction of tumor-specific type I T helper cells in metastatic melanoma patients by vaccination with mature, cryopreserved, peptide-loaded monocyte-derived dendritic cells. J Exp Med 2002;195:1279–88.[Abstract/Free Full Text]
  43. Godelaine D, Carrasco J, Lucas S, et al. Polyclonal CTL responses observed in melanoma patients vaccinated with dendritic cells pulsed with a MAGE-3.A1 peptide. J Immunol 2003;171:4893–7.[Abstract/Free Full Text]
  44. Tanaka K. Role of proteasomes modified by interferon-{gamma} in antigen processing. J Leukoc Biol 1994;56:571–5.[Abstract]
  45. Engelhard VH. Creating new peptide antigens by slicing and splicing proteins. Nat Immunol 2004;5:128–9.[CrossRef][Medline]



This article has been cited by other articles:


Home page
Cancer Res.Home page
A. F. Cheung, M. J.P. DuPage, H. K. Dong, J. Chen, and T. Jacks
Regulated Expression of a Tumor-Associated Antigen Reveals Multiple Levels of T-Cell Tolerance in a Mouse Model of Lung Cancer
Cancer Res., November 15, 2008; 68(22): 9459 - 9468.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fukuyama, T.
Right arrow Articles by Yasumoto, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fukuyama, T.
Right arrow Articles by Yasumoto, K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online